The Arp2/3 complex assembles branched actin filaments, which are key to many cellular processes, but its organismal roles remain poorly understood. Here, we employed conditional Arpc4 knockout mice to study the function of the Arp2/3 complex in the epidermis. We found that depletion of the Arp2/3 complex by knockout of Arpc4 results in skin abnormalities at birth that evolve into a severe psoriasis-like disease hallmarked by hyperactivation of transcription factor Nrf2. Knockout of Arpc4 in cultured keratinocytes was sufficient to induce nuclear accumulation of Nrf2, upregulation of Nrf2 target genes and decreased filamentous actin levels. Furthermore, pharmacological inhibition of the Arp2/3 complex unmasked the role of branched actin filaments in Nrf2 regulation. Consistent with this, we revealed that Nrf2 associates with the actin cytoskeleton in cells and binds to filamentous actin in vitro. Finally, we discovered that Arpc4 is downregulated in both human and mouse psoriatic epidermis. Thus, the Arp2/3 complex affects keratinocyte shape and transcriptome through an actin-based cell-autonomous mechanism that influences epidermal morphogenesis and homeostasis.
INTRODUCTION
The actin-related protein (Arp2/3) complex consists of two actin-related proteins (Arp2 and Arp3; also known as Actr2 and Actr3, respectively) and five additional actin-related protein complex subunits (Arpc1-5) (Goley and Welch, 2006). The Arp2/3 complex catalyses the polymerization of monomeric actin [globular (G)-actin] into branched filaments [filamentous (F)-actin] thereby generating branched F-actin networks and mechanical forces in the cell (Goley and Welch, 2006; Rotty et al., 2013).
The genome of most eukaryotes contains a single gene encoding each Arp2/3-complex subunit (Goley and Welch, 2006). Mice and humans have instead two functional Arp3, Arpc1 and Arpc5 loci, which give rise to paralogues with diverging sequences and slightly different functional properties (Abella et al., 2016). Biochemical reconstitution of the Arp2/3 complex revealed that Arpc2 and Arpc4 are crucial for the structural integrity of the complex, whereas the other subunits have only variable effects on actin nucleation (Gournier et al., 2001). Accordingly, knockdown of either Arpc2 or Arpc4 leads to the downregulation of the Arp2/3 complex in a variety of cell types (Goley and Welch, 2006). For this reason, Arpc2 and Arpc4 are referred to as core subunits, whereas Arp2, Arp3, Arpc1, Arpc3 and Arpc5 are regarded as peripheral subunits.
The Arp2/3 complex regulates many actin-dependent processes, such as cell migration, endocytosis, vesicle trafficking, organelle remodelling, and cell-cell and cell-matrix adhesion (Goley and Welch, 2006; Leyton-Puig et al., 2017; Rotty et al., 2013). In agreement with its central role in the cell, germline knockout of the Arp2/3 complex and that of its activators causes early embryonic lethality in most multicellular animal models (Stradal et al., 2004). Thus, whether and how the Arp2/3 complex affects developmental and homeostatic events remain two outstanding and largely unexplored issues. Although conditional knockout technologies can bypass embryonic lethality, targeting of the peripheral subunit Arpc3 has only produced an ‘Arpc3-less’ Arp2/3 complex and minor alterations in the central nervous system (Kim et al., 2013b, 2015; Zuchero et al., 2015) and small intestine (Zhou et al., 2015). Surprisingly, knockout of Arpc3 in the epidermis resulted in neonatal lethality and defective epidermal permeability barrier (EPB) despite a largely normal tissue architecture (Zhou et al., 2013).
Epidermis is a stratified self-renewing epithelium fulfilling essential protective functions (Simpson et al., 2011; Watt, 2014). The most abundant cells in the epidermis are keratinocytes, which self-organize in tightly juxtaposed layers. Strong cell-cell adhesion and firm binding between keratinocytes and the underlying basement membrane confer the necessary robustness on to the epidermis (Simpson et al., 2011; Watt, 2014). The keratinocytes bound to the basement membrane form the basal layer, which proliferates and can undergo either symmetric or asymmetric division, the former ensuring regenerative potential and the latter constant renewal of the epidermis (Sotiropoulou and Blanpain, 2012; Watt, 2014). The daughter cells positioned above the basal layer enter the spinous layer, where they exit the cell cycle and begin a complex differentiation process that reinforces intercellular junctions (Simpson et al., 2011). The upper granular layer consists of flattened keratinocytes characterized by a water-impermeable cornified envelope located beneath the plasma membrane. Finally, the outermost cornified layer contains dead squamous cells tightly linked together and devoid of internal organelles, which are constantly shed off (Segre, 2006). The keratinocyte differentiation programme controlling epidermal morphogenesis and homeostasis involves profound signalling-regulated rearrangements of both the composition and the architecture of the (actin) cytoskeleton (Simpson et al., 2011).
A master regulator of epidermal homeostasis is nuclear factor (erythroid-derived 2)-like 2 (NFE2L2 or Nrf2), a member of the cap-and-collar family of transcription factors (Sykiotis and Bohmann, 2010). Nrf2 binds to an antioxidant response element located in the regulatory regions of its target genes, most of which promote detoxification from reactive oxygen species and toxic compounds (Gorrini et al., 2013; Sykiotis and Bohmann, 2010). Not surprisingly, compelling evidence associates deregulation of Nrf2 expression and/or activity with a number of pathologies (Schäfer and Werner, 2015; Sykiotis and Bohmann, 2010). In homeostasis, the levels of Nrf2 are controlled by a Keap1-containing cullin 3-based E3 ligase complex that binds and ubiquitylates Nrf2 in the cytosol thereby marking it for proteasome-mediated degradation (Sykiotis and Bohmann, 2010). In stressed cells, Keap1 no longer ubiquitylates Nrf2, which can accumulate and translocate into the nucleus where it promotes gene transcription (Sykiotis and Bohmann, 2010).
Here, we report that ablation of the Arp2/3 complex in mouse epidermis causes a severe psoriasis-like disease hallmarked by Nrf2 hyperactivation and decreased F-actin levels. Unexpectedly, we find that the Arp2/3 complex modulates Nrf2-dependent gene transcription in keratinocytes by regulating Nrf2 localization through a mechanism that involves binding of Nrf2 to actin filaments. The finding that the Arp2/3 complex couples actin-based regulation of keratinocytes' shape and transcriptome, which can influence epidermal morphogenesis and homeostasis, opens a new view on its mode of action. Furthermore, the downregulation of Arpc4 in both human and mouse psoriatic epidermis suggests a possible role for the Arp2/3 complex in psoriasis pathogenesis.
RESULTS
Knockout of Arpc4 in mouse epidermis results in Arp2/3-complex null keratinocytes
We exploited a mutant (flox, f) allele of the gene encoding the Arp2/3-complex core subunit Arpc4 (Fig. 1A) to obtain homozygous Arpc4f/f mice on a pure B6 genetic background (Fig. 1B). As homozygous germline deletion of Arpc4 was embryonic lethal prior to embryonic day (E) 7.5 (not shown), transgenic Arpc4f/wt mice expressing Cre recombinase downstream of the keratin 14 (K14) promoter were crossed with the Arpc4f/f mice to ablate the expression of Arpc4 in the hair follicles and basal cells of the epidermis (Fig. 1C). The resulting offspring was composed of all four genotypes in the expected Mendelian ratio, including epidermis-specific Arpc4 knockout (hereafter referred to as Arpc4 eKO) mice (Fig. 1C). The Arpc4 eKO pups could be easily recognized by the macroscopic appearance of the skin, which displayed uneven thickening accompanied by alopecic areas (Fig. 1D, Movie 1). The expression of Arpc4 and Arpc1A were dramatically decreased in these epidermal regions (Fig. S1A). Keratinocytes isolated from the abnormal areas of the Arpc4 eKO pups were not only devoid of Arpc4 but also lacked the entire Arp2/3 complex (Fig. S1D), thus confirming that the core subunits are essential for the stability of the Arp2/3 complex.
Arpc4f/f::K14-Cre(neo) mice are viable and develop a psoriasis-like disease. (A) Schematic of the first three exons of wild-type (wt) and mutant (f, flox) Arpc4 locus. Exons are depicted approximately to scale. (B) Representative wild-type PCR showing the amplicons obtained from the wild-type (wt) and floxed (f) Arpc4 alleles. Location of forward and reverse primers is shown in A, size of the wild-type and floxed amplicons is indicated on the right. (C) Breeding scheme showing the genotype of parents (P) and offspring (F1). Expected and observed Mendelian ratios are indicated below each genotype (eHet and eKO indicate that one and two Arpc4 f alleles underwent CRE-mediated recombination in the epidermis, respectively). Differences are not statistically significant (n=86 mice). (D) Phenotype of Arpc4 wild-type (wt) and Arpc4 eKO pups at P5. Arpc4 wild-type and Arpc4 eHet pups were undistinguishable (not shown). (E) Histochemical analysis of the skin of Arpc4 wt and Arpc4 eKO mice. Representative skin sections of Arpc4 wt and Arpc4 eKO mice at P1, 7, 14 and 21 are shown. Inset at P1 shows ghost cells (arrowheads). Asterisks mark dermis with massive immune infiltrates. (F) Representative skin sections showing ultrastructural analysis of the skin of Arpc4 wt and Arpc4 eKO mice at P14. Scale bars: 100 µm (E, Arpc4 eKO panel at P21); 50 µm (E, other panels); 4 µm (F).
Arpc4f/f::K14-Cre(neo) mice are viable and develop a psoriasis-like disease. (A) Schematic of the first three exons of wild-type (wt) and mutant (f, flox) Arpc4 locus. Exons are depicted approximately to scale. (B) Representative wild-type PCR showing the amplicons obtained from the wild-type (wt) and floxed (f) Arpc4 alleles. Location of forward and reverse primers is shown in A, size of the wild-type and floxed amplicons is indicated on the right. (C) Breeding scheme showing the genotype of parents (P) and offspring (F1). Expected and observed Mendelian ratios are indicated below each genotype (eHet and eKO indicate that one and two Arpc4 f alleles underwent CRE-mediated recombination in the epidermis, respectively). Differences are not statistically significant (n=86 mice). (D) Phenotype of Arpc4 wild-type (wt) and Arpc4 eKO pups at P5. Arpc4 wild-type and Arpc4 eHet pups were undistinguishable (not shown). (E) Histochemical analysis of the skin of Arpc4 wt and Arpc4 eKO mice. Representative skin sections of Arpc4 wt and Arpc4 eKO mice at P1, 7, 14 and 21 are shown. Inset at P1 shows ghost cells (arrowheads). Asterisks mark dermis with massive immune infiltrates. (F) Representative skin sections showing ultrastructural analysis of the skin of Arpc4 wt and Arpc4 eKO mice at P14. Scale bars: 100 µm (E, Arpc4 eKO panel at P21); 50 µm (E, other panels); 4 µm (F).
Knockout of Arpc4 in mouse epidermis causes a psoriasis-like disease
Initial skin lesions were detected microscopically in the Arpc4 eKO mice at day 1 after birth [postnatal day (P) 1]. Local thickening of the epidermis, mainly the cornified layer, and the presence of scattered ‘ghost cells’ (anucleated cells) were particularly obvious in the head region (Fig. 1E). These initial lesions developed progressively into macroscopic psoriasis-like plaques: body and extremities of the Arpc4 eKO mice had dry, unevenly thickened and poorly furred skin at P5 (Fig. 1D). Furthermore, microscopic analyses revealed abnormal thickening of the cornified layer (hyperkeratosis), presence of nuclei in the cornified layer (parakeratosis) accompanied by microabscesses, and hyperplasia of the epidermal squamous cells (acanthosis) at P7 (Fig. 1E). In addition, hair follicles in the psoriasis-like lesions were rare and often lacked the shaft and the sebaceous gland (Fig. 1E, Fig. S1C). Inflammatory infiltrations mainly consisting of lymphocytic cells were observed in dermis (dermatitis) (Fig. 1E, Fig. S1Ci,Ciii). The psoriasis-like lesions progressed further over time and acquired an ichthyosis-like appearance (Fig. 1E). Ultrastructural analyses confirmed these observations and further showed that the Arpc4 eKO mice have no evident signs of compromised epidermal integrity (Fig. 1F). Consistent with this, the Arpc4 eKO pups mounted a fully functional outside-in EPB (Fig. S1D) and the EPB regulators YAP/TAZ (Zhou et al., 2013) attained normal activity both in vivo and in isolated keratinocytes (Fig. S2A,B). The presence of inside-out EPB could not be reliably probed because epidermal lesions are microscopic in Arpc4 eKO newborns. Thus, we cannot exclude the possibility of a mild inside-out EPB defect. In any case, the Arpc4 eKO animals had to be euthanized by P21 owing to the severity of the skin lesions.
Molecular characterization of the Arpc4 eKO skin with well-established differentiation markers [cornified envelope regulator transglutaminase 1 (Matsuki et al., 1998), cornified envelope component involucrin (Koch et al., 2000), suprabasal keratin 1 (Roth et al., 2012) and basal and stem-cell keratin 15 (Bose et al., 2013)] showed that ablation of the Arp2/3 complex perturbs the differentiation programme of keratinocytes (Fig. S1E). In addition, skin lesions showed increased Ki67 positivity in both the basal and the suprabasal epidermal layers (not shown).
Although the psoriasis-like lesions were of variable size and usually more severe in the dorsal than in the ventral trunk, extremities and head (Movie 1), the disease showed full penetrance. The patchy nature of the phenotype was somewhat surprising as K14-Cre-mediated recombination gives a mosaic pattern at day E15 and occurs in most of the epidermis after birth (Huelsken et al., 2001). However, flox alleles that remain largely mosaic after birth have been previously reported (Kobielak et al., 2003; Raymond et al., 2005). As lesions were located in the areas of the epidermis with no Arp2/3 complex expression (Fig. S1A) and the Arpc4 eHet mice were normal (not shown), mosaic recombination of the Arpc4 flox allele likely explains the above findings. Overall, these observations indicate that ablation of the Arp2/3 complex in the mouse epidermis perturbs epidermal cell differentiation and causes a psoriasis-like disease.
Arpc4 eKO epidermis displays a psoriasis-like gene expression profile
To characterize this phenotype at the molecular level, we determined the global gene expression profile of the epidermis of wild-type and Arpc4 eKO siblings. Comparative analysis of RNA sequencing (RNA-seq) data identified 141 differentially expressed transcripts, most of which (131) were upregulated upon knockout of Arpc4 (Fig. 2A, Table S1). RT-qPCR analysis of independent epidermal samples supported the validity of this gene signature (Fig. 2B). Ingenuity pathway analysis (IPA) allowed us to extract system-level pathophysiological information from the list of Arpc4-responsive genes. The category ‘Dermatological Diseases and Conditions’ ranked first among the IPA-annotated diseases and disorders and most of the other top categories were related to events often observed in psoriasis, such as inflammatory response (Fig. 2C, Table S2). In agreement with the anatomopathological analysis of the skin of the Arpc4 eKO mice, psoriasis was the most enriched ‘Disease or Functions’ annotation belonging to the ‘Dermatological Diseases and Conditions’ (Fig. 2D, Table S2). In summary, the gene expression profiles of the epidermis of the wild-type and the Arpc4 eKO mice confirm the diagnosis based on anatomopathological criteria.
Next-generation sequencing reveals that the epidermis of the Arpc4 eKO mice displays a psoriasis-like gene expression profile. (A) The Arp2/3 complex controls gene expression in the epidermis. Heat map of the 141 genes that are differentially expressed in the epidermis of Arpc4 wt and Arpc4 eKO mice. Epidermises of Arpc4 wt and Arpc4 eKO littermates taken from three different nests (litter number indicated below each column) were isolated at P3-5 and processed for RNA sequencing. Genes showing at least a log2 fold change>1.5 and P<0.05 in all comparisons were classified as differentially expressed genes. Heat map depicts the normalized gene expression of the 141 differentially expressed genes according to the colour code indicated in the top-left bar. (B) Validation of the psoriasis-like gene expression profile. Total RNA isolated from the epidermis of two Arpc4 wt and Arpc4 eKO littermates (litter number indicated in the box) was used to compare the relative expression of the indicated genes by RT-qPCR. Data are expressed as mean+s.e.m. and plotted using a log2 scale. (C) The top ten disease and pathological categories obtained from IPA of the annotated differentially expressed genes. Enrichment P-values are plotted using −log10 scale. (D) Pie chart showing the ‘Diseases or Functions Annotation’ belonging to the ‘Dermatological Diseases and Conditions’ category. P-values and number of identified genes are indicated in parentheses.
Next-generation sequencing reveals that the epidermis of the Arpc4 eKO mice displays a psoriasis-like gene expression profile. (A) The Arp2/3 complex controls gene expression in the epidermis. Heat map of the 141 genes that are differentially expressed in the epidermis of Arpc4 wt and Arpc4 eKO mice. Epidermises of Arpc4 wt and Arpc4 eKO littermates taken from three different nests (litter number indicated below each column) were isolated at P3-5 and processed for RNA sequencing. Genes showing at least a log2 fold change>1.5 and P<0.05 in all comparisons were classified as differentially expressed genes. Heat map depicts the normalized gene expression of the 141 differentially expressed genes according to the colour code indicated in the top-left bar. (B) Validation of the psoriasis-like gene expression profile. Total RNA isolated from the epidermis of two Arpc4 wt and Arpc4 eKO littermates (litter number indicated in the box) was used to compare the relative expression of the indicated genes by RT-qPCR. Data are expressed as mean+s.e.m. and plotted using a log2 scale. (C) The top ten disease and pathological categories obtained from IPA of the annotated differentially expressed genes. Enrichment P-values are plotted using −log10 scale. (D) Pie chart showing the ‘Diseases or Functions Annotation’ belonging to the ‘Dermatological Diseases and Conditions’ category. P-values and number of identified genes are indicated in parentheses.
The transcription factor Nrf2 is hyperactive in the epidermis of Arpc4 eKO mice
The RNA-seq data revealed an unexpected connection between the function of the Arp2/3 complex and that of Nrf2: among the genes showing a significantly altered expression in wild-type versus Arpc4 eKO mice, 65 were Nrf2-responsive genes (Table S1). Instead, only one target (Parp8) of G-actin-sensitive myocardin-related transcription factors (MRTFs) (Esnault et al., 2014; Posern and Treisman, 2006) was significantly affected. Thus, the G-actin pool controlling MRTF activity is apparently independent of the Arp2/3 complex.
Remarkably, mice with enhanced Nrf2 activity in keratinocytes present severe hyperkeratosis and acanthosis of the epidermis (Schäfer et al., 2012) resembling the initial abnormalities observed in the Arpc4 eKO mice. This and the observation that most differentially expressed genes are upregulated upon knockout of Arpc4 suggest that the Arp2/3 complex might restrain Nrf2 activity in keratinocytes. Consistent with this hypothesis, the epidermis of the Arpc4 eKO mice showed increased nuclear Nrf2 levels at P4 (Fig. 3A). The number of Nrf2-positive interfollicular keratinocytes declined with age in the normal epidermis, but Nrf2 expression remained ubiquitous in the psoriasis-like lesions (Fig. 3B). Of note, neither the mRNA [852±68 (n=3) and 686±52 (n=3) reads in wild-type and eKO epidermises, respectively; P=0.12, unpaired two-tailed t-test] nor the protein levels of Keap1 were downregulated in the Arpc4 eKO mice (Fig. 3B). This rules out that the Arp2/3 complex inhibits Nrf2 by controlling Keap1 expression. Most importantly, Nrf2-target genes identified by RNA-seq [Sprr2, keratin 6 (Krt6) and S100a9], as well as the genuine Nrf2-target gene Nqo1, attained increased protein levels in the affected epidermal areas (Fig. 3B). Thus, Nrf2 is hyperactive in the epidermal regions devoid of the Arp2/3 complex.
Ablation of the Arp2/3 complex in the epidermis results in Nrf2 hyperactivation. (A) Representative skin sections showing expression of Nrf2 in the epidermis of Arpc4 wt and Arpc4 eKO littermates at P4. (B) Immunohistochemical characterization of the skin of Arpc4 wt and Arpc4 eKO littermates at P14. Representative images show normal skin (Arpc4 wt) and psoriasis-like lesions (Arpc4 eKO) stained as indicated. Insets show magnifications of the regions marked by dashed boxes. Scale bars: 50 µm.
Ablation of the Arp2/3 complex in the epidermis results in Nrf2 hyperactivation. (A) Representative skin sections showing expression of Nrf2 in the epidermis of Arpc4 wt and Arpc4 eKO littermates at P4. (B) Immunohistochemical characterization of the skin of Arpc4 wt and Arpc4 eKO littermates at P14. Representative images show normal skin (Arpc4 wt) and psoriasis-like lesions (Arpc4 eKO) stained as indicated. Insets show magnifications of the regions marked by dashed boxes. Scale bars: 50 µm.
The Arp2/3 complex regulates Nrf2 localization and activity in keratinocytes
To prove that ablation of Arpc4 in basal keratinocytes increases Nrf2 activity, we isolated wild-type and Arpc4 KO keratinocytes. As expected, the knockout cells lacked both lamellipodia and ruffles and showed a global reduction in the F-actin levels, stress fibres included (Fig. S3A). Of note, reduced F-actin levels could also be observed in the psoriatic epidermis of the Arpc4 eKO mice (Fig. S3B). Phosphorylated Nrf2 levels were higher in the Arpc4 KO than the wild-type keratinocytes (Fig. 4A), suggestive of increased Nrf2 activity. Compared with wild-type keratinocytes, the Arpc4 KO keratinocytes and those overexpressing Nrf2 (see also Fig. 7B) displayed a very similar, mainly upregulated, gene expression pattern (Fig. 4B,C, Table S3). Furthermore, silencing of Nrf2 in the Arpc4 KO keratinocytes attenuated the expression of Nrf2-responsive genes identified by RNA-seq (Fig. 4D,E), but did not rescue the actin cytoskeleton (Fig. S3C). Collectively, these results show that the Arp2/3 complex regulates Nrf2 activity in keratinocytes.
Increased expression of Nrf2-target genes in Arpc4 knockout keratinocytes depends on Nrf2. (A) Characterization of Arpc4 wild-type and knockout keratinocytes. Total cell lysates (30 µg) obtained from wild-type (wt) and knockout (KO) keratinocytes were blotted as indicated. Data are representative of two independent experiments. (B) Arp2/3 KO and Nrf2-overexpressing keratinocytes display a similar gene expression profile. Transcriptome of wild-type (wt) keratinocytes was compared with that of Arpc4 KO (KO) and Nrf2-overexpressing (Nrf2) keratinocytes. Genes showing log2 fold change>2 and P<0.05 in both comparisons were classified as differentially expressed. Heat map depicts the normalized gene expression of the 109 differentially expressed genes, colour-coded as indicated in the bar. (C) Validation of the gene expression profile. Relative expression of the indicated genes in the above keratinocyte lines was compared by RT-qPCR. Data representing mean+s.e.m. (n=6 from two independent experiments) are plotted using a log2 scale. (D) Silencing of Nrf2 in the Arpc4 knockout keratinocytes. We generated two independent Nrf2 knockdown (Nrf2 KD #1 and Nrf2 KD #2) Arpc4 knockout (KO) keratinocytes and used control knockdown (ctr KD) Arpc4 wt and KO cells as a reference. Total cell lysates (30 μg) were blotted as indicated. Data are representative of two independent experiments. The lower band in the Nrf2 blot is due to either cross-reacting proteins or Nrf2 degradation products. (E) Knockdown of Nrf2 attenuates the expression of Nrf2-target genes in the Arpc4 KO keratinocytes. Relative expression of the indicated genes in ctr KD and Nrf2 KD (#1 and #2) Arpc4 KO keratinocytes was compared by RT-qPCR. Data are expressed as mean+s.e.m. (n≥6 from at least two independent experiments; ***P<0.001; ****P<0.0001; one-way ANOVA with Bonferroni's correction for multiple comparisons). Edg3 and C3-asp are also known as S1pr3 and complement 3.
Increased expression of Nrf2-target genes in Arpc4 knockout keratinocytes depends on Nrf2. (A) Characterization of Arpc4 wild-type and knockout keratinocytes. Total cell lysates (30 µg) obtained from wild-type (wt) and knockout (KO) keratinocytes were blotted as indicated. Data are representative of two independent experiments. (B) Arp2/3 KO and Nrf2-overexpressing keratinocytes display a similar gene expression profile. Transcriptome of wild-type (wt) keratinocytes was compared with that of Arpc4 KO (KO) and Nrf2-overexpressing (Nrf2) keratinocytes. Genes showing log2 fold change>2 and P<0.05 in both comparisons were classified as differentially expressed. Heat map depicts the normalized gene expression of the 109 differentially expressed genes, colour-coded as indicated in the bar. (C) Validation of the gene expression profile. Relative expression of the indicated genes in the above keratinocyte lines was compared by RT-qPCR. Data representing mean+s.e.m. (n=6 from two independent experiments) are plotted using a log2 scale. (D) Silencing of Nrf2 in the Arpc4 knockout keratinocytes. We generated two independent Nrf2 knockdown (Nrf2 KD #1 and Nrf2 KD #2) Arpc4 knockout (KO) keratinocytes and used control knockdown (ctr KD) Arpc4 wt and KO cells as a reference. Total cell lysates (30 μg) were blotted as indicated. Data are representative of two independent experiments. The lower band in the Nrf2 blot is due to either cross-reacting proteins or Nrf2 degradation products. (E) Knockdown of Nrf2 attenuates the expression of Nrf2-target genes in the Arpc4 KO keratinocytes. Relative expression of the indicated genes in ctr KD and Nrf2 KD (#1 and #2) Arpc4 KO keratinocytes was compared by RT-qPCR. Data are expressed as mean+s.e.m. (n≥6 from at least two independent experiments; ***P<0.001; ****P<0.0001; one-way ANOVA with Bonferroni's correction for multiple comparisons). Edg3 and C3-asp are also known as S1pr3 and complement 3.
To elucidate the underlying molecular mechanism, we expressed EGFP-tagged Arpc4 and empty EGFP in two independent populations of Arpc4 KO keratinocytes to generate rescued and knockout isogenic lines, respectively (Fig. 5A). Molecular characterization of these keratinocytes indicated that the introduction of EGFP-Arpc4 in the Arpc4 KO cells was sufficient to rescue the endogenous Arp2/3-complex subunits, whereas it did not affect either Nrf2 or Keap1 expression (Fig. 5A). Morphological characterization of the isogenic EGFP- and EGFP-Arpc4-expressing Arpc4 KO keratinocytes showed that the former are smaller, have reduced F-actin levels and lack lamellipodia, and often display bleb-like structures and fewer stress fibres (Fig. 5B, Fig. S4A). This latter observation is in line with the filaments assembled by the Arp2/3 complex being incorporated into stress fibres (Hotulainen and Lappalainen, 2006). Fractionation experiments confirmed biochemically that F-actin is decreased in the absence of the Arp2/3 complex (Fig. 5C,D, Fig. S4B). Consistent with the well-established localization of the Arp2/3 complex (Rotty et al., 2013), EGFP-Arpc4 decorated actin-rich lamellipodia and dotty cytoplasmic structures likely corresponding to vesicles and vesicular compartments (Fig. 5B, Fig. S4A).
Isogenic Arpc4 knockout and rescued keratinocytes show that the Arp2/3 complex regulates cell shape, formation of lamellipodia and F-actin content. (A) Characterization of isogenic Arpc4 knockout and rescued keratinocytes. Independent lines of Arpc4 knockout (KO) keratinocytes (#1 and #2) were transduced with retroviruses encoding either EGFP or EGFP-tagged Arpc4. Total cell lysates (30 µg) were blotted as indicated. Note that EGFP-Arpc4 migrates at about 45 kDa below a non-specific band. Data are representative of three independent experiments. (B) The Arpc4 knockout keratinocytes are smaller and do not form either lamellipodia or ruffles. Isogenic Arpc4 KO+EGFP and Arpc4 KO+EGFP-Arpc4 (line #1) were plated on collagen I-coated coverslips, fixed and processed in parallel, and imaged using identical settings. Representative compressed confocal z-stacks show nuclei (DAPI, blue in merge), actin cytoskeleton (phalloidin, red in merge) and either EGFP or EGFP-Arpc4 (EGFP, green in merge). Scale bar: 20 µm. Data are representative of three independent experiments. Line #2 gave similar results (see Fig. S3A). (C) Distribution of G-actin and F-actin in isogenic Arp2/3-complex knockout and rescued keratinocytes. Arpc4 KO+EGFP and Arpc4 KO+EGFP-Arpc4 keratinocytes (line #1) were plated on collagen I-coated dishes, harvested and lysed for separating G-actin from F-actin. Total cell lysates (30 µg) and the same percentage of soluble (S) and pelleted (P) material were blotted as indicated. Data are representative of three independent experiments. Line #2 gave similar results (see Fig. S3B). (D) The Arp2/3 complex knockout keratinocytes have less F-actin. Bar graph shows mean+s.e.m. of the F-actin/G-actin ratio (densitometric intensity of actin in P versus densitometric intensity of actin in S) in the Arpc4 KO+EGFP and the Arpc4 KO+EGFP-Arpc4 keratinocytes (line #1) (*P<0.05; unpaired two-tailed t-test; n=3).
Isogenic Arpc4 knockout and rescued keratinocytes show that the Arp2/3 complex regulates cell shape, formation of lamellipodia and F-actin content. (A) Characterization of isogenic Arpc4 knockout and rescued keratinocytes. Independent lines of Arpc4 knockout (KO) keratinocytes (#1 and #2) were transduced with retroviruses encoding either EGFP or EGFP-tagged Arpc4. Total cell lysates (30 µg) were blotted as indicated. Note that EGFP-Arpc4 migrates at about 45 kDa below a non-specific band. Data are representative of three independent experiments. (B) The Arpc4 knockout keratinocytes are smaller and do not form either lamellipodia or ruffles. Isogenic Arpc4 KO+EGFP and Arpc4 KO+EGFP-Arpc4 (line #1) were plated on collagen I-coated coverslips, fixed and processed in parallel, and imaged using identical settings. Representative compressed confocal z-stacks show nuclei (DAPI, blue in merge), actin cytoskeleton (phalloidin, red in merge) and either EGFP or EGFP-Arpc4 (EGFP, green in merge). Scale bar: 20 µm. Data are representative of three independent experiments. Line #2 gave similar results (see Fig. S3A). (C) Distribution of G-actin and F-actin in isogenic Arp2/3-complex knockout and rescued keratinocytes. Arpc4 KO+EGFP and Arpc4 KO+EGFP-Arpc4 keratinocytes (line #1) were plated on collagen I-coated dishes, harvested and lysed for separating G-actin from F-actin. Total cell lysates (30 µg) and the same percentage of soluble (S) and pelleted (P) material were blotted as indicated. Data are representative of three independent experiments. Line #2 gave similar results (see Fig. S3B). (D) The Arp2/3 complex knockout keratinocytes have less F-actin. Bar graph shows mean+s.e.m. of the F-actin/G-actin ratio (densitometric intensity of actin in P versus densitometric intensity of actin in S) in the Arpc4 KO+EGFP and the Arpc4 KO+EGFP-Arpc4 keratinocytes (line #1) (*P<0.05; unpaired two-tailed t-test; n=3).
The knockout keratinocytes showed more than a two-fold increase in the nuclear versus cytosolic Nrf2 ratio compared with that of the rescued ones (Fig. 6A,B), which correlated with a higher expression of a battery of genuine Nrf2-responsive genes, including the direct targets Sprr2, Sprr1 and Epgn (Papp et al., 2012; Schäfer et al., 2012, 2014) (Fig. 6C). Therefore, regulation of Nrf2 localization and activity by the Arp2/3 complex is cell-autonomous in keratinocytes.
The Arp2/3 complex controls the localization of Nrf2 and the expression of Nrf2-target genes in a cell-autonomous manner. (A) The Arp2/3 complex controls the partitioning of Nrf2 between nucleus and cytosol. Arpc4 KO+EGFP and the Arpc4 KO+EGFP-Arpc4 keratinocytes (line #1) were plated on collagen I-coated dishes, harvested, lysed and fractionated to obtain cytosol-enriched (Cytosol) and nuclear-enriched (Nucleus) fractions. An equal percentage (10% of the total volume) of either fraction was blotted as indicated. Data are representative of two independent experiments. (B) The Arp2/3 complex restrains Nrf2 into the cytosol. Bar graph shows mean+s.d. of the normalized nucleus/cytosol Nrf2 ratio in the Arpc4 KO+EGFP and the Arpc4 KO+EGFP-Arpc4 keratinocytes (line #1) (n=2). The intensity of Nrf2 was determined by densitometry from non-saturated exposures. Values were normalized with respect to the ratio measured in the Arpc4 KO+EGFP cells. (C) The Arp2/3 complex controls the expression of Nrf2-target genes. Total RNA isolated from the Arpc4 KO+EGFP and the Arpc4 KO+EGFP-Arpc4 keratinocytes (line #1 in black, line #2 in grey) was used to compare the relative expression of the indicated genes by RT-qPCR. Data are expressed as mean+s.e.m. (n≥6 from at least two independent experiments; *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001; two-way ANOVA).
The Arp2/3 complex controls the localization of Nrf2 and the expression of Nrf2-target genes in a cell-autonomous manner. (A) The Arp2/3 complex controls the partitioning of Nrf2 between nucleus and cytosol. Arpc4 KO+EGFP and the Arpc4 KO+EGFP-Arpc4 keratinocytes (line #1) were plated on collagen I-coated dishes, harvested, lysed and fractionated to obtain cytosol-enriched (Cytosol) and nuclear-enriched (Nucleus) fractions. An equal percentage (10% of the total volume) of either fraction was blotted as indicated. Data are representative of two independent experiments. (B) The Arp2/3 complex restrains Nrf2 into the cytosol. Bar graph shows mean+s.d. of the normalized nucleus/cytosol Nrf2 ratio in the Arpc4 KO+EGFP and the Arpc4 KO+EGFP-Arpc4 keratinocytes (line #1) (n=2). The intensity of Nrf2 was determined by densitometry from non-saturated exposures. Values were normalized with respect to the ratio measured in the Arpc4 KO+EGFP cells. (C) The Arp2/3 complex controls the expression of Nrf2-target genes. Total RNA isolated from the Arpc4 KO+EGFP and the Arpc4 KO+EGFP-Arpc4 keratinocytes (line #1 in black, line #2 in grey) was used to compare the relative expression of the indicated genes by RT-qPCR. Data are expressed as mean+s.e.m. (n≥6 from at least two independent experiments; *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001; two-way ANOVA).
Actin nucleation by the Arp2/3 complex controls Nrf2 localization and activity
We failed to show that the Arp2/3 complex interacts with Nrf2 (not shown), but found that phosphorylation of Nrf2 at Ser40 increases in keratinocytes treated with the Arp2/3 complex inhibitor CK-666 (Nolen et al., 2009) (Fig. 7A). Notably, phosphorylation of Ser40 promotes nuclear accumulation and activation of Nrf2 (Huang et al., 2002). Consequently, we hypothesized that the Arp2/3 complex could control Nrf2 through the polymerization of actin filaments and explored this possibility further. As five different commercial anti-Nrf2 antibodies cross-react with additional proteins in keratinocytes, we carried out single-cell analyses exploiting a keratinocyte line expressing EGFP-tagged Nrf2 at low levels (Fig. 7B, Fig. S5A). Upon CK-666 treatment, the number of cells having a higher EGFP-Nrf2 signal in the nucleus than in the cytosol doubled (Fig. 7C,D). The observed cell-to-cell variability is most likely inherent to the polyclonal nature of keratinocytes. Live-cell imaging confirmed that pharmacological inhibition of the Arp2/3 complex leads to nuclear accumulation of EGFP-Nrf2 (Fig. S5B, Movie 2). Similar to CK-666, actin depolymerization induced by latrunculin A caused nuclear accumulation of EGFP-Nrf2 in keratinocytes (Fig. 7E,F). By contrast, inhibition of formin-induced actin polymerization by SMIFH2 (Isogai et al., 2015b) had no significant effects (Fig. 7E,F). The sum of these results points towards a specific role for the actin filaments nucleated by the Arp2/3 complex in the control of Nrf2 localization.
Inhibition of the Arp2/3 complex triggers nuclear translocation of Nrf2, which partially localizes on actin filaments. (A) Inhibition of the Arp2/3 complex increases the phosphorylation of Nrf2 at Ser40. Wild-type keratinocytes were plated on collagen I-coated dishes and treated with DMSO (−), or SMIFH2 (3 µM), or CK-666 (100 µM), or latrunculin A (Lat. A, 0.25 µM) for 60 min. Total cell lysates (30 µg) were blotted as indicated. (B) Nrf2 expression levels in wild-type and EGFP-Nrf2-expressing keratinocytes. Wild-type (wt) and EGFP-Nrf2-expressing keratinocytes were plated on collagen I-coated dishes and treated with CK-666 (100 µM) or DMSO (−) for the indicated time. Total cell lysates (30 µg) were blotted as indicated. Note that EGFP-Nrf2 migrates as doublet of approximately 130 kDa. Data are representative of three independent experiments. (C,D) CK-666 induces nuclear translocation of Nrf2. EGFP-Nrf2-expressing cells were plated on collagen I-coated coverslips, treated with CK-666 (100 µM) or DMSO (−) for the indicated time and scored only if the nuclear versus cytosolic intensity ratio of EGFP-Nrf2 (nuclear/cytosolic Nrf2 intensity >1) was greater than one. Bar graph depicts percentage of scored cells (mean+s.e.m.) (*P<0.05; **P<0.01; one-way ANOVA with Bonferroni's correction for multiple comparisons; n=3). Representative compressed confocal z-stacks of the cells analysed in C are shown in D. Parallel experiments showed that CK-666 reduced lamellipodium formation and phalloidin staining (not shown; Fig. S6). (E,F) Latrunculin A, but not SMIFH2, mimics the effects of CK-666. Representative compressed confocal z-stacks of the cells analysed in E are shown in F. Parallel experiments showed that latrunculin A disrupted the actin cytoskeleton, whereas SMIFH2 reduced stress fibre-like actin structures (not shown; Fig. S6). (G) EGFP-Nrf2 partially colocalizes with F-actin. Representative confocal central sections depicting EGFP-Nrf2-expressing keratinocytes. Nuclei (DAPI, blue in merge), actin cytoskeleton (phalloidin, red in merge) and EGFP-Nrf2 (EGFP-Nrf2, green in merge) are shown. Arrowheads indicate lamellipodia/ruffles and stress fibres. Insets (i and ii) show magnifications of the boxed areas in G. Scale bars: 20 µm (G, main panel); 10 µm (D,F); 5 µm (G, insets).
Inhibition of the Arp2/3 complex triggers nuclear translocation of Nrf2, which partially localizes on actin filaments. (A) Inhibition of the Arp2/3 complex increases the phosphorylation of Nrf2 at Ser40. Wild-type keratinocytes were plated on collagen I-coated dishes and treated with DMSO (−), or SMIFH2 (3 µM), or CK-666 (100 µM), or latrunculin A (Lat. A, 0.25 µM) for 60 min. Total cell lysates (30 µg) were blotted as indicated. (B) Nrf2 expression levels in wild-type and EGFP-Nrf2-expressing keratinocytes. Wild-type (wt) and EGFP-Nrf2-expressing keratinocytes were plated on collagen I-coated dishes and treated with CK-666 (100 µM) or DMSO (−) for the indicated time. Total cell lysates (30 µg) were blotted as indicated. Note that EGFP-Nrf2 migrates as doublet of approximately 130 kDa. Data are representative of three independent experiments. (C,D) CK-666 induces nuclear translocation of Nrf2. EGFP-Nrf2-expressing cells were plated on collagen I-coated coverslips, treated with CK-666 (100 µM) or DMSO (−) for the indicated time and scored only if the nuclear versus cytosolic intensity ratio of EGFP-Nrf2 (nuclear/cytosolic Nrf2 intensity >1) was greater than one. Bar graph depicts percentage of scored cells (mean+s.e.m.) (*P<0.05; **P<0.01; one-way ANOVA with Bonferroni's correction for multiple comparisons; n=3). Representative compressed confocal z-stacks of the cells analysed in C are shown in D. Parallel experiments showed that CK-666 reduced lamellipodium formation and phalloidin staining (not shown; Fig. S6). (E,F) Latrunculin A, but not SMIFH2, mimics the effects of CK-666. Representative compressed confocal z-stacks of the cells analysed in E are shown in F. Parallel experiments showed that latrunculin A disrupted the actin cytoskeleton, whereas SMIFH2 reduced stress fibre-like actin structures (not shown; Fig. S6). (G) EGFP-Nrf2 partially colocalizes with F-actin. Representative confocal central sections depicting EGFP-Nrf2-expressing keratinocytes. Nuclei (DAPI, blue in merge), actin cytoskeleton (phalloidin, red in merge) and EGFP-Nrf2 (EGFP-Nrf2, green in merge) are shown. Arrowheads indicate lamellipodia/ruffles and stress fibres. Insets (i and ii) show magnifications of the boxed areas in G. Scale bars: 20 µm (G, main panel); 10 µm (D,F); 5 µm (G, insets).
In agreement with the above results, CK-666 treatment also stimulated the expression of Nrf2-target genes in both wild-type and EGFP-Nrf2-expressing keratinocytes (Fig. S5C). This functionally links Arp2/3-complex-mediated actin polymerization and Nrf2 activity and also support the physiological relevance of this new Nrf2-regulatory mechanism.
Surprisingly, EGFP-Nrf2 partially colocalized with F-actin in lamellipodia and along stress fibres (Fig. 7G). This localization pattern was clearly perturbed by CK-666 and latrunculin A, but not SMIFH2 (Fig. S6). Thus, the presence of Nrf2 on F-actin structures seems to be largely dependent on the actin nucleation activity of the Arp2/3 complex. Co-sedimentation assays showed that purified full-length GST-Nrf2 (Fig. 8A) binds directly to F-actin at concentrations that mimic the low steady-state levels of Nrf2 in the cell (Kim et al., 2011) (Fig. 8B). Congruently, the equilibrium dissociation constant of the Nrf2-F-actin interaction lies in the high nanomolar range (Fig. 8C). In vivo, however, only the actin filaments nucleated by the Arp2/3 complex are permissive for the binding of Nrf2. It is noteworthy that the initial branched geometry of these filaments excludes the actin-binding proteins that decorate linear actin networks (Michelot and Drubin, 2011) and may outcompete Nrf2.
Nrf2 binds directly to filamentous actin. (A) Coomassie gel showing purified recombinant full-length GST-Nrf2 (4 µg). (B) Co-sedimentation assays were performed mixing GST-Nrf2 (Nrf2 FL, 0.15 µM) with BSA (0.6 µM) and either F-actin (F-actin, 2.5 µM) or F-actin buffer. The same percentages of soluble (S) and pelleted (P) fractions were subjected to SDS-PAGE followed by immunoblotting as indicated. Ponceau serves as a loading control. Data are representative of three independent experiments performed using three different actin and Nrf2 batches. (C) The affinity of interaction between Nrf2 and F-actin is 0.25 µM. Full-length GST-Nrf2 (0, 0.5, 1, 2 and 4 µM) was sedimented with (+ F-actin, 2.5 µM) or without (− F-actin) F-actin. The same percentage of each pelleted fraction was immunoblotted as indicated. Band intensities were measured with QuantityOne. Specific Nrf2-bound fractions [Bound GST-Nrf2 (%)] were obtained subtracting the intensity of Nrf2 without F-actin to the intensity of Nrf2 with F-actin, followed by normalization. Grey and lilac dots corresponding to two independent experiments were used for the fitting (shown as a black line). The computed equilibrium dissociation constant (KD) is expressed as mean+s.d. R2 indicates the coefficient of determination of the fitting.
Nrf2 binds directly to filamentous actin. (A) Coomassie gel showing purified recombinant full-length GST-Nrf2 (4 µg). (B) Co-sedimentation assays were performed mixing GST-Nrf2 (Nrf2 FL, 0.15 µM) with BSA (0.6 µM) and either F-actin (F-actin, 2.5 µM) or F-actin buffer. The same percentages of soluble (S) and pelleted (P) fractions were subjected to SDS-PAGE followed by immunoblotting as indicated. Ponceau serves as a loading control. Data are representative of three independent experiments performed using three different actin and Nrf2 batches. (C) The affinity of interaction between Nrf2 and F-actin is 0.25 µM. Full-length GST-Nrf2 (0, 0.5, 1, 2 and 4 µM) was sedimented with (+ F-actin, 2.5 µM) or without (− F-actin) F-actin. The same percentage of each pelleted fraction was immunoblotted as indicated. Band intensities were measured with QuantityOne. Specific Nrf2-bound fractions [Bound GST-Nrf2 (%)] were obtained subtracting the intensity of Nrf2 without F-actin to the intensity of Nrf2 with F-actin, followed by normalization. Grey and lilac dots corresponding to two independent experiments were used for the fitting (shown as a black line). The computed equilibrium dissociation constant (KD) is expressed as mean+s.d. R2 indicates the coefficient of determination of the fitting.
In summary, binding of Nrf2 to F-actin indicates that Nrf2 regulation by the Arp2/3 complex involves actin nucleation.
Arpc4 expression is downregulated in both human and mouse psoriatic skin
The phenotype of the Arpc4 eKO mice suggests that the Arp2/3 complex might be involved in the pathogenesis of psoriasis. However, population-based studies in humans have not yet revealed an association between ARPC4 and psoriasis. Hence, we first analysed ARPC4 expression and distribution in the skin of healthy donors by immunohistochemistry. Human epidermis showed a rather uniform positivity for ARPC4 both in the basal and supra-basal layers (Fig. 9A, Fig. S7). This expression pattern strongly resembles that of mouse Arpc4 (Fig. S1A). Notably, ARPC4 was particularly abundant within the nucleus in roughly half of the analysed healthy skin samples, as well as in asymptomatic psoriatic skin (Fig. S7). This suggests that nuclear ARPC4 is not predisposing to or protecting from psoriasis. Next, healthy skin was compared with both asymptomatic and lesional skin of psoriatic patients. We found that ARPC4 expression and distribution are similar in the epidermis of asymptomatic skin of psoriatic patients and healthy donors (Fig. 9A,B, Fig. S7). Nevertheless, reduced basal ARPC4 levels were observed in two asymptomatic psoriatic skin samples (Fig. S7), thus raising the possibility that downregulation of the ARP2/3 complex is pathogenic in human epidermis. More importantly, ARPC4 immunoreactivity was significantly decreased in the epidermis of lesional psoriatic skin, especially in the basal proliferative layer (Fig. 9A,B, Fig. S7).
Human and mouse psoriatic skin show reduced Arpc4 expression. (A) ARPC4 is downregulated in human psoriatic skin. Representative images showing anti-Arpc4 immunoreactivity (brown staining) in normal skin (NS), asymptomatic psoriatic skin (APS) and psoriatic skin (PS) sections. Samples were processed, stained and acquired in parallel. Note that APS and PS are from the same patient. (B) ARPC4 levels are significantly reduced in the epidermis of psoriatic patients. ARPC4 immunoreactivity in the NS, APS and PS samples images shown in Fig. S7 was quantified, normalized and plotted as arbitrary units (a. u.) so that black and white would correspond to one and zero, respectively. Graph depicts means (black bars) and individual ARPC4 values colour-coded according to frame colour of the corresponding images. Identical colours denote matched APS and PS samples (**P<0.01; one-way ANOVA with Bonferroni's correction for multiple comparisons). (C) Arpc4 is downregulated in IMQ-treated mouse epidermis. Skin sections of control and IMQ-treated B6 mice were stained with anti-Arpc4, anti-Krt10 and anti-Ki67 antibodies. Samples were processed, stained and acquired in parallel. Representative images are shown. Scale bars: 500 µm (A); 50 µm (C).
Human and mouse psoriatic skin show reduced Arpc4 expression. (A) ARPC4 is downregulated in human psoriatic skin. Representative images showing anti-Arpc4 immunoreactivity (brown staining) in normal skin (NS), asymptomatic psoriatic skin (APS) and psoriatic skin (PS) sections. Samples were processed, stained and acquired in parallel. Note that APS and PS are from the same patient. (B) ARPC4 levels are significantly reduced in the epidermis of psoriatic patients. ARPC4 immunoreactivity in the NS, APS and PS samples images shown in Fig. S7 was quantified, normalized and plotted as arbitrary units (a. u.) so that black and white would correspond to one and zero, respectively. Graph depicts means (black bars) and individual ARPC4 values colour-coded according to frame colour of the corresponding images. Identical colours denote matched APS and PS samples (**P<0.01; one-way ANOVA with Bonferroni's correction for multiple comparisons). (C) Arpc4 is downregulated in IMQ-treated mouse epidermis. Skin sections of control and IMQ-treated B6 mice were stained with anti-Arpc4, anti-Krt10 and anti-Ki67 antibodies. Samples were processed, stained and acquired in parallel. Representative images are shown. Scale bars: 500 µm (A); 50 µm (C).
To corroborate the link between reduced Arpc4 expression and psoriasis, we used the imiquimod (IMQ)-induced psoriasiform mouse model, which closely resembles the human psoriatic lesions in terms of phenotypic and histological characteristics, including epidermal hyperplasia (acanthosis) and the presence of inflammatory infiltrates in the dermis (van der Fits et al., 2009). As expected, B6 mice treated with IMQ showed (1) a remarkably increased epidermal thickness (198.45±48.03 µm and 40.06±13.04 µm in IMQ-treated and control mice, respectively; P<0.001), (2) thickening of the cornified layer (71.85±34.56 µm versus 29.22±17.09 µm; P<0.001), (3) perturbed Krt10 expression (indicative of impaired terminal differentiation; Fig. 9C), (4) enhanced proliferation (hallmarked by Ki67-positive keratinocytes; Fig. 9C), and (5) widespread inflammatory infiltrate (not shown), compared with control mice. In addition to these psoriasis-like manifestations, Arpc4 expression was diminished in the IMQ-treated epidermis, especially in the basal layer keratinocytes (Fig. 9C).
Therefore, the association between low Arpc4 expression and psoriasis appears to be conserved in mice and humans.
DISCUSSION
Here, we report that the Arpc4 epidermal knockout mice are Arp2/3-complex null and develop severe psoriasis-like lesions hallmarked by ubiquitous Nrf2 expression and upregulation of Nrf2-target genes. Furthermore, we discovered that the Arp2/3 complex inhibits Nrf2 activity through a cell-autonomous mechanism involving interaction between Nrf2 and F-actin. The downregulation of Arpc4 in human and mouse psoriatic skin suggests that the function of the Arp2/3 complex in the epidermis is conserved. Most importantly, our findings ascribe an unforeseen gene transcription-regulatory role to the actin network generated by the Arp2/3 complex in health and disease.
We propose a sequestration model to explain how the Arp2/3 complex harnesses the activity of Nrf2 in keratinocytes: actin nucleation by the Arp2/3 complex results in the formation of branched actin filaments that can be subsequently remodelled and incorporated into linear actin structures. The filaments generated by the Arp2/3 complex sequester part of the cytosolic Nrf2 pool and restrain the activity of Nrf2. Genetic ablation and pharmacological inhibition of the Arp2/3 complex relieve Nrf2, which can translocate into the nucleus where it increases the transcription of genes involved the psoriatic response. Notably, we provide robust experimental evidence in support of the tenets of this model.
First, the marked reduction in F-actin observed in the Arpc4 eKO mice (Fig. S3B) shows that the Arp2/3 complex is active in the ‘unchallenged’ epidermis and can effectively participate in Nrf2 regulation. Thus, this new actin-based Nrf2-regulatory mechanism may functionally connect the reduction in F-actin levels with the rise in Nrf2 activity during keratinocyte differentiation (Schäfer and Werner, 2015; Vaezi et al., 2002). It also suggests that the knockout of Arpc3 does not phenocopy that of Arpc4 because the ‘Arpc3-less’ Arp2/3 complex ensures normal epidermal F-actin levels (Zhou et al., 2013). Instead, the EPB defect and the perinatal lethality observed in the Arpc3 eKO mice likely stem from spurious dominant effects exerted by mislocalized ‘Arpc3-less’ Arp2/3 complex on tight junctions and YAP/TAZ (Zhou et al., 2013).
Second, genetics and chemical biology show that the Arp2/3 complex assembles actin filaments endowed with unique Nrf2-regulatory features. The knockout of Arpc4 revealed that the Arp2/3 complex regulates both the branched and the linear F-actin networks (Fig. 5B, Fig. S3A) to which Nrf2 can associate (Fig. 7G, Fig. 8, Fig. S6). Nevertheless, mice lacking either Fmn1 or mDia1 (Diaph1), formins that polymerize linear actin filaments in epithelial cells (Isogai et al., 2015c; Kobielak et al., 2004), do not have skin defects (Eisenmann et al., 2007; Wynshaw-Boris et al., 1997). Furthermore, the pan-formin inhibitor SMIFH2 failed to affect the localization of EGFP-Nrf2 (Fig. 7E,F, Fig. S6), the phosphorylation of Nrf2 at Ser40 (Fig. 7A) and the expression of Nrf2-target genes in keratinocytes (not shown). Hence, remodelling of Nrf2-bound branched actin filaments likely explains the localization of Nrf2 on linear F-actin structures. Most importantly, these observations show that the initial branched geometry of the actin filaments nucleated by the Arp2/3 complex is a key Nrf2-regulatory feature. Remarkably, we also discovered that the Arp2/3 complex restrains Nrf2 phosphorylation on Ser40 (Fig. 4A, Fig. 7A), which favours nuclear accumulation and activation of Nrf2 (Huang et al., 2002). Thus, Nrf2 regulation by the Arp2/3 complex involves both binding to F-actin and a post-translational modification. In this regard, it has been proposed that Keap1 forms a complex with F-actin and Nrf2 thereby promoting ubiquitylation and proteasome-mediated degradation of Nrf2 in the cytosol (Kang et al., 2004). However, this is highly unlikely because the same region of Keap1 interacts with actin and Nrf2 (Kang et al., 2004) and cellular actin is abundant enough to fully outcompete Nrf2. Not surprisingly, subsequent studies have excluded the possibility that the actin cytoskeleton allows Keap1 to control Nrf2 (Velichkova and Hasson, 2005). In any case, we found that Keap1 is diffused and uniformly distributed in keratinocytes expressing EGFP-Nrf2 (Fig. S8). This latter observation is consistent with the cell type-specific localization of Keap1 at actin-positive structures (Velichkova et al., 2002). Therefore, the Arp2/3 complex and Keap1 regulate Nrf2 through entirely distinct mechanisms. As neither Nrf2 nor Keap1 levels vary upon knockout of Arpc4 in keratinocytes (Fig. 5), it also appears that the Arp2/3 complex and Keap1 act independently on Nrf2.
Third, the knockout of Arpc4 resulted in decreased F-actin levels both in vivo and in isolated keratinocytes (Fig. S3B, Fig. 5D). Although this involved both branched and linear F-actin structures (Fig. 5B, Fig. S3A), the knockout of Arpc4 had negligible effects on the expression of MRTF-target genes (Fig. 2A, Fig. 4B). Intriguingly, we also found that the expression of Nrf2-target genes is insensitive to formin inhibition (not shown). Therefore, keratinocytes have distinct F-actin and G-actin pools regulated by either the Arp2/3 complex or formins, as well as independent mechanisms to sense and respond to the changes in either F-actin network.
Fourth, knockout of Arpc4 in basal keratinocytes causes a psoriasis-like disease hallmarked by Nrf2 hyperactivation (Figs 1 and 2, Fig. S1) and downregulation of Arpc4 occurs in both human psoriatic skin and the IMQ-induced psoriasis mouse model (Fig. 9). Moreover, elevated expression of Nrf2 has been recently observed in psoriasis and suggested to cause pathogenic hyperproliferation of keratinocytes (Yang et al., 2017). Hence, the phenotype of the Arpc4 eKO mice could be partly due to Nrf2 hyperactivation enhancing keratinocyte proliferation in vivo. The similarities between the early phenotype of the Arpc4 eKO mice and that of mice expressing constitutively active Nrf2 in basal keratinocytes support this view (Schäfer et al., 2012). As only the knockout of Arpc4 causes a psoriasis-like disease in mice, Nrf2-independent regulation of gene transcription and actin dynamics by the Arp2/3 complex also has a key pathophysiological role. The use of the Nrf2 activator dimethyl fumarate (DMF) to treat moderate-to-severe plaque psoriasis does not contradict the pathogenic role of Nrf2 in psoriasis. Actually, the anti-inflammatory and immune-modulatory properties of DMF might not require Nrf2 (Schulze-Topphoff et al., 2016) and could counteract cell proliferation driven by the further activation of Nrf2 in psoriatic skin. Alternatively, the beneficial anti-inflammatory and cytoprotective functions of Nrf2 may prevail over its pathogenic proliferative role in the epidermis only above a certain expression level and/or in full-blown psoriatic lesions.
In any case, downregulation of the Arp2/3 complex in keratinocytes qualifies it as one of the elusive epidermal cell-intrinsic psoriasis triggers. In line with this idea, the psoriasis-like disease in the Arpc4 eKO mice is not due to a generic pro-inflammatory response in keratinocytes. In fact, Arpc4 ablation did not increase the levels of active, phosphorylated NF-κB in isolated keratinocytes (Fig. 4A) nor did it produce upregulation and enrichment of NF-κB-target genes in the epidermis (Fig. 2A). Similarly, we also ruled out early disruption of the basement membrane in the Arpc4 eKO pups as the primary cause of the psoriasis-like disease (Fig. S9). Given that the Arp2/3 complex is essential for embryogenesis, we propose that epigenetic events and/or somatic mutations determine Arp2/3 complex levels in the epidermis. Arpc4 downregulation by IMQ in mouse epidermis (Fig. 9C) supports this view.
In summary, we have discovered that the Arp2/3 complex affects epidermal morphogenesis and homeostasis by coupling actin-based regulation of keratinocytes' shape and transcriptome. These unforeseen findings pave the way for a deeper understanding of the cellular and organismal functions of the Arp2/3 complex in health and disease.
MATERIALS AND METHODS
Mice
Arpc4tm1a(EUCOMM)Wtsi) mice (knockout-first mice with conditional potential, promoterless cassette) were obtained from the Wellcome Trust Sanger Institute. These mice were backcrossed with Flp recombinase transgenic C57Bl/6NRj mice to remove the cassette flanked by Frt sites thereby creating conditional Arpc4wt/f mice. Arpc4wt/f mice were backcrossed on a C57Bl/6 background at least ten times, before intercrossing Arpc4wt/f mice to obtain homozygous Arpc4f/f animals. Arpc4f/f mice were phenotypically identical to wild-type B6 mice and bred well. Heterozygote K14-Cre(neo) transgenic B6 mice (Margadant et al., 2009) were backcrossed at least ten times with C57Bl/6 mice before breeding with homozygous Arpc4f/f mice. Analysed mouse cohorts consisted of both sexes. Genotyping of the Arpc4 alleles was performed with the wild-type primers Arpc4_39529_F (AAGCCTTGCCCGAGATAATG) and Arpc4_39529_R (AAGCAAAGCCAGTCCCTCAC), positions of which are depicted in Fig. 1A.
IMQ-induced mouse model of human psoriasis
Eight-week-old female C57BL/6 mice (Harlan Laboratories, San Pietro al Natisone, Italy) were divided randomly into control (n=6) and IMQ-treated (n=12) groups. Whereas control mice received a control cream (Vaseline; Walgreens Pharmacy), IMQ-treated mice received on the shaved back skin a daily topical dose of 50 mg of 5% IMQ cream (Aldara, Meda AB, Solna, Sweden). On day 5, skin biopsies of the treated area were collected with a 8-mm biopsy puncher, as previously described (Palombo et al., 2016). Epidermal and scale thickness, and cell infiltrate number were analysed as parameters of skin acanthosis and inflammation (not shown). The significance of differences between experimental groups (mice treated with control cream versus mice treated with IMQ) was calculated by unpaired Student's t-test (with P<0.05 considered significant).
Generation and culturing of keratinocytes
Keratinocytes were isolated from back skin epidermis of Arpc4f/f and Arpc4f/f::K14-Cre(neo) littermates up to P4. In brief, skins were removed, put on sterile 3MM paper and trypsinized (EDTA-free 0.25% trypsin) for 16 h at 4°C to separate the epidermis from the dermis. Epidermises were minced, and cells were detached by stirring on ice for 1 h. Cell suspensions were filtered and seeded on dishes coated with 10 μg cm−2 collagen IV (Becton Dickinson) and cultured in EpiLife medium with 40 μM CaCl2 and EpiLife-defined growth supplement (EDGS).
Primary keratinocytes grown in EpiLife medium containing 40 μM CaCl2 and EDGS were immortalized with SV40 large T antigen as previously described (Mertens et al., 2005). Immortalized Arpc4f/f keratinocyte cultures were subsequently treated with Adeno-cre virus produced in HEK293A cells to knock out Arpc4. Rescue of the Arpc4f/f::K14-Cre(neo) (line #1) and Arpc4−/− (line #2) populations devoid of Arpc4 was performed by retroviral transduction with pMX encoding either EGFP or human ARPC4 tagged with EGFP at the C terminus. After two or three rounds of transduction, EGFP-positive keratinocytes were sorted. EGFP-Nrf2-expressing keratinocytes were generated from an immortalized Arpc4f/f keratinocyte line by retroviral transduction with pMX encoding human NRF2 tagged with EGFP at the N terminus. Low passage (<18) keratinocytes were used for experiments.
Nrf2 knockdown (KD) keratinocytes were obtained by transducing Arpc4 KO cells with lentiviruses encoding shRNA TRCN0000012129 (#1) and shRNA TRCN0000054658 (#2) targeting mouse NFE2L2. Control KD Arpc4 KO keratinocytes were obtained by transduction with empty pLKO-derived lentiviral particles prepared as previously described (Leyton-Puig et al., 2017). Low passage (<18) keratinocytes were used for experiments.
Keratinocytes were divided using TrypLE Express enzyme (Invitrogen) and trypsin inhibitor (1 mg ml−1; Sigma) and plated in CELLnTEC Keratinocyte medium on collagen I-coated dishes. After 24 h, EpiLife medium containing 40 μM CaCl2 and EDGS supplement was added. Only mycoplasma-free cells were used in all experiments.
(Immuno)histochemistry
Back skins (or decapitated bodies, P1) were fixed in EAF (4% formaldehyde, 5% glacial acetic acid) and embedded in paraffin. Sections (5 µm) were deparaffinized and rehydrated, and subjected to antigen retrieval and inactivation of endogenous peroxidase prior to the addition of primary antibodies. A two-way staining protocol [biotin/horseradish peroxidase (HRP)] was used employing 3,3′-diaminobenzidine (DAB) as a substrate (details are provided in Table S4). All sections were counterstained with Haematoxylin, washed and mounted with Entellan. Investigators were blind to group allocations during both experiments and subsequent analyses.
Electron microscopy
Tissues were fixed in Karnovsky's fixative (2% paraformaldehyde, 2.5% glutaraldehyde in 0.1 M cacodylate buffer at pH 7.2). Post-fixation was performed with 1% osmium tetroxide in 0.1 M cacodylate buffer at pH 7.2. After washing, tissue blocks were stained en bloc with Ultrastain 1 (Leica), followed by ethanol dehydration series. Finally, tissue was embedded in a mixture of DDSA/NMA/Embed-812 (EMS), sectioned and stained with Ultrastain 2 (Leica) and analysed with a Tecnai 12G2 electron microscope (FEI). Investigators were blind to group allocations during the experiments and subsequent analyses.
Skin permeability assay
Newborn mice were euthanized by intraperitoneal administration of a lethal dose of sodium pentobarbital (Pharmacy of the Faculty of Veterinarian Medicine, Utrecht University; 2 mg/g body weight). The tail of each pup was clipped and stored for PCR-based genotypic analysis. Carcasses were rinsed in ice-cold PBS and dehydrated by immersion in 25%, 50%, 75% and 100% methanol for 2 min each at 4°C. Next, they were progressively rehydrated by immersion in 100%, 75%, 50% and 25% methanol for 2 min each at 4°C and finally in PBS. After immersion in 0.1% Toluidine Blue for 2 min on ice, carcasses were briefly washed in PBS and immediately photographed. PCR-based genotypic analyses were conducted only after completion of the assay. Investigators were blind to group allocations during the experiments and subsequent analyses.
Standard biochemical procedures and antibodies
Cell lysates, protein quantification and SDS-PAGE were performed as previously described (Beli et al., 2008; Galovic et al., 2011; Isogai et al., 2015a, 2016). Fractionations were run on 4-15% gradient gels (TGX, Bio-Rad) using the Laemmli buffer system and blotted on nitrocellulose (pore size 0.2 µm; Pall). Blots were routinely blocked with 5% bovine serum albumin (BSA) for 1 h and then, depending on the manufacturer, incubated with primary antibodies for 1 h or overnight. All secondary HPR-conjugated antibodies were from Bio-Rad. Primary antibodies are listed in Table S4.
Immunofluorescence, imaging and image analysis
Keratinocytes were plated on collagen I (2 µg ml−1)-coated coverslips and treated 48 h later. Cells were fixed as previously described (Isogai et al., 2015c) and images acquired sequentially on a CLSM Leica TCS SP5 using identical settings throughout each experiment. For confocal time-lapse video microscopy, cells were plated on collagen I-coated glass-bottom Cellview dishes (Greiner) and imaged on a CLSM Leica TCS SP5 microscope equipped with a humidified climate chamber with 5% CO2 at 37°C (63×, 1.45 N.A, Argon laser 5-7%, 1.4 A.U., line scan mode, accumulation 4, gain 40%, 2 frames min−1). Movies were assembled from (512×512 pixels) time series and processed using ImageJ.
Automated analysis compressed confocal (1024×1024 pixel) z-stacks of non-permeabilized EGFP-Nrf2-expressing keratinocytes counterstained with DAPI was carried out using Cell profiler (Broad Institute) (Jones et al., 2008) and a custom-modified ‘Human cytoplasm-nucleus translocation assay’ pipeline.
Semi-quantitative analysis of ARPC4 immunoreactivity in human skin samples was performed as follows: images were processed using ImageJ plugin ‘IHC ToolBox’ (http://imagej.nih.gov/ij/plugins/ihc-toolbox/index.html) using either pre-set or custom-made H-DAB models to extract the unmixed DAB (brown) signal. The resulting DAB images were inspected manually and only those ensuring a satisfactory removal of the counterstaining were analysed. For each image, two full-thickness epidermal regions of interest were randomly selected and mean intensity measured with the ImageJ ‘Measure’ function. Values were averaged and then converted from the original 0-255 (black-white) scale into a 0-1 (black-white) scale. Each value (x) was then transformed using the 1-x formula for plotting according to a more intuitive 0-1 (white-black) scale.
Fractionations
To obtain cytosol-enriched and nuclear-enriched fractions, keratinocytes (approximately 16×106 cells, 80% confluent cultures) were washed twice with ice-cold PBS supplemented with calcium (0.884 mM) and magnesium (0.492 mM) (Lonza, BE17-513F), scraped with a rubber policeman and spun at 900 g for 5 min at 4°C. The pellet was taken up in 150 µl hypertonic buffer [100 mM PIPES pH 6.8, 1 mM EGTA, 1 mM MgCl2 supplemented with phosphatase and protease inhibitor cocktail (Roche)], re-suspended gently and left at room temperature for 5 min. After addition of 0.5% Triton X-100 and gentle re-suspension, samples were spun and centrifuged at 900 g for 5 min at 4°C. The resulting supernatant is referred to as cytosol. The pellet was washed with 10 bed volumes of hypertonic buffer without Triton X-100 and then re-suspended in RIPA buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with phosphatase and protease inhibitor cocktail (Roche), sonicated three times for 10 s in a Branson sonicator bath (75% intensity) and centrifuged for 30 min at 15,000 rpm (21,130 g) at 4°C. The final supernatant is referred to as nucleus.
To obtain G-actin and F-actin fractions, the G-actin/F-actin in vivo assay kit (Cytoskeleton) was used. Briefly, keratinocytes (approximately 3×106 cells, 80% confluent cultures) were lysed in 400 µl of the LAS2 as per the manufacturer's instructions. After removing cell debris and unbroken cells, protein concentration was measured and lysates diluted in LAS2 buffer to obtain a final concentration of 1 mg ml−1. Next, 150 µl of each lysate were fractionated.
Muscle actin (Cytoskeleton) was recycled as previously described (Hertzog and Carlier, 2005) and then used for the F-actin co-sedimentation assays using an established protocol (Hertzog and Carlier, 2005). Full-length GST-Nrf2 was expressed in Escherichia coli and purified using previously described procedures (Beli et al., 2008; Galovic et al., 2011; Innocenti et al., 2004, 2005) with the exception that cells were grown at 30°C prior to induction.
Tissue homogenization, total RNA isolation, TruSeq Stranded mRNA sample preparation, sequencing and bioinformatics
Tissues were homogenized in TRIzol reagent (Ambion Life Technologies) using a polytron (DI 18 Disperser, IKA) as per the manufacturer's protocol. Typically, 1 and 0.5 ml of TRIzol reagent were used per 50-100 mg of epidermis and 1×106 cells, respectively.
Total RNA was extracted using TRIzol reagent as per the manufacturer's protocol. Briefly, 0.2 volumes of chloroform (Chloroform stab./Amylene, Biosolve) were added to the TRIzol homogenate and tube(s) (Falcon, 15 ml) were shaken vigorously. The tubes were incubated for 2-3 min at room temperature and centrifuged (Hettich, rotanta 46 RS) at 4500 g or 1 h at 4°C. Approximately 70% of the upper aqueous phase was transferred to a clean 15 ml tube and 0.5 volumes of isopropanol (Sigma-Aldrich) were added. The tube(s) were then incubated overnight at −20°C and centrifuged at 4500 g for 30 min at 4°C. The supernatant was removed and the pellet was washed twice with 80% ethanol (Sigma-Aldrich). The total RNA pellet was air-dried for 8 min and dissolved in an appropriate volume of nuclease-free water (Ambion Life Technologies) and quantified using a Nanodrop UV-VIS Spectrophotometer. The total RNA was further purified using MinElute Cleanup Kit (Qiagen) according to the manufacturer's instructions. Quality and quantity of the total RNA was assessed by the 2100 Bioanalyzer using a Nano chip (Agilent). Total RNA samples having RNA integrity number (RIN)>8 were subjected to library generation.
Strand-specific libraries were generated using the TruSeq Stranded mRNA sample preparation kit (Illumina, RS-122-2101/2) according to the manufacturer's instructions (Illumina, 15031047 Rev. E). Briefly, polyadenylated RNA from 1000 ng intact total RNA was purified using oligo-dT beads. Following purification, RNA was fragmented, random primed and reverse transcribed using SuperScript II Reverse Transcriptase (Invitrogen, 18064-014) with the addition of actinomycin D. Second strand synthesis was performed using Polymerase I and RNaseH with replacement of dTTP for dUTP. The generated cDNA fragments were 3′-end adenylated and ligated to Illumina Paired-end sequencing adapters and subsequently amplified by 12 cycles of PCR. The libraries were analysed on a 2100 Bioanalyzer using a 7500 chip (Agilent), diluted and pooled equimolar into a 10-plex, 10 nM sequencing pool.
The epidermal and keratinocyte libraries were sequenced with 51-base and 65-base single reads, respectively, on a HiSeq2500 using V4 chemistry (Illumina). Reads were aligned with TopHat (Kim et al., 2013a; Trapnell et al., 2009) (version 2.0.12), which allows for exon-exon-junctions against the mouse build 38. Read counts were generated using a custom script based on the union mode of the HTSseq-count (Anders et al., 2015). Only reads that mapped uniquely to the transcriptome were used for counting. All samples were merged into one dataset and genes that have zero expression across all samples were removed from the dataset. Identification of differentially expressed genes was performed using the R package Limma (Ritchie et al., 2015). In Fig. 2, wild-type samples were compared with knockout samples and a given gene was considered differentially expressed only when P<0.05 in all three comparisons. In order to create a robust list, a log2 fold change of 1.5 was set as a minimum. Nrf2-target genes were retrieved from the NRF2ome website publicly available online and, after removal of duplicated entries, complemented by mining Nrf2-target genes from published literature. The MRTF signature (921 genes) was previously published (Esnault et al., 2014). Investigators were blind to group allocations during the experiments. Reads were normalized to 10 million reads per sample to plot expression levels in the heat maps. Hierarchical clustering based on complete linkage and using the Euclidean distance was performed on both genes (rows) and samples (columns) of the data. The order of the samples and genes is based on the results of the clustering analyses.
RT-qPCR
Total RNA was isolated from keratinocytes and skin epidermis using GeneJET RNA purification kit (Thermo Scientific) and TRIzol, respectively. For keratinocytes, complementary DNA synthesis was performed using 1-2 µg of mRNA with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and oligo-dT (25 ng ml−1) according to the manufacturer's instructions. For the epidermis, the mix was also supplemented with random primers (1:100 from the supplied 10× RT stock solution). Real-time qPCR reactions were set up using 1-2 ng of cDNA as a template and gene-specific primers (600 nM) in a StepOnePlusTM Real-Time PCR system (Applied Biosystems). All reactions produced single amplicons (100-200 bp), which allowed us to equate one threshold cycle difference using Hprt as reference housekeeping gene (Isogai et al., 2015b). Biological duplicates were assayed in triplicate and data were normalized with respect to the central value of the control. RT-qPCR primers are listed in Table S5.
Collection and staining of human skin samples
Skin biopsies were taken from lesional skin of adult patients affected by chronic plaque psoriasis (n=10). Biopsies were also obtained from normal skin of healthy subjects undergoing plastic surgery (n=5). For six psoriatic patients, a skin biopsy from asymptomatic normal-appearing skin distant from the lesions was also taken.
For immunohistochemistry, skin samples were fixed in 10% formalin and embedded in paraffin. Five-µm-thick sections were dewaxed and rehydrated. After quenching endogenous peroxidase, achieving antigen retrieval, and blocking non-specific binding sites, sections were incubated overnight at 4°C with goat anti-Arpc4 antibodies. Biotinylated anti-goat antibodies and staining kits were from Vector Laboratories. Signal was developed using DAB (3,3′-diaminobenzidine) (DAKO) followed by counterstaining with Haematoxylin (Vector Laboratories). Controls omitting the primary antibodies gave virtually no staining (not shown).
Statistics
GraphPad Prism (version 6.oh) was used to carry out all statistical analyses and to plot results as indicated in the figure legends.
Study approval
Animal studies were performed with approval of the local Animals Ethics Committee (DEC) and according to Dutch legislation. IMQ treatments were performed in compliance with a protocol approved by the Italian ISS (Istituto Superiore di Sanità) (23/12/2013, IDI protocol N. SA-IDI-CA-1). Human studies were performed according to the Declaration of Helsinki with regard to scientific use, and approved by the ethical committee of the Fondazione ‘Luigi Maria Monti’ – Istituto Dermopatico dell'Immacolata (IDI)-IRCCS (Rome, Italy) (23/12/2015, Protocol N. 103/CE/2015). Patients were enrolled in the study after written informed consent.
Acknowledgements
We thank J. Neefjes (Leiden University) for the EGFP-Nrf2 plasmid, A. Berns (NKI) and A. Sonnenberg (NKI) for critical reading of the manuscript and Ron Kerkhoven for supervising the work of the NKI Genomics Core Facility.
Author contributions
Conceptualization: M.I.; Methodology: R.v.d.K., M.I.; Validation: R.v.d.K., J.-Y.S., I.d.K., H.J., S.M., C.S., C.A., W.B., M.I.; Formal analysis: R.v.d.K., I.d.K., M.I.; Investigation: R.v.d.K., J.-Y.S., H.J., S.M., C.S., C.A., W.B., M.I.; Resources: R.v.d.K., I.d.K., H.J., S.M., C.S., C.A., M.I.; Writing - original draft: M.I.; Writing - review & editing: M.I.; Visualization: J.-Y.S., I.d.K., S.M., C.S., C.A., M.I.; Supervision: M.I.; Project administration: M.I.; Funding acquisition: M.I.
Funding
This research received no specific grant from any funding agency in the public, commercial or not-for-profit sectors.
Data availability
RNA-seq data are available at Gene Expression Omnibus (GEO) under accession numbers GSE107264 (keratinocyte) and GSE107265 (epidermis).
Reference
Competing interests
The authors declare no competing or financial interests.