Notch signaling plays important roles during mammalian nephrogenesis. To investigate whether Notch regulates nephron segmentation, we performed Notch loss-of-function and gain-of-function studies in developing nephrons in mice. Contrary to the previous notion that Notch signaling promotes the formation of proximal tubules and represses the formation of distal tubules in the mammalian nephron, we show that inhibition of Notch blocks the formation of all nephron segments and that constitutive activation of Notch in developing nephrons does not promote or repress the formation of a specific segment. Cells lacking Notch fail to form the S-shaped body and show reduced expression of Lhx1 and Hnf1b. Consistent with this, we find that constitutive activation of Notch in mesenchymal nephron progenitors causes ectopic expression of Lhx1 and Hnf1b and that these cells eventually form a heterogeneous population that includes proximal tubules and other types of cells. Our data suggest that Notch signaling is required for the formation of all nephron segments and that it primes nephron progenitors for differentiation rather than directing their cell fates into a specific nephron segment.

INTRODUCTION

In mammals, nephrons are formed only during development (McMahon, 2016). At the cortex of the developing kidney, mesenchymal nephron progenitors reside adjacent to the branching tips of the collecting duct. At each branching event, a subset of nephron progenitors undergoes mesenchymal-to-epithelial transition (MET) to form a ball-like epithelial structure called the renal vesicle (RV). The RV becomes the comma-shaped body (CSB), which develops into the S-shaped body (SSB). Each SSB eventually gives rise to a nephron. The nephrogenesis process continues until nephron progenitors are depleted around birth, by 36 weeks of gestation in humans and by postnatal day (P) 4 in mice (Hartman et al., 2007; Hinchliffe et al., 1991; Rumballe et al., 2011). The absence of nephron progenitors thereafter prevents the generation of new nephrons, even after kidney injury (Humphreys et al., 2008). Undifferentiated mesenchymal nephron progenitors express Six2, which encodes a homeodomain transcription factor (Self et al., 2006). Six2 is required for the maintenance of nephron progenitors, blocking their premature depletion (Kobayashi et al., 2008; Self et al., 2006). Previously, we have shown that the differentiation of nephron progenitors requires the downregulation of Six2, and that Notch signaling downregulates Six2, thereby promoting nephrogenesis (Chung et al., 2016).

The nephron serves as the blood filtration unit of the kidney. Each nephron is composed of distinct segments (Desgrange and Cereghini, 2015). Podocytes and Bowman's capsule cells in the renal corpuscle originate from nephron progenitors (Kobayashi et al., 2008). Along the proximodistal axis of the nephron, the renal corpuscle is followed by the proximal tubule, loop of Henle, and distal tubule, all of which originate from a common pool of Six2+ nephron progenitor cells. Different nephron segments are composed of specific types of epithelial tubule cells that perform distinct physiological functions. The developmental process of nephron segmentation is not well understood, especially in mammals. It is believed that Notch is a major signaling pathway involved in regulating mammalian nephron segmentation (Desgrange and Cereghini, 2015; Kopan et al., 2014; Park and Kopan, 2015). Activation of Notch signaling requires cell-to-cell interaction between a ligand-expressing cell and a Notch receptor-expressing cell, resulting in the cleavage of the intracellular domain (ICD) of the Notch receptor (Kopan and Ilagan, 2009). Subsequently, the Notch ICD released from the plasma membrane forms a complex with its DNA-binding partner Rbpj (also called CSL) and regulates the transcription of its target genes in the nucleus (Kopan and Ilagan, 2009).

It was previously thought that Notch signaling promoted the formation of proximal tubules and repressed the formation of other nephron segments, especially distal tubules (Cheng et al., 2007, 2003; Surendran et al., 2010). This model was based on several genetic studies of Notch signaling in mouse models. Reports showed that deletion of Notch2 with Pax3tm1(cre)Joe (Pax3cre) inhibits the formation of proximal tubules (Cheng et al., 2007; Liu et al., 2015). However, since Pax3cre targets not only the nephron lineage but also the interstitial lineage in the kidney (Engleka et al., 2005), it is possible that the deletion of Notch2 in the interstitial lineage might have contributed to the mutant phenotype. In fact, when Notch2 was deleted by the nephron lineage-specific Tg(Six2-GFP/cre)1Amc (Six2GFPcre) (Kobayashi et al., 2008; Park et al., 2007), proximal tubules were still formed (Surendran et al., 2010). We have recently shown that deletion of Notch1 and Notch2 with Six2GFPcre arrests nephrogenesis largely at the RV stage and that in this mutant neither proximal nor distal tubules are formed (Chung et al., 2016). The nephron lineage-specific Notch loss-of-function (LOF) study does not therefore support the model that Notch signaling proximalizes the nephron. Although one report showed that constitutive expression of the Notch1 ICD with Six2GFPcre resulted in the ectopic formation of proximal tubules (Cheng et al., 2007), another reported that constitutive expression of the Notch2 ICD caused the depletion of Six2+ nephron progenitors without the ectopic formation of proximal tubules (Fujimura et al., 2010). The model that Notch signaling proximalizes the nephron is only supported by the Notch1 gain-of-function (GOF) experiment, but not by the Notch2 GOF report. Thus, further investigation is required to determine whether Notch signaling promotes the formation of proximal tubules and represses the formation of distal tubules.

Removing Notch in cap mesenchyme progenitors with Six2GFPcre completely blocks nephrogenesis before nephron segmentation initiates (Chung et al., 2016). It is therefore necessary to remove Notch signaling at a later stage of nephrogenesis to study its possible role in segmentation. To this end, we employed Wnt4tm3(EGFP/cre)Amc (Wnt4GFPcre) (Mugford et al., 2009). Since Wnt4 is one of the earliest genes to be activated during the differentiation of nephron progenitors (Park et al., 2007; Stark et al., 1994), Wnt4GFPcre allowed us to genetically manipulate Notch signaling during the differentiation of nephron progenitors. Here we show that Notch signaling is required for the formation of all nephron segments and does not promote the formation of any specific nephron segment during nephrogenesis. Furthermore, we show that Notch signaling regulates the expression of Lhx1 and Hnf1b, two genes encoding key transcription factors required for proper nephron segmentation. Collectively, our data suggest that Notch signaling primes nephron progenitors for differentiation rather than directing their cell fates into proximal tubules. This work proposes a new model for the role of Notch in nephrogenesis.

RESULTS

Wnt4GFPcre targets early developing nephrons

In order to determine when and where Wnt4GFPcre becomes active during nephrogenesis, we performed lineage analysis by examining Wnt4GFPcre-activated Rosa reporter (Rosa26lacZ) in early developing nephrons. We used Jag1 expression to determine the stages of developing nephrons (Georgas et al., 2009; Park et al., 2012). Jag1 marked the distal part (closer to the tip of the collecting duct) of the RV (Fig. 1A). Jag1 was expressed in the comma head portion of the CSB but little Jag1 was detected in the tail of the CSB (Fig. 1B). In the SSB, Jag1 expression was strongest in the median segment (Fig. 1C). Wnt4GFPcre expression was also dynamic during nephrogenesis. Wnt4GFPcre was expressed in the entire RV (Fig. 1A, GFP), in the comma head of the CSB (Fig. 1B, GFP), and in the median segment of the SSB (Fig. 1C, GFP). Despite the dynamic expression of Wnt4GFPcre during early nephrogenesis, the entire RV, CSB and SSB were marked with Rosa reporter (Fig. 1, β-gal), demonstrating that Wnt4GFPcre targets developing nephrons as early as the RV stage.

Fig. 1.

Wnt4GFPcre targets developing nephrons. Rosa reporter (Rosa26lacZ) activated by Wnt4GFPcre was examined in the renal vesicle (RV) (A), the comma-shaped body (CSB) (B) and the S-shaped body (SSB) (C). Jag1 expression was used to determine the stages of nephrogenesis. Jag1 was expressed in the distal part of the RV (A). The Jag1 expression domain was expanded in the CSB (B). Jag1 was expressed in the median segment of the SSB (C). Wnt4GFPcre was expressed in the entire RV (A). In CSB and SSB, expression of Wnt4GFPcre largely overlaps with that of Jag1 (B,C). Expression of the Rosa reporter indicates that Wnt4GFPcre can target the RV and its derivatives despite its dynamic and polarized expression during early nephrogenesis. (A-C) Mouse kidneys at E16.5 are shown. Images are representative of two independent experiments. Scale bar: 100 µm.

Fig. 1.

Wnt4GFPcre targets developing nephrons. Rosa reporter (Rosa26lacZ) activated by Wnt4GFPcre was examined in the renal vesicle (RV) (A), the comma-shaped body (CSB) (B) and the S-shaped body (SSB) (C). Jag1 expression was used to determine the stages of nephrogenesis. Jag1 was expressed in the distal part of the RV (A). The Jag1 expression domain was expanded in the CSB (B). Jag1 was expressed in the median segment of the SSB (C). Wnt4GFPcre was expressed in the entire RV (A). In CSB and SSB, expression of Wnt4GFPcre largely overlaps with that of Jag1 (B,C). Expression of the Rosa reporter indicates that Wnt4GFPcre can target the RV and its derivatives despite its dynamic and polarized expression during early nephrogenesis. (A-C) Mouse kidneys at E16.5 are shown. Images are representative of two independent experiments. Scale bar: 100 µm.

Deletion of Notch with Wnt4GFPcre inhibits the formation of all nephron segments

By employing Wnt4GFPcre, which targets early developing nephrons, we carried out a Notch LOF study. Since it is known that Notch1 and Notch2 act redundantly during nephrogenesis (Surendran et al., 2010), we deleted both Notch1 and Notch2 with Wnt4GFPcre. In order to trace only those nephron progenitors in which Wnt4GFPcre-mediated recombination occurred, we included a lineage tracer (EYFP) in our genetic analysis. It is likely that most of the Wnt4GFPcre-activated Rosa EYFP reporter-positive cells also experienced the deletion of conditional alleles of Notch genes. First, we tested how Wnt4GFPcre-mediated deletion of Notch genes affects nephron segmentation. It was previously thought that Notch signaling promoted the formation of proximal tubules while repressing the formation of distal tubules (Cheng et al., 2007, 2003; Surendran et al., 2010). If this model is correct, blocking Notch signaling in developing nephrons should allow the formation of distal tubules and inhibit the formation of proximal tubules. We examined nephron segmentation in the Notch mutant kidney by immunofluorescence analysis. We used Wt1 (podocyte), Lotus tetragonolobus lectin (LTL) (proximal tubule), Slc12a1 (loop of Henle) and Slc12a3 (distal tubule) to mark specific nephron segments (Fig. 2A). In the control kidney, Rosa EYFP reporter-positive cells could differentiate into all segments of the nephron (Fig. 2A, left). By contrast, in the Notch double-mutant kidneys, the Rosa EYFP reporter-labeled cells failed to form any segment of the nephron (Fig. 2A, right).

Fig. 2.

Deletion of Notch with Wnt4GFPcre inhibits the formation of all nephron segments. (A) Lineage analysis of Wnt4+ cells shows that the nephron segmentation process is blocked in the Notch1 and Notch2 double-mutant kidney. In the control kidney (left), Rosa EYFP reporter-positive cells form Wt1+ podocytes, LTL+ proximal tubules, Slc12a1+ loop of Henle, and Slc12a3+ distal tubules. In the Notch double-mutant kidney (right), EYFP+ cells fail to develop into any segment of the nephron. N1c and N2c indicate conditional alleles of Notch1 and Notch2, respectively. Kidneys at E18.5 are shown. Images are representative of two independent experiments. Scale bar: 100 µm. (B) RT-qPCR of genes expressed in specific segments of the nephron shows that all nephron segments are poorly formed in the Notch double-mutant kidney at E18.5. Nphs2 and Slc34a1 are specifically expressed in podocytes and proximal tubules, respectively. Error bars indicate s.d., n=4.

Fig. 2.

Deletion of Notch with Wnt4GFPcre inhibits the formation of all nephron segments. (A) Lineage analysis of Wnt4+ cells shows that the nephron segmentation process is blocked in the Notch1 and Notch2 double-mutant kidney. In the control kidney (left), Rosa EYFP reporter-positive cells form Wt1+ podocytes, LTL+ proximal tubules, Slc12a1+ loop of Henle, and Slc12a3+ distal tubules. In the Notch double-mutant kidney (right), EYFP+ cells fail to develop into any segment of the nephron. N1c and N2c indicate conditional alleles of Notch1 and Notch2, respectively. Kidneys at E18.5 are shown. Images are representative of two independent experiments. Scale bar: 100 µm. (B) RT-qPCR of genes expressed in specific segments of the nephron shows that all nephron segments are poorly formed in the Notch double-mutant kidney at E18.5. Nphs2 and Slc34a1 are specifically expressed in podocytes and proximal tubules, respectively. Error bars indicate s.d., n=4.

In order to quantify defects of nephron segmentation in the Notch double-mutant kidneys, we performed quantitative reverse-transcription PCR (RT-qPCR) of genes expressed in the specific segments of the nephron (Fig. 2B). In the nephron lineage, Nphs2 and Slc34a1 are expressed specifically in podocytes and proximal tubules, respectively (Lee et al., 2015; Moeller et al., 2003). Slc12a1 and Slc12a3 are expressed specifically in the loop of Henle and distal tubules, respectively (Lee et al., 2015). Consistent with our immunofluorescence analysis (Fig. 2A), the Notch double-mutant kidneys showed severe defects in the formation of all nephron segments (Fig. 2B). Contrary to the previous model of mammalian nephron segmentation, our data showed that Notch signaling is required for the formation of all nephron segments, not just for the proximal tubule segment.

Notch signaling is required for the formation of the SSB and for robust expression of Lhx1 and Hnf1b

In order to investigate mechanisms underlying nephron segmentation defects seen in the Notch double-mutant kidney, we examined early nephrogenesis. First, we tested whether the deletion of Notch genes with Wnt4GFPcre still allows nephron progenitors to undergo MET, using Cdh1 (E-cadherin) as an epithelial marker (Hay, 2005). We found that EYFP+ Notch double-mutant cells could become Cdh1+ epithelial cells (Fig. 3A) but that these EYFP+ cells failed to form the SSB (Fig. 3B, Fig. S1). Whereas in the control kidney (Fig. 3B, left) there was abundant adjacent expression of Jag1 and Wt1 marking the SSB (arrows), these structures were missing in the mutant kidney (Fig. 3B, right), suggesting the absence of SSB in the Notch mutant. The mutant kidney did contain some Wt1+ or Jag1+ cells (arrows in Fig. 3B, right) in developing nephrons but these were largely negative for EYFP, meaning that they had escaped Wnt4GFPcre-mediated recombination and were likely to have intact Notch. Our data suggest that, during nephrogenesis, Notch signaling is required for the formation of the SSB. Although Wnt4GFPcre targeted a subset of mesenchymal nephron progenitors (Fig. 3A), genetic manipulation of Notch signaling with Wnt4GFPcre did not affect the expression of Six2, Pax2 and Wt1 in the cap mesenchyme (Fig. S2A,B), which suggests that the nephrogenesis defect in the Notch LOF mutant kidney was not caused by premature depletion of mesenchymal nephron progenitors.

Fig. 3.

Deletion of Notch with Wnt4GFPcre causes defects in early nephrogenesis. (A) In both control (left) and mutant (right), Rosa EYFP reporter-positive cells differentiate into Cdh1+ epithelial cells, suggesting that the Notch mutant cells can undergo MET. (B) In the control kidney, Rosa EYFP reporter-positive cells form the SSB (arrows). The SSB exhibits a characteristic Jag1+ median segment and Wt1+ proximal segment. In the Notch mutant kidney, EYFP+ cells fail to form SSB. Most of the Wt1+ proximal segment of the SSB in the mutant kidney is negative for EYFP, suggesting that these Wt1+ cells have intact Notch. (C) In the control kidney, EYFP+ cells develop into Lhx1+ cells (arrowheads). In the Notch mutant kidney, most of the Lhx1+ cells (arrowheads) are negative for EYFP, suggesting that Notch signaling is required for expression of Lhx1. In addition, expression of Hnf1b in the EYFP+ cells is significantly reduced in the Notch mutant kidney (arrows), suggesting that Notch signaling is required for robust expression of Hnf1b. (A-C) Kidneys at E18.5 are shown. Images are representative of two independent experiments. Scale bars: 100 µm.

Fig. 3.

Deletion of Notch with Wnt4GFPcre causes defects in early nephrogenesis. (A) In both control (left) and mutant (right), Rosa EYFP reporter-positive cells differentiate into Cdh1+ epithelial cells, suggesting that the Notch mutant cells can undergo MET. (B) In the control kidney, Rosa EYFP reporter-positive cells form the SSB (arrows). The SSB exhibits a characteristic Jag1+ median segment and Wt1+ proximal segment. In the Notch mutant kidney, EYFP+ cells fail to form SSB. Most of the Wt1+ proximal segment of the SSB in the mutant kidney is negative for EYFP, suggesting that these Wt1+ cells have intact Notch. (C) In the control kidney, EYFP+ cells develop into Lhx1+ cells (arrowheads). In the Notch mutant kidney, most of the Lhx1+ cells (arrowheads) are negative for EYFP, suggesting that Notch signaling is required for expression of Lhx1. In addition, expression of Hnf1b in the EYFP+ cells is significantly reduced in the Notch mutant kidney (arrows), suggesting that Notch signaling is required for robust expression of Hnf1b. (A-C) Kidneys at E18.5 are shown. Images are representative of two independent experiments. Scale bars: 100 µm.

In Notch LOF and GOF studies employing Six2GFPcre, which targets undifferentiated nephron progenitors, we have previously shown that Notch signaling downregulates Six2 (Chung et al., 2016). Although Wnt4GFPcre acts later than Six2GFPcre, both Cre lines appear to cause similar Notch LOF mutant phenotypes. This suggests that Notch signaling plays additional roles, such as activating key differentiation genes, in developing nephrons after Six2 is downregulated. We tested if Notch signaling is required for the activation of Lhx1 and Hnf1b, two transcription factors required for proper nephron segmentation. In the Lhx1 mutant, nephron progenitors are known to be arrested at RV during nephrogenesis (Kobayashi et al., 2005) and Hnf1b mutant nephron progenitors fail to develop into the SSB (Heliot et al., 2013; Massa et al., 2013). In kidneys at embryonic day (E) 18.5, Lhx1 appears to be expressed in the nephron lineage but Hnf1b is expressed in both the collecting duct and developing nephrons. Since Wnt4GFPcre targets mostly the nephron lineage, EYFP Hnf1b+ cells are either collecting duct cells or nephron lineage cells that escaped Cre-mediated recombination. In the control kidney, the wild-type nephron progenitors marked with EYFP could differentiate into Lhx1+ cells or Hnf1b+ cells, as expected (Fig. 3C, left). When both Notch1 and Notch2 were deleted by Wnt4GFPcre, Notch LOF mutant (EYFP+) cells could also differentiate into Lhx1+ or Hnf1b+ cells (Fig. 3C, right), although expression levels of Lhx1 and Hnf1b were significantly lower in the Notch LOF compared with control cells (Fig. 3C, right versus left). The Notch LOF mutant kidney contained some cells that express Lhx1 at higher levels (arrowheads in Fig. 3C, right) but most of these were negative for EYFP, suggesting that they had escaped Cre-mediated deletion of Notch genes and that Notch signaling is intact in these cells. In the control kidney (Fig. 3C, left), expression of Hnf1b tended to be higher in EYFP+ Lhx1 cells (arrows) than in EYFP+ Lhx1+ cells (arrowheads), suggesting that expression of Hnf1b was upregulated where Lhx1 was downregulated. However, in the Notch LOF mutant kidney (Fig. 3C, right), expression of Hnf1b was comparable in Lhx1+ and Lhx1 cells. Collectively, these results suggest that Notch signaling is required for robust expression of Lhx1 and Hnf1b.

Constitutive activation of Notch signaling by Wnt4GFPcre does not promote the formation of a specific segment of the nephron

The results of our Notch LOF study were inconsistent with the previous model, in which Notch signaling proximalizes the mammalian nephron (Cheng et al., 2007, 2003; Surendran et al., 2010). To address this discrepancy, we performed Notch GOF studies. The fact that Wnt4GFPcre-mediated deletion of Notch blocks nephron segmentation suggests that Wnt4GFPcre becomes active before nephron segmentation occurs. We activated the expression of an active form of Notch1 (NICD) in developing nephrons with Wnt4GFPcre. If Notch signaling promotes the formation of proximal tubule and represses the formation of other nephron segments, then the NICD-expressing cells should preferentially differentiate into proximal tubules. In order to trace only those nephron tubules with constitutive activation of Notch signaling, we included the Rosa EYFP reporter in the analysis. Interestingly, we found that EYFP+ cells with constitutive activation of Notch signaling could differentiate into any nephron segment (Fig. 4A). Quantitation of nephron segmentation by RT-qPCR analysis showed that the Notch GOF mutant kidney exhibited largely normal nephron segmentation without increase or decrease in any specific nephron segment (Fig. 4B). Our data strongly suggest that constitutive activation of Notch signaling during the differentiation of nephron progenitors does not affect nephron segmentation. Despite largely normal nephron segmentation, the Notch GOF mutant kidneys were glomerulocystic (Fig. 4C, Fig. S3B).

Fig. 4.

Constitutive activation of Notch signaling by Wnt4GFPcre does not promote the formation of a specific segment of the nephron. (A) Lineage analysis of Wnt4+ cells shows that Notch gain-of-function (GOF) mutant cells undergo normal nephron segmentation. Rosa EYFP reporter-positive Notch GOF cells form Wt1+ podocytes, LTL+ proximal tubules, Slc12a1+ loop of Henle, and Slc12a3+ distal tubules. Since Wnt4GFPcre is absent in the control kidney and present in the mutant kidney, the Rosa EYFP is active only in the Notch GOF kidney. (B) RT-qPCR of nephron segmentation marker genes shows that constitutive activation of Notch signaling by Wnt4GFPcre does not promote the formation of a specific segment of the nephron. Error bars indicate s.d., n=4. (C) Activation of Notch signaling by Wnt4GFPcre causes cystic dilation of Bowman's capsule. Wt1+ podocytes in glomerulocysts are marked with arrows. (A-C) Kidneys at E18.5 are shown. Images are representative of two independent experiments. Scale bars: 100 µm.

Fig. 4.

Constitutive activation of Notch signaling by Wnt4GFPcre does not promote the formation of a specific segment of the nephron. (A) Lineage analysis of Wnt4+ cells shows that Notch gain-of-function (GOF) mutant cells undergo normal nephron segmentation. Rosa EYFP reporter-positive Notch GOF cells form Wt1+ podocytes, LTL+ proximal tubules, Slc12a1+ loop of Henle, and Slc12a3+ distal tubules. Since Wnt4GFPcre is absent in the control kidney and present in the mutant kidney, the Rosa EYFP is active only in the Notch GOF kidney. (B) RT-qPCR of nephron segmentation marker genes shows that constitutive activation of Notch signaling by Wnt4GFPcre does not promote the formation of a specific segment of the nephron. Error bars indicate s.d., n=4. (C) Activation of Notch signaling by Wnt4GFPcre causes cystic dilation of Bowman's capsule. Wt1+ podocytes in glomerulocysts are marked with arrows. (A-C) Kidneys at E18.5 are shown. Images are representative of two independent experiments. Scale bars: 100 µm.

Constitutive activation of Notch signaling by Six2GFPcre does not convert all nephron progenitors into proximal tubules

It was previously reported that constitutive expression of NICD in undifferentiated nephron progenitors with Six2GFPcre promoted the formation of proximal tubules while inhibiting the formation of distal tubules and podocytes (Cheng et al., 2007). This conclusion was, in part, based on the observation of ectopic formation of LTL-stained (LTL+) proximal tubules in the Notch GOF mutant kidney by Six2GFPcre (Cheng et al., 2007). However, it has not been definitively addressed whether other types of cells are present in the Notch GOF kidney. We generated the same Notch GOF mutant kidney with Six2GFPcre and included a Rosa reporter (EYFP or β-galactosidase) to label Notch GOF cells in the nephron lineage (Rosa26EYFP/NICD;Six2GFPcre or Rosa26lacZ/NICD;Six2GFPcre).

We found that only a subset of Cdh1+ epithelial cells were positive for LTL staining and that most of the epithelial cells were negative for LTL (white arrows in Fig. 5A, first row) in the mutant kidney, suggesting that constitutive activation of Notch signaling does not convert all nephron progenitors into proximal tubules. The Notch GOF mutant kidney formed Wt1+ Mafb+ podocytes, which adopted the typical crescent configuration found in glomeruli (yellow arrow in Fig. 5A, second row). Similar to the Notch GOF mutant kidneys generated with Wnt4GFPcre (Fig. 4C, Fig. S3B), the glomeruli formed in the Notch GOF mutant kidneys with Six2GFPcre were also cystic (Fig. 5A, second row, and Fig. S4B). These results suggest that nephron progenitors with constitutive activation of Notch signaling can differentiate into podocytes and Bowman's capsule. Strikingly, there were large clusters of Rosa reporter-positive Notch GOF mutant cells that were positive for Wt1 and negative for Cdh1 and Mafb (white arrowheads in Fig. 5A, second and third rows). These cells form clusters without forming a lumen, suggesting that they did not complete MET. Taken together, these data (Fig. 5A) suggest that constitutive activation of Notch signaling in mesenchymal nephron progenitors generates a heterogeneous population of various cell types, rather than converting all nephron progenitors exclusively into proximal tubules.

Fig. 5.

Constitutive activation of Notch signaling by Six2GFPcre primes nephron progenitors for differentiation and leads to the formation of a heterogeneous population of cells. (A) New born (P0) kidneys are shown. Notch GOF mutant cells are labeled with the Rosa26 reporter (β-galactosidase) and epithelial cells are marked with Cdh1. Only a subset of epithelial cells is positive for LTL staining, with the majority negative for LTL (white arrows, first row), suggesting that not all Notch GOF mutant cells develop into proximal tubules. Notch GOF mutant cells can form Wt1+ Mafb+ podocytes (yellow arrow, second row). Most of the Notch GOF mutant cells are Wt1+ Cdh1 and form clusters (white arrowheads, third row), and these cells do not appear to form a lumen. (B) Kidneys at E13.5. In the control kidney, Lama1, Cdh1 and Hnf1b are expressed in the developing nephrons and collecting duct but these genes are not expressed in the cap mesenchyme. The collecting duct is positive for cytokeratin (CK) and the developing nephrons are positive for Lhx1. Wt1 is weakly expressed in the cap mesenchyme and highly expressed in the proximal segment of the SSB. Notch GOF mutant cells are labeled with YFP and most of them express Lama1, Lhx1 and Hnf1b, similar to developing nephrons. YFP+ Wt1 cells express Cdh1 (arrowheads), suggesting that the Notch GOF cells have completed MET. The lumens of the collecting ducts are labeled with asterisks. (A,B) Images are representative of two independent experiments. Scale bars: 100 µm.

Fig. 5.

Constitutive activation of Notch signaling by Six2GFPcre primes nephron progenitors for differentiation and leads to the formation of a heterogeneous population of cells. (A) New born (P0) kidneys are shown. Notch GOF mutant cells are labeled with the Rosa26 reporter (β-galactosidase) and epithelial cells are marked with Cdh1. Only a subset of epithelial cells is positive for LTL staining, with the majority negative for LTL (white arrows, first row), suggesting that not all Notch GOF mutant cells develop into proximal tubules. Notch GOF mutant cells can form Wt1+ Mafb+ podocytes (yellow arrow, second row). Most of the Notch GOF mutant cells are Wt1+ Cdh1 and form clusters (white arrowheads, third row), and these cells do not appear to form a lumen. (B) Kidneys at E13.5. In the control kidney, Lama1, Cdh1 and Hnf1b are expressed in the developing nephrons and collecting duct but these genes are not expressed in the cap mesenchyme. The collecting duct is positive for cytokeratin (CK) and the developing nephrons are positive for Lhx1. Wt1 is weakly expressed in the cap mesenchyme and highly expressed in the proximal segment of the SSB. Notch GOF mutant cells are labeled with YFP and most of them express Lama1, Lhx1 and Hnf1b, similar to developing nephrons. YFP+ Wt1 cells express Cdh1 (arrowheads), suggesting that the Notch GOF cells have completed MET. The lumens of the collecting ducts are labeled with asterisks. (A,B) Images are representative of two independent experiments. Scale bars: 100 µm.

Constitutive activation of Notch signaling by Six2GFPcre causes ectopic expression of Lhx1 and Hnf1b in nephron progenitors

To investigate the direct effect of activation of Notch signaling in mesenchymal nephron progenitors, we examined the Notch GOF mutant kidney by Six2GFPcre at an earlier stage (E13.5). Since the results of our Notch LOF study (Fig. 3C) suggest that Notch signaling is required for robust expression of Lhx1 and Hnf1b, two transcription factors required for proper nephron segmentation, we tested whether constitutive activation of Notch signaling in mesenchymal nephron progenitors causes ectopic expression of Lhx1 and Hnf1b. We have previously shown that constitutive expression of Notch1 ICD with Six2GFPcre downregulates Six2 at E13.5 (Chung et al., 2016). Since Six2 is absent in the Notch GOF mutant kidney at this stage, the YFP signal seen in Fig. 5B is likely to be from the Rosa EYFP reporter rather than from Six2GFPcre. In the control kidney (Fig. 5B, left), developing nephrons expressed Lama1, Lhx1 and Hnf1b. These genes were also expressed in the collecting duct but not in the cap mesenchyme. Wt1 was weakly expressed in the cap mesenchyme but highly expressed in the proximal segments of the SSB. Most of the EYFP+ Notch GOF mutant cells were positive for Wt1 and negative for Cdh1 (Fig. 5B, right, second row); only a subset of Notch GOF cells became Cdh1+ epithelial cells (arrowheads in Fig. 5B, right, second row). We found that most of the EYFP+ Notch GOF mutant cells were positive for Lama1, Lhx1 and Hnf1b, showing early signs of differentiation (Fig. 5B, right). These data (Fig. 5B) suggest that activation of Notch signaling primes nephron progenitors for differentiation by activating expression of Lhx1 and Hnf1b.

DISCUSSION

We have previously shown that Notch signaling promotes nephrogenesis by downregulating the expression of Six2, a key transcription factor required for the maintenance of nephron progenitors (Chung et al., 2016). In that study, we performed Notch LOF and GOF analyses with Six2GFPcre, which targets undifferentiated nephron progenitors (Kobayashi et al., 2008; Park et al., 2007). Since Six2GFPcre-mediated deletion of Notch causes the differentiation of nephron progenitors to be arrested largely at RV, it does not allow us to study the role of Notch signaling in nephron segmentation. Here, to explore the role of Notch during nephron segmentation, we employed Wnt4GFPcre. Wnt4 is one of the earliest genes to be activated during the differentiation of nephron progenitors (Park et al., 2007; Stark et al., 1994). We have previously shown that Wnt/β-catenin signaling initiates the differentiation of nephron progenitors and that Wnt4 is directly upregulated by Wnt/β-catenin signaling (Park et al., 2012, 2007). Our lineage analysis showed that Wnt4GFPcre targeted early developing nephron structures, including RV, CSB and SSB, where Notch signaling is active (Fig. 1). This allowed us to investigate the roles of Notch signaling in nephron segmentation.

As we reported previously (Brunskill et al., 2014), undifferentiated nephron progenitors in the cap mesenchyme were mosaically labeled with Wnt4GFPcre-activated Rosa reporter (Fig. 1). Although a subset of the cap mesenchymal cells was targeted by Wnt4GFPcre, cells differentiated further when Notch genes were deleted with Wnt4GFPcre than with Six2GFPcre, suggesting that Wnt4GFPcre acts later than Six2GFPcre. We have previously shown that, when Notch genes were deleted with Six2GFPcre, differentiation of the Notch mutant cells was arrested largely at the RV, which is negative for Cdh1 (Chung et al., 2016). However, when Wnt4GFPcre was used, more Cdh1+ epithelial cells were formed (Fig. 3A, right), although these epithelial cells failed to differentiate into the SSB (Fig. 3B, Fig. S1B) or mature nephron segments (Fig. 2). These results suggest that Notch signaling is required for proper nephron segmentation. Considering that Wnt4GFPcre acts later than Six2GFPcre, the fact that deletion of Notch genes by either Wnt4GFPcre or Six2GFPcre inhibits nephron segmentation suggests later roles for Notch signaling after Six2 is downregulated. Consistent with this, we found that Notch signaling regulates the expression of Lhx1 and Hnf1b, two genes encoding key transcription factors required for proper nephron segmentation.

It has been reported that different parts of the RV exhibit differential gene expression (Cho et al., 1998; Georgas et al., 2009), possibly setting the stage for nephron segmentation. The RV was formed regardless of whether Notch genes were deleted with either Six2GFPcre or Wnt4GFPcre. However, the proximodistal axis of the RV was affected by the Cre used. When Notch genes were deleted with Six2GFPcre, Lhx1 was expressed in the entire RV (Fig. S5), suggesting that this mutant kidney failed to establish a proper proximodistal axis at the RV. When Notch genes were deleted with Wnt4GFPcre, the distal part of the RV expressed Jag1 and the proximal part expressed Wt1 (arrowheads in Fig. S1B), suggesting that the proximodistal axis of the RV was established properly. This discrepancy is likely to be due to the fact that Wnt4GFPcre acts later than Six2GFPcre. Taken together, these results suggest that Notch signaling is required for the establishment of the proximodistal axis at the RV.

The previous model of mammalian nephrogenesis suggested that Notch signaling promotes the formation of proximal tubules and represses the formation of distal tubules (Cheng et al., 2007, 2003; Surendran et al., 2010). According to this model, the deletion of Notch1 and Notch2 with Wnt4GFPcre should have blocked the formation of proximal tubules, while still allowing the formation of distal tubules. However, our results showed that the Notch mutant cells failed to develop into any type of nephron segment, not just proximal tubules (Fig. 2). Consistent with this, the Notch LOF mutant cells also failed to form the SSB, which is thought to be a key intermediate structure for proper nephron segmentation (Fig. 3B, Fig. S1B). Our data suggest that, contrary to the previous model, Notch signaling is required for the formation of all nephron segments, not just proximal tubules.

We found that Wnt4GFPcre-mediated activation of Notch signaling in differentiating nephron progenitors did not promote the formation of the proximal tubule exclusively (Fig. 4). Considering that Wnt4GFPcre can target the RV and its derivatives (Fig. 1), activation of Notch ICD with Wnt4GFPcre should have caused differentiating nephron progenitors to experience constitutive activation of Notch signaling, instead of the regionalized activation of Notch signaling seen during normal differentiation of nephron progenitors. Surprisingly, constitutive activation of Notch signaling with Wnt4GFPcre neither increased nor decreased any specific nephron segment (Fig. 4), suggesting that Notch signaling does not favor the proximal tubule cell fate over other cell fates during nephron segmentation. Consistent with this, the Notch GOF mutant kidney generated with Wnt4GFPcre formed the SSB properly (Fig. S1C). Our data definitively showed that nephron tubules with constitutive activation of Notch signaling could form all nephron segments, suggesting that Notch signaling does not promote or repress the formation of a specific nephron segment.

Two Notch GOF studies have previously reported the targeting of undifferentiated nephron progenitors with Six2GFPcre. One study reported that expression of Notch1 ICD promoted the formation of proximal tubules (Cheng et al., 2007). The other study reported that expression of Notch2 ICD caused the depletion of Six2+ nephron progenitors without the ectopic formation of proximal tubules (Fujimura et al., 2010). The Notch1 ICD allele encodes a truncated Notch1 ICD lacking the PEST domain, while the Notch2 ICD allele encodes the full-length Notch2 ICD containing the PEST domain (Fujimura et al., 2010; Murtaugh et al., 2003). The PEST domain is involved in the degradation of Notch (Chiang et al., 2006; Fryer et al., 2004). It was previously thought that differences in either the specific type of Notch or the stability of the two Notch ICDs might have caused the different phenotypes. Despite the discrepancy between these two Notch GOF studies, the long-held view was that, during nephrogenesis, activation of Notch signaling promotes proximal tubule formation while repressing the formation of other nephron segments (Park and Kopan, 2015). However, we show here that constitutive expression of Notch1 ICD with Six2GFPcre results in a phenotype similar to that observed in the previous Notch2 GOF study, namely that both LTL+ and LTL epithelial cells were formed as well as glomerulocysts. Although it is not known if clusters of Wt1+ Cdh1 cells are present in the Notch2 GOF mutant kidney, it was shown that expression of Notch2 ICD in mesenchymal nephron progenitor cells downregulates Six2, but not Wt1, at E11.5 (Fujimura et al., 2010). Our data show that the phenotype caused by the expression of Notch1 ICD in Six2+ cells is more similar to that caused by the expression of Notch2 ICD than previously thought. The fact that Six2 is downregulated by the expression of either Notch1 ICD or Notch2 ICD is consistent with the notion that the ICDs of Notch1 and Notch2 are functionally equivalent (Liu et al., 2015). It appears that ectopic proximal tubule formation occurs only when the Notch1 GOF mutant kidneys were cultured in vitro as explants (Boyle et al., 2011; Cheng et al., 2007). It is possible that the in vitro culture condition for kidney explants may have promoted the formation of proximal tubules.

Contrary to a previous report (Cheng et al., 2007), we found that a significant portion of nephron progenitors expressing Notch1 ICD remained positive for Wt1 and negative for Cdh1 at P0 (Fig. 5A, third row). It is difficult to define the exact nature of these cells because they show features of both developing nephrons and mesenchymal nephron progenitors. Similar to developing nephrons, these cells expressed Lhx1, Hnf1b and Lama1, but they also expressed Wt1, a key transcription factor expressed in nephron progenitors. We have previously shown that constitutive expression of Notch1 ICD in mesenchymal nephron progenitors with Six2GFPcre downregulates several key mesenchymal genes, including Six2, while not affecting Osr1 expression (Chung et al., 2016). One possibility is that persistent expression of Wt1 or Osr1 or both prevents these cells from completing MET despite constitutive activation of Notch signaling. Consistent with this idea, Wt1 was downregulated in the small portion of Notch GOF nephron progenitors that did become epithelialized at E13.5 (Fig. 5B). Another possibility is that these Wt1+ Cdh1 cells might express different cadherins. It has been shown that the proximal segment of the SSB expresses Wt1 and Cdh6 (Cho et al., 1998).

We believe that our characterization of the Notch GOF mutant kidney by Six2GFPcre at an early developmental stage (E13.5) better elucidates the direct effect of Notch signaling. Most of the Notch GOF mutant progenitor cells at E13.5 showed ectopic expression of Lhx1 and Hnf1b (Fig. 5B). Our data suggest that the major role of Notch signaling is to prime nephron progenitors for differentiation by downregulating Six2 (Chung et al., 2016) and upregulating Lhx1 and Hnf1b rather than dictating their cell fates into a specific segment of the nephron. Lack of robust expression of Lhx1 and Hnf1b may be responsible for poor nephron segmentation in the Notch LOF mutant kidney (Fig. 3C).

During nephrogenesis, developing nephrons are positioned adjacent to the collecting duct and stroma. These neighboring cells may provide important signals that are required for proper elongation of the RV to form nephron tubules. Since the Notch GOF mutant kidney by Six2GFPcre is severely defective in branching of the collecting duct (Cheng et al., 2007), the precise positioning of different types of cells surrounding the developing nephrons is disrupted, resulting in a failure to provide the correct developmental cues for proper elongation of the RV into nephron tubules (Fig. 5A, Fig. S4). By contrast, the nephron tubules derived from the Notch GOF mutant cells by Wnt4GFPcre appeared to elongate normally (Fig. 4A, Fig. S3B).

Our results presented here collectively suggest that Notch signaling is required for the formation of all nephron segments and that Notch signaling does not promote the formation of a specific nephron segment during mammalian nephrogenesis. Our finding that Notch signaling does not proximalize the mammalian nephron is consistent with the model for pronephros segmentation in the zebrafish. In the zebrafish pronephros, which shares a remarkably similar segmentation pattern with mammalian nephrons (Desgrange and Cereghini, 2015; Naylor and Davidson, 2017), Notch signaling does not promote the formation of the proximal tubule segment. Rather, Notch signaling regulates the binary cell fate decision between multi-ciliated cells and transporting cells, resulting in the salt-and-pepper distribution pattern of these two types of cells along the pronephros (Liu et al., 2007). It remains to be further investigated how Notch-mediated binary cell fate decisions apply to mammalian nephrogenesis.

Our findings provide crucial insight into how to generate nephron tubules in vitro for potential cell replacement therapy. We have previously shown that Notch signaling in nephron progenitors can be activated by transient activation of Wnt/β-catenin signaling (Park et al., 2012). To take advantage of this endogenous activation of Notch signaling for the generation of nephron tubules in vitro, cell-to-cell interaction is required, which can be achieved by maintaining nephron progenitors in aggregates. Our findings predict that activation of Notch signaling is required for, and should be compatible with, the generation of all nephron segments in vitro and that, unless exogenous Notch input is provided, dispersed nephron progenitors will fail to form nephron tubules properly.

MATERIALS AND METHODS

Mouse strains

Wnt4tm3(EGFP/cre)Amc (Wnt4GFPcre) (Mugford et al., 2009), Notch1tm2Rko (Notch1c/c) (Yang et al., 2004), Notch2tm3Grid (Notch2c/c) (McCright et al., 2006), Rbpjtm1Hon (Rbpjc/c) (Tanigaki et al., 2002), Gt(ROSA)26Sortm1(Notch1)Dam (Rosa26Notch1ICD) (Murtaugh et al., 2003), Gt(ROSA)26Sortm1(EYFP)Cos (Rosa26EYFP, also known as R26R-EYFP) (Srinivas et al., 2001), Gt(ROSA)26Sortm1Sor (Rosa26lacZ, also known as R26R) (Soriano, 1999), and Tg(Six2-GFP/cre)1Amc (Six2GFPcre) (Kobayashi et al., 2008; Park et al., 2007) mice were described previously. All mice were maintained in the Cincinnati Children's Hospital Medical Center (CCHMC) animal facility according to animal care regulations. The Animal Studies Committee at CCHMC approved the experimental protocols (IACUC2013-0105 and IACUC2017-0037). We adhere to the NIH Guide for the Care and Use of Laboratory Animals.

Immunofluorescence

Embryonic or newborn (P0) kidneys were fixed with 4% paraformaldehyde (PFA) in PBS for 10 min, incubated in 10% sucrose in PBS at 4°C overnight, and imbedded the following day in OCT (Fisher Scientific). We obtained 10 µm cryosections and incubated them overnight with 5% heat-inactivated sheep serum/PBST (PBS with 0.1% Triton X-100) containing primary antibodies (Table S1). Fluorophore-labeled secondary antibodies (Invitrogen or Jackson ImmunoResearch) were used for indirect visualization. Nuclei were stained using Hoechst 33342 (Invitrogen, H3570). Images were taken by wide-field microscopy with a Nikon TiE microscope with Andor Zyla 4.2 camera and Lumencor SpectraX light source housed at the Confocal Imaging Core (CIC) at CCHMC.

RT-qPCR

Control or Notch mutant kidneys at E18.5 were dissected out and total RNA was extracted using the Qiagen RNeasy Micro Kit according to the manufacturer's instructions for microdissected tissue. Starting with 1 µg total RNA, we obtained cDNA by reverse transcription using the RevertAid cDNA Synthesis Kit (Thermo Scientific, K1621). Quantitative PCR was performed on an Applied Biosystems StepOne Plus device (Thermo Scientific) using Power SYBR Green PCR Master Mix (Thermo Scientific, 4368706). Oligonucleotide primers (5′-3′, forward and reverse) were: Gapdh (used as internal control), CAACTTTGTCAAGCTCATTTCCTG and CCTCTCTTGCTCAGTGTCCTT; Nphs2, CTCTGGCCCTAACATCTCCA and TTCAGTGAGCAAGCAACCAG; Slc34a1, TGCTGAGAGACACTCCGTTG and TATTGGGGTGGCAAATTCTC; Slc12a1, AGCGGGCTCTCCTTAAGTTC and CTCAGGAGGCCAAGCAGAAT; Slc12a3, AGCTGGAGAAGAGGCTTCAA and TGCAACTTCAAGGTCCAGAA. Biological replicates of control and Notch mutant kidneys were used as indicated in the figure legends. Fold change calculations were performed using the ΔΔCt method.

Acknowledgements

We thank Steve Potter, Stacey Huppert and Cathy Mendelsohn for critically reading the manuscript; and Matt Kofron and the Confocal Imaging Core at CCHMC for help with microscopy.

Author contributions

Conceptualization: E.C., J.-S.P.; Methodology: E.C., P.D., J.-S.P.; Formal analysis: E.C., J.-S.P.; Investigation: E.C., J.-S.P.; Resources: J.-S.P.; Data curation: E.C., P.D., J.-S.P.; Writing - original draft: E.C., J.-S.P.; Writing - review & editing: E.C., J.-S.P.; Supervision: J.-S.P.; Project administration: J.-S.P.; Funding acquisition: J.-S.P.

Funding

This work was supported by the National Institutes of Health/NIDDK (R01 DK100315 to J.-S.P.); and Cincinnati Children's Hospital Medical Center Research Innovation/Pilot Funding Program (to J.-S.P.). Deposited in PMC for release after 12 months.

References

Boyle
,
S. C.
,
Kim
,
M.
,
Valerius
,
M. T.
,
McMahon
,
A. P.
and
Kopan
,
R.
(
2011
).
Notch pathway activation can replace the requirement for Wnt4 and Wnt9b in mesenchymal-to-epithelial transition of nephron stem cells
.
Development
138
,
4245
-
4254
.
Brunskill
,
E. W.
,
Park
,
J.-S.
,
Chung
,
E.
,
Chen
,
F.
,
Magella
,
B.
and
Potter
,
S. S.
(
2014
).
Single cell dissection of early kidney development: multilineage priming
.
Development
141
,
3093
-
3101
.
Cheng
,
H.-T.
,
Miner
,
J. H.
,
Lin
,
M.
,
Tansey
,
M. G.
,
Roth
,
K.
and
Kopan
,
R.
(
2003
).
Gamma-secretase activity is dispensable for mesenchyme-to-epithelium transition but required for podocyte and proximal tubule formation in developing mouse kidney
.
Development
130
,
5031
-
5042
.
Cheng
,
H.-T.
,
Kim
,
M.
,
Valerius
,
M. T.
,
Surendran
,
K.
,
Schuster-Gossler
,
K.
,
Gossler
,
A.
,
McMahon
,
A. P.
and
Kopan
,
R.
(
2007
).
Notch2, but not Notch1, is required for proximal fate acquisition in the mammalian nephron
.
Development
134
,
801
-
811
.
Chiang
,
M. Y.
,
Xu
,
M. L.
,
Histen
,
G.
,
Shestova
,
O.
,
Roy
,
M.
,
Nam
,
Y.
,
Blacklow
,
S. C.
,
Sacks
,
D. B.
,
Pear
,
W. S.
and
Aster
,
J. C.
(
2006
).
Identification of a conserved negative regulatory sequence that influences the leukemogenic activity of NOTCH1
.
Mol. Cell. Biol.
26
,
6261
-
6271
.
Cho
,
E. A.
,
Patterson
,
L. T.
,
Brookhiser
,
W. T.
,
Mah
,
S.
,
Kintner
,
C.
and
Dressler
,
G. R.
(
1998
).
Differential expression and function of cadherin-6 during renal epithelium development
.
Development
125
,
803
-
812
.
Chung
,
E.
,
Deacon
,
P.
,
Marable
,
S.
,
Shin
,
J.
and
Park
,
J.-S.
(
2016
).
Notch signaling promotes nephrogenesis by downregulating Six2
.
Development
143
,
3907
-
3913
.
Desgrange
,
A.
and
Cereghini
,
S.
(
2015
).
Nephron patterning: lessons from Xenopus, zebrafish, and mouse studies
.
Cells
4
,
483
-
499
.
Engleka
,
K. A.
,
Gitler
,
A. D.
,
Zhang
,
M.
,
Zhou
,
D. D.
,
High
,
F. A.
and
Epstein
,
J. A.
(
2005
).
Insertion of Cre into the Pax3 locus creates a new allele of Splotch and identifies unexpected Pax3 derivatives
.
Dev. Biol.
280
,
396
-
406
.
Fryer
,
C. J.
,
White
,
J. B.
and
Jones
,
K. A.
(
2004
).
Mastermind recruits CycC:CDK8 to phosphorylate the Notch ICD and coordinate activation with turnover
.
Mol. Cell
16
,
509
-
520
.
Fujimura
,
S.
,
Jiang
,
Q.
,
Kobayashi
,
C.
and
Nishinakamura
,
R.
(
2010
).
Notch2 activation in the embryonic kidney depletes nephron progenitors
.
J. Am. Soc. Nephrol.
21
,
803
-
810
.
Georgas
,
K.
,
Rumballe
,
B.
,
Valerius
,
M. T.
,
Chiu
,
H. S.
,
Thiagarajan
,
R. D.
,
Lesieur
,
E.
,
Aronow
,
B. J.
,
Brunskill
,
E. W.
,
Combes
,
A. N.
,
Tang
,
D.
, et al. 
(
2009
).
Analysis of early nephron patterning reveals a role for distal RV proliferation in fusion to the ureteric tip via a cap mesenchyme-derived connecting segment
.
Dev. Biol.
332
,
273
-
286
.
Hartman
,
H. A.
,
Lai
,
H. L.
and
Patterson
,
L. T.
(
2007
).
Cessation of renal morphogenesis in mice
.
Dev. Biol.
310
,
379
-
387
.
Hay
,
E. D.
(
2005
).
The mesenchymal cell, its role in the embryo, and the remarkable signaling mechanisms that create it
.
Dev. Dyn.
233
,
706
-
720
.
Heliot
,
C.
,
Desgrange
,
A.
,
Buisson
,
I.
,
Prunskaite-Hyyrylainen
,
R.
,
Shan
,
J.
,
Vainio
,
S.
,
Umbhauer
,
M.
and
Cereghini
,
S.
(
2013
).
HNF1B controls proximal-intermediate nephron segment identity in vertebrates by regulating Notch signalling components and Irx1/2
.
Development
140
,
873
-
885
.
Hinchliffe
,
S. A.
,
Sargent
,
P. H.
,
Howard
,
C. V.
,
Chan
,
Y. F.
and
van Velzen
,
D.
(
1991
).
Human intrauterine renal growth expressed in absolute number of glomeruli assessed by the disector method and Cavalieri principle
.
Lab. Invest.
64
,
777
-
784
.
Humphreys
,
B. D.
,
Valerius
,
M. T.
,
Kobayashi
,
A.
,
Mugford
,
J. W.
,
Soeung
,
S.
,
Duffield
,
J. S.
,
McMahon
,
A. P.
and
Bonventre
,
J. V.
(
2008
).
Intrinsic epithelial cells repair the kidney after injury
.
Cell Stem Cell
2
,
284
-
291
.
Kobayashi
,
A.
,
Kwan
,
K.-M.
,
Carroll
,
T. J.
,
McMahon
,
A. P.
,
Mendelsohn
,
C. L.
and
Behringer
,
R. R.
(
2005
).
Distinct and sequential tissue-specific activities of the LIM-class homeobox gene Lim1 for tubular morphogenesis during kidney development
.
Development
132
,
2809
-
2823
.
Kobayashi
,
A.
,
Valerius
,
M. T.
,
Mugford
,
J. W.
,
Carroll
,
T. J.
,
Self
,
M.
,
Oliver
,
G.
and
McMahon
,
A. P.
(
2008
).
Six2 defines and regulates a multipotent self-renewing nephron progenitor population throughout mammalian kidney development
.
Cell Stem Cell
3
,
169
-
181
.
Kopan
,
R.
and
Ilagan
,
M. X. G.
(
2009
).
The canonical Notch signaling pathway: unfolding the activation mechanism
.
Cell
137
,
216
-
233
.
Kopan
,
R.
,
Chen
,
S.
and
Little
,
M.
(
2014
).
Nephron progenitor cells: shifting the balance of self-renewal and differentiation
.
Curr. Top. Dev. Biol.
107
,
293
-
331
.
Lee
,
J. W.
,
Chou
,
C. L.
and
Knepper
,
M. A.
(
2015
).
Deep sequencing in microdissected renal tubules identifies nephron segment-specific transcriptomes
.
J. Am. Soc. Nephrol.
26
,
2669
-
2677
.
Liu
,
Y.
,
Pathak
,
N.
,
Kramer-Zucker
,
A.
and
Drummond
,
I. A.
(
2007
).
Notch signaling controls the differentiation of transporting epithelia and multiciliated cells in the zebrafish pronephros
.
Development
134
,
1111
-
1122
.
Liu
,
Z.
,
Brunskill
,
E.
,
Varnum-Finney
,
B.
,
Zhang
,
C.
,
Zhang
,
A.
,
Jay
,
P. Y.
,
Bernstein
,
I.
,
Morimoto
,
M.
and
Kopan
,
R.
(
2015
).
The intracellular domains of Notch1 and Notch2 are functionally equivalent during development and carcinogenesis
.
Development
142
,
2452
-
2463
.
Massa
,
F.
,
Garbay
,
S.
,
Bouvier
,
R.
,
Sugitani
,
Y.
,
Noda
,
T.
,
Gubler
,
M.-C.
,
Heidet
,
L.
,
Pontoglio
,
M.
and
Fischer
,
E.
(
2013
).
Hepatocyte nuclear factor 1beta controls nephron tubular development
.
Development
140
,
886
-
896
.
McCright
,
B.
,
Lozier
,
J.
and
Gridley
,
T.
(
2006
).
Generation of new Notch2 mutant alleles
.
Genesis
44
,
29
-
33
.
McMahon
,
A. P.
(
2016
).
Development of the mammalian kidney
.
Curr. Top. Dev. Biol.
117
,
31
-
64
.
Moeller
,
M. J.
,
Sanden
,
S. K.
,
Soofi
,
A.
,
Wiggins
,
R. C.
and
Holzman
,
L. B.
(
2003
).
Podocyte-specific expression of cre recombinase in transgenic mice
.
Genesis
35
,
39
-
42
.
Mugford
,
J. W.
,
Yu
,
J.
,
Kobayashi
,
A.
and
McMahon
,
A. P.
(
2009
).
High-resolution gene expression analysis of the developing mouse kidney defines novel cellular compartments within the nephron progenitor population
.
Dev. Biol.
333
,
312
-
323
.
Murtaugh
,
L. C.
,
Stanger
,
B. Z.
,
Kwan
,
K. M.
and
Melton
,
D. A.
(
2003
).
Notch signaling controls multiple steps of pancreatic differentiation
.
Proc. Natl. Acad. Sci. USA
100
,
14920
-
14925
.
Naylor
,
R. W.
and
Davidson
,
A. J.
(
2017
).
Pronephric tubule formation in zebrafish: morphogenesis and migration
.
Pediatr. Nephrol.
32
,
211
-
216
.
Park
,
J.-S.
and
Kopan
,
R.
(
2015
).
Notch signaling in nephron segmentation
. In
Kidney Development, Disease, Repair and Regeneration
(ed.
M. H.
Little
), pp.
87
-
94.
New York
:
Academic Press
.
Park
,
J.-S.
,
Valerius
,
M. T.
and
McMahon
,
A. P.
(
2007
).
Wnt/beta-catenin signaling regulates nephron induction during mouse kidney development
.
Development
134
,
2533
-
2539
.
Park
,
J.-S.
,
Ma
,
W.
,
O'Brien
,
L. L.
,
Chung
,
E.
,
Guo
,
J.-J.
,
Cheng
,
J.-G.
,
Valerius
,
M. T.
,
McMahon
,
J. A.
,
Wong
,
W. H.
and
McMahon
,
A. P.
(
2012
).
Six2 and Wnt regulate self-renewal and commitment of nephron progenitors through shared gene regulatory networks
.
Dev. Cell
23
,
637
-
651
.
Rumballe
,
B. A.
,
Georgas
,
K. M.
,
Combes
,
A. N.
,
Ju
,
A. L.
,
Gilbert
,
T.
and
Little
,
M. H.
(
2011
).
Nephron formation adopts a novel spatial topology at cessation of nephrogenesis
.
Dev. Biol.
360
,
110
-
122
.
Self
,
M.
,
Lagutin
,
O. V.
,
Bowling
,
B.
,
Hendrix
,
J.
,
Cai
,
Y.
,
Dressler
,
G. R.
and
Oliver
,
G.
(
2006
).
Six2 is required for suppression of nephrogenesis and progenitor renewal in the developing kidney
.
EMBO J.
25
,
5214
-
5228
.
Soriano
,
P.
(
1999
).
Generalized lacZ expression with the ROSA26 Cre reporter strain
.
Nat. Genet.
21
,
70
-
71
.
Srinivas
,
S.
,
Watanabe
,
T.
,
Lin
,
C.-S.
,
William
,
C. M.
,
Tanabe
,
Y.
,
Jessell
,
T. M.
and
Costantini
,
F.
(
2001
).
Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus
.
BMC Dev. Biol.
1
,
4
.
Stark
,
K.
,
Vainio
,
S.
,
Vassileva
,
G.
and
McMahon
,
A. P.
(
1994
).
Epithelial transformation of metanephric mesenchyme in the developing kidney regulated by Wnt-4
.
Nature
372
,
679
-
683
.
Surendran
,
K.
,
Boyle
,
S.
,
Barak
,
H.
,
Kim
,
M.
,
Stomberski
,
C.
,
McCright
,
B.
and
Kopan
,
R.
(
2010
).
The contribution of Notch1 to nephron segmentation in the developing kidney is revealed in a sensitized Notch2 background and can be augmented by reducing Mint dosage
.
Dev. Biol.
337
,
386
-
395
.
Tanigaki
,
K.
,
Han
,
H.
,
Yamamoto
,
N.
,
Tashiro
,
K.
,
Ikegawa
,
M.
,
Kuroda
,
K.
,
Suzuki
,
A.
,
Nakano
,
T.
and
Honjo
,
T.
(
2002
).
Notch-RBP-J signaling is involved in cell fate determination of marginal zone B cells
.
Nat. Immunol.
3
,
443
-
450
.
Yang
,
X.
,
Klein
,
R.
,
Tian
,
X.
,
Cheng
,
H.-T.
,
Kopan
,
R.
and
Shen
,
J.
(
2004
).
Notch activation induces apoptosis in neural progenitor cells through a p53-dependent pathway
.
Dev. Biol.
269
,
81
-
94
.

Competing interests

The authors declare no competing or financial interests.

Supplementary information