Hormonal interactions are crucial for plant development. In Arabidopsis, cytokinins inhibit root growth through effects on cell proliferation and cell elongation. Here, we define key mechanistic elements in a regulatory network by which cytokinin inhibits root cell elongation in concert with the hormones auxin and ethylene. The auxin importer AUX1 functions as a positive regulator of cytokinin responses in the root; mutation of AUX1 specifically affects the ability of cytokinin to inhibit cell elongation but not cell proliferation. AUX1 is required for cytokinin-dependent changes of auxin activity in the lateral root cap associated with the control of cell elongation. Cytokinin regulates root cell elongation through ethylene-dependent and -independent mechanisms, both hormonal signals converging on AUX1 as a regulatory hub. An autoregulatory circuit is identified involving the control of ARR10 and AUX1 expression by cytokinin and auxin, this circuit potentially functioning as an oscillator to integrate the effects of these two hormones. Taken together, our results uncover several regulatory circuits controlling interactions of cytokinin with auxin and ethylene, and support a model in which cytokinin regulates shootward auxin transport to control cell elongation and root growth.

INTRODUCTION

The root systems of plants are essential for survival, performing such functions as absorbing water and nutrients from the soil, storing food and nutrients, and providing anchorage (Giehl et al., 2014; Jones and Ljung, 2012). The architecture of the root system is developmentally plastic and responds to its environment by modifying such characteristics as primary root growth, lateral root density and lateral root growth, with root growth itself being dependent on both cell proliferation and cell elongation (Giehl et al., 2014; Jones and Ljung, 2012). Cell proliferation occurs at the root apical meristem (RAM), the stem cells of the RAM being organized around a mitotically inactive quiescent center (QC). The stem cells and their derived cells divide, each division shifting the cells further away from the QC (Perilli et al., 2012; Scheres et al., 2002). The meristematic cells eventually cease dividing and begin to elongate and differentiate (Bennett and Scheres, 2010). Not surprisingly, multiple phytohormone signaling pathways interact to control root growth, including the hormone cytokinin, which inhibits both cell proliferation and elongation of root cells (Beemster and Baskin, 2000; Hwang et al., 2012; Moubayidin et al., 2009; Schaller et al., 2015; Vanstraelen and Benkova, 2012; Werner et al., 2003).

The cytokinin signaling pathway of plants is a phospho-relay similar to the two-component response systems of prokaryotes (Kieber and Schaller, 2014; Schaller et al., 2011; Werner and Schmülling, 2009). In Arabidopsis, the cytokinin signaling pathway incorporates histidine kinase receptors (AHKs), histidine-containing phosphotransfer proteins (AHPs), and response regulators (ARRs), all encoded by multi-gene families. Signaling is initiated by cytokinin binding to and inducing autophosphorylation of the AHKs, which are predominantly localized to membranes of the endoplasmic reticulum. Phosphates are transferred from the receptors to cytosolic AHPs which, after movement into the nucleus, phosphorylate the type-B ARR transcription factors. Three type-B ARRs (ARR1, ARR10 and ARR12) play the predominant role in cytokinin signaling, with higher order mutants curtailing the ability of cytokinin to induce changes in gene expression and rendering the plant cytokinin insensitive (Argyros et al., 2008; Ishida et al., 2008; Mason et al., 2005) Among the transcriptional targets induced by the type-B ARRs are a second class of response regulators termed the type-A ARRs, which negatively regulate cytokinin signaling (Bhargava et al., 2013; To et al., 2004).

Cytokinin coordinates root development in concert with the phytohormones auxin and ethylene. Auxin, like cytokinin, regulates both cell proliferation and elongation of the root. Mutants affecting auxin biosynthesis, transport and signaling affect cytokinin responses (De Rybel et al., 2014; Dello Ioio et al., 2008; El-Showk et al., 2013; Schaller et al., 2015; Timpte et al., 1995; Zhou et al., 2011), indicative of the interaction between these two hormones in the control of root growth. The primary role explored for cytokinin-auxin cross-talk has been in the control of cell proliferation at the RAM, cytokinin inhibiting and auxin stimulating the anticlinal cell divisions that regulate RAM size (Dello Ioio et al., 2008; Schaller et al., 2014). Cytokinin-mediated control of cell proliferation appears to involve both transcriptional and post-transcriptional regulation of a subset of PIN auxin efflux carriers (Marhavý et al., 2011; Ruzicka et al., 2009; Zhang et al., 2011). Cytokinin and auxin also cross-talk to regulate cell division in the quiescent center of the root, with cytokinin repressing expression of LAX2, thus modulating auxin transport in the root tip (Zhang et al., 2013). Ethylene also plays a substantive role in root growth owing to its ability to inhibit cell proliferation and elongation, the inhibition of cell elongation being dependent on an ethylene-induced redistribution of auxin (Ruzicka et al., 2009; Swarup et al., 2007; Thomann et al., 2009). Cytokinin stimulates ethylene biosynthesis, and the increased ethylene concentration is proposed to play a role in cytokinin-dependent inhibition of root cell elongation (Chae et al., 2003; Hansen et al., 2009; Vogel et al., 1998b). Substantial progress has been made in our understanding of how cytokinin, auxin and ethylene coordinate root growth and development but, given the complexity of this process, new mechanisms underlying their interactions continue to be discovered.

We performed a forward genetic screen to uncover key regulators that function in conjunction with cytokinin to control root growth. Through this screen, we identified the gene encoding the auxin influx-carrier AUX1 as a positive regulator of the root growth response to cytokinin. AUX1 is one of a four-member Arabidopsis family of auxin importers, and is a primary mediator for shootward auxin transport in the root (Bennett et al., 1996; Péret et al., 2012; Swarup et al., 2008). Through characterization of the role of AUX1 in cytokinin signaling, we determined that: (1) AUX1 mediates the ability of cytokinin to inhibit root cell elongation but not root cell proliferation; (2) AUX1 is required for cytokinin-dependent changes in auxin activity; and (3) cytokinin regulates root cell elongation through both ethylene-dependent and -independent mechanisms. Our results uncover several regulatory circuits that control the interactions of cytokinin with auxin and ethylene, and support a model in which cytokinin regulates shootward auxin transport to control cell elongation and, ultimately, root growth.

RESULTS

A mutant screen identifies AUX1 as a positive regulator of cytokinin signaling in the root

ARR1, ARR10 and ARR12 are the type-B ARRs that contribute most to cytokinin-dependent root development (Argyros et al., 2008; Ishida et al., 2008; Mason et al., 2005). Although single mutants have a minimal effect on cytokinin sensitivity, higher-order mutants show pronounced phenotypes consistent with overlapping function. For example, an arr1 arr12 double mutant has a longer root than the arr1 or arr12 single mutants when grown on cytokinin. To identify other genes that contribute to cytokinin regulation of root development, we generated ethyl-methanesulfonate (EMS)-mutagenized populations of arr12 and arr1 as sensitized backgrounds, and assayed for seedlings with long roots in the presence of exogenous cytokinin [0.1 µM 6-benzyl-aminopurine (BA); Fig. 1A]. We screened 20,000 M2 seeds of each genotype, using a pooling strategy, and confirmed six candidate mutations in the M3 generation. We named these mutants enhancer of response regulator (err) and describe in this paper results obtained from allelic err3 mutants.

Fig. 1.

A genetic screen identifies AUX1 as a positive regulator of cytokinin signaling in the primary root. (A) Design of the mutant screen to identify enhancer of response regulator (err) mutants; these enhance the cytokinin insensitivity, determined by the root growth response, of type-B ARR single mutants. (B) Root growth response to cytokinin of wild type (WT), single mutants err3-1 and arr12, double mutants err3-1 arr12 and arr1 arr12, and triple mutant err3-1 arr1 arr12. Seedlings were grown on vertical plates in the absence or presence of 1 µM BA (n≥20) for five days illuminated from above. (C) Agravitropic phenotypes of five-day-old light-grown err3-1 mutants. (D) A missense mutation in err3-1 results in a Pro371Leu change in AUX1. (E) Root growth response to 1 µM BA of WT compared with the AUX1/LAX auxin importer family single mutants lax1, lax2, lax3, aux1-21 and aux1-121 (err3-1), and the quadruple mutant lax1 lax2 lax3 aux1 (quad) (n≥20). In B and E, groups marked by different letters are significantly different (P<0.05). Error bars represent s.e.m.

Fig. 1.

A genetic screen identifies AUX1 as a positive regulator of cytokinin signaling in the primary root. (A) Design of the mutant screen to identify enhancer of response regulator (err) mutants; these enhance the cytokinin insensitivity, determined by the root growth response, of type-B ARR single mutants. (B) Root growth response to cytokinin of wild type (WT), single mutants err3-1 and arr12, double mutants err3-1 arr12 and arr1 arr12, and triple mutant err3-1 arr1 arr12. Seedlings were grown on vertical plates in the absence or presence of 1 µM BA (n≥20) for five days illuminated from above. (C) Agravitropic phenotypes of five-day-old light-grown err3-1 mutants. (D) A missense mutation in err3-1 results in a Pro371Leu change in AUX1. (E) Root growth response to 1 µM BA of WT compared with the AUX1/LAX auxin importer family single mutants lax1, lax2, lax3, aux1-21 and aux1-121 (err3-1), and the quadruple mutant lax1 lax2 lax3 aux1 (quad) (n≥20). In B and E, groups marked by different letters are significantly different (P<0.05). Error bars represent s.e.m.

The err3-1 mutant was identified in the arr12 enhancer screen. To examine the relative contribution of err3-1 to root growth responses, we introduced err3-1 from the err3-1 arr12 background into wild-type and arr1 arr12 backgrounds by crossing. The err3-1 mutant exhibited partial cytokinin insensitivity by itself in a root growth assay, but also significantly enhanced the cytokinin insensitivity exhibited by arr12 and arr1 arr12 (Fig. 1B). We also observed that the err3-1 mutant exhibited an agravitropic phenotype regardless of background (Fig. 1C), suggesting it might be allelic to AUX1 (At2g38120), which encodes an auxin influx carrier and mutations in which also lead to an agravitropic phenotype (Bennett et al., 1996; Péret et al., 2012; Swarup et al., 2004). Indeed, we identified a Pro371Leu missense mutation in the coding sequence of AUX1 in the err3-1 line, suggesting that err3-1 is allelic to aux1 (Fig. 1D). Similarly, we identified a second allele of err3 (err3-2) from the arr1 enhancer screen and found it was the result of a Gly374Ser missense mutation in AUX1 (Fig. S1A,B), confirming the significance of AUX1 in mediating the cytokinin response. Both err3-1 and err3-2 alter amino-acid residues present in the extracellular loop between the ninth and tenth predicted transmembrane segments of AUX1 (Swarup et al., 2004). This region is highly conserved in the Arabidopsis amino acid/auxin permease superfamily that contains AUX1 (Swarup et al., 2004). A previously identified null allele of AUX1 (aux1-21) exhibited the same level of cytokinin insensitivity as err3-1 (Fig. 1E) (Bennett et al., 1996), consistent with err3-1 being a complete loss-of-function allele of aux1. Because err3-1 and err3-2 are allelic to AUX1, we designated them as aux1-121 and aux1-122, respectively (Swarup et al., 2004), and use these designations for the remainder of the manuscript.

AUX1 is the founding member of the four-member AUX/LAX family of auxin-influx carriers in Arabidopsis (Péret et al., 2012). We examined the lax1, lax2 and lax3 mutants to determine whether they also contributed to the cytokinin root growth response. The three single lax mutants were indistinguishable from wild type in their response to 1 µM cytokinin (Fig. 1E). Furthermore, the lax mutants did not enhance the aux1 mutant phenotype, as the cytokinin response of aux1-21 lax1 lax2 lax3 quadruple mutant was not significantly different from that of the aux1 single mutant (Fig. 1E) (Ugartechea-Chirino et al., 2010). These data are consistent with the hypothesis that AUX1 is a positive regulator of cytokinin-mediated root growth and that it performs a function that does not overlap with other family members in this regard. Our identification of AUX1 mutant alleles through a forward genetic screen also corroborates an earlier finding that an aux1-7 loss-of-function allele exhibits reduced cytokinin sensitivity for root growth (Timpte et al., 1995).

The ability of cytokinin to inhibit cell elongation is dependent on AUX1

Cytokinins control root growth through effects on cell proliferation in the meristem as well as on cell expansion in the elongation zone (Beemster and Baskin, 2000; Dello Ioio et al., 2008; Marhavý et al., 2011; Ruzicka et al., 2009; Zhang et al., 2011), both of which decrease in wild type treated with exogenous cytokinin (Fig. 2). The single type-B mutants arr1, arr10 and arr12 all exhibit a small increase in meristem cell number (Hill et al., 2013; Dello Ioio et al., 2007), presumably owing to a reduction in endogenous cytokinin signaling. The arr1 arr12 double mutant, which shows pronounced cytokinin insensitivity (Mason et al., 2005), exhibits significant increases in both meristem cell number and cell length at the elongation zone (Fig. 2). Furthermore, the arr1 arr12 mutant is significantly resistant to the effects of exogenous cytokinin on both cell proliferation and elongation (Fig. 2).

Fig. 2.

Cytokinin requires AUX1 to inhibit cell elongation but not cell proliferation at the root tip. Seedlings of wild type (WT), the single mutants arr12 and aux1-121, the double mutants arr1 arr12 and aux1-121 arr12, and the triple mutant aux1-121 arr1 arr12 were grown in the absence or presence of 1 µM BA for 5 days. Representative images are stained with propidium iodide. (A) Effect on root meristem size. Meristem size was quantified by cortical layer cell counts (n≥10). Results of one representative experiment are shown. (B) Effect on root epidermal cell size. Cell lengths were quantified on the shootward side of the elongation zone at the region of root hair initiation (n≥20). Groups marked by different letters are significantly different (P<0.05). Error bars represent s.e.m. Arrowheads indicate meristem size (A) and cell boundaries (B). Scale bars: 100 µm.

Fig. 2.

Cytokinin requires AUX1 to inhibit cell elongation but not cell proliferation at the root tip. Seedlings of wild type (WT), the single mutants arr12 and aux1-121, the double mutants arr1 arr12 and aux1-121 arr12, and the triple mutant aux1-121 arr1 arr12 were grown in the absence or presence of 1 µM BA for 5 days. Representative images are stained with propidium iodide. (A) Effect on root meristem size. Meristem size was quantified by cortical layer cell counts (n≥10). Results of one representative experiment are shown. (B) Effect on root epidermal cell size. Cell lengths were quantified on the shootward side of the elongation zone at the region of root hair initiation (n≥20). Groups marked by different letters are significantly different (P<0.05). Error bars represent s.e.m. Arrowheads indicate meristem size (A) and cell boundaries (B). Scale bars: 100 µm.

AUX1 facilitates basipetal (shootward) auxin transport via the lateral root cap (LRC) and epidermal tissues as well as acropetal (rootward) transport via the phloem (Marchant et al., 2002; Swarup et al., 2001). Because AUX1 expression spans the meristem and elongation zone, it could theoretically affect cytokinin's control of cell proliferation and/or expansion. We therefore examined the effects of aux1-121 alone as well as in combination with arr12 and arr1 arr12 to determine the role of AUX1 in cytokinin-regulated cell proliferation and expansion (Fig. 2). We observed no effect of aux1-121 on meristem size (Fig. 2A). For example, the meristem size of the aux1-121 single mutant was indistinguishable from wild type in the absence or presence of cytokinin (Fig. 2A). Similarly, the aux1-121 mutant had no additive effect on the meristem phenotype in combination with arr12 and arr1 (Fig. 2A), suggesting that these type-B ARRs, but not AUX1, play a role in regulating cell proliferation in the root apical meristem (Fig. 2A). In contrast to what we observed for meristem size, the aux1-121 mutation had a substantial effect on the ability of cytokinin to regulate cell expansion in the elongation zone (Fig. 2B). Cell length of the aux1 mutants aux1-121, aux1-121 arr12 and aux1-121 arr1 arr12 were indistinguishable from wild type in the absence of cytokinin, but were all insensitive to treatment with exogenous cytokinin. Like aux1-121, the independent aux1-21 allele affected the ability of cytokinin to inhibit cell expansion but not meristem size (Fig. S2C,D). Taken together, these data indicate that AUX1 plays a role in the ability of cytokinin to regulate cell elongation but not cell proliferation in the root. Consistent with this role for the shootward transport of auxin by AUX1 in mediating the cytokinin response, sensitivity for aux1 root growth to cytokinin was fully restored by expressing AUX1 in the mutant LRC and epidermal tissues (Fig. S1C) using a GAL4-based transactivation system (Swarup et al., 2005).

AUX1 was previously found to mediate the inhibitory effect of ethylene on root cell elongation (Ru˚zicka et al., 2007; Stepanova et al., 2005; Strader et al., 2010; Swarup et al., 2007). As cytokinin increases ethylene biosynthesis (Cary et al., 1995; Chae et al., 2003; Hansen et al., 2009; Vogel et al., 1998a), we examined whether the inhibitory effect of cytokinin on cell elongation was ethylene dependent. To examine the role of ethylene, we used the ethylene-insensitive mutant ein2-5 (Fig. 3A) (Alonso, 1999). As shown in Fig. 3B, both ein2-5 and aux1-7 affect the ability of cytokinin to inhibit root growth. The effect of ein2-5 on the cytokinin response is primarily due to the regulation of cell size, not cell proliferation (Fig. 3C,D), consistent with ethylene acting downstream of cytokinin to control cell elongation. However, whereas the aux1 mutant is completely insensitive to cytokinin, the ein2-5 mutant is only partially insensitive to cytokinin. These data indicate that cytokinin inhibits root cell elongation through ethylene-dependent as well as ethylene-independent mechanisms, with both mechanisms converging on AUX1 as a key mediator.

Fig. 3.

The ethylene-insensitive ein2 mutant confers partial insensitivity to cytokinin. (A) Root lengths of wild-type (WT) and ein2-5 seedlings grown in the absence or presence of 10 µl l−1 ethylene (n≥20) for 7 days. (B) Root lengths of WT as well as aux1-7, ein2-5, arr1 arr12 and arr1 arr10-2 arr12 mutants grown in the absence or presence of 1 µM BA (n≥20) for 7 days. (C) Elongation zone cell lengths of roots from WT, ein2-5 and aux1-7 seedlings grown in the absence or presence of 1 µM BA (n≥20) for 7 days. (D) RAM cortex layer cell counts of WT, ein2-5 and aux1-7 seedlings grown in the absence or presence of 1 µM BA (n≥8) for 7 days. Groups marked by different letters are significantly different (P<0.05). Error bars represent s.e.m.

Fig. 3.

The ethylene-insensitive ein2 mutant confers partial insensitivity to cytokinin. (A) Root lengths of wild-type (WT) and ein2-5 seedlings grown in the absence or presence of 10 µl l−1 ethylene (n≥20) for 7 days. (B) Root lengths of WT as well as aux1-7, ein2-5, arr1 arr12 and arr1 arr10-2 arr12 mutants grown in the absence or presence of 1 µM BA (n≥20) for 7 days. (C) Elongation zone cell lengths of roots from WT, ein2-5 and aux1-7 seedlings grown in the absence or presence of 1 µM BA (n≥20) for 7 days. (D) RAM cortex layer cell counts of WT, ein2-5 and aux1-7 seedlings grown in the absence or presence of 1 µM BA (n≥8) for 7 days. Groups marked by different letters are significantly different (P<0.05). Error bars represent s.e.m.

Expression of the type-B response regulator ARR10 is dependent on AUX1 and auxin

Because AUX1 genetically behaved as a positive regulator of cytokinin signaling, enhancing the type-B arr mutant phenotype, we hypothesized that the aux1 mutant might affect expression of type-B ARRs. We therefore examined expression of the seven subfamily-1 type-B ARRs in root tips by use of the NanoString nCounter system, a high-throughput, extremely sensitive and precise method of quantifying transcript abundance (Geiss et al., 2008; Malkov et al., 2009) and which is an effective means of following phytohormone responses (Bhargava et al., 2013; Tsai et al., 2012; Zhang et al., 2011). We performed NanoString analysis on wild type, aux1-21 and the arr1 arr12 cytokinin-insensitive mutant, with expression analyzed following 24-h growth on 1 µM BA or the DMSO vehicle control. We detected expression of ARR1, ARR2, ARR10 and ARR12 (Fig. 4A; Fig. S2A), consistent with these being the most abundantly expressed type-B ARRs in the root tip (Hill et al., 2013). Two independent factors influenced expression of ARR10. First, expression of ARR10 was significantly reduced in aux1 compared with wild type, being expressed at 64% of the wild-type level (Fig. 4A). Second, expression of ARR10 was also influenced by cytokinin, with cytokinin treatment resulting in a reduction in ARR10 expression to 59% of the wild-type level; this reduction in ARR10 expression was dependent on cytokinin signaling as no significant difference was observed in the arr1 arr12 background (Fig. 4A). In the aux1 background, ARR10 was as responsive to cytokinin as in wild type, indicating that these factors independently influence expression of ARR10. We confirmed these effects on ARR10 expression by qRT-PCR using independently isolated root-tip mRNA and our aux1-121 allele (Fig. 4B). The cytokinin-dependent suppression of ARR10 expression required both ARR1 and ARR12, based on single mutant analysis (Fig. S2B). We did not observe inhibition of ARR10 expression by cytokinin in root tissue lacking the root tip (Fig. S2C). In contrast to the ARR10 expression changes in the root tip, expression of ARR1, ARR2 and ARR12 was not significantly affected by aux1 or by cytokinin (Fig. S2A).

Fig. 4.

Effects ofauxin and cytokinin on expression of ARR10. (A) Cytokinin inhibits expression of ARR10. NanoString analysis of ARR10 levels in 7-day-old 1-mm primary root tips of wild type (WT), arr1 arr12 and aux1-21 treated in the absence or presence of 1 µM cytokinin for 24 h. Groups marked by different letters are significantly different (P<0.05). (B) qRT-PCR validation of the data shown in A in WT, arr1 arr12 and aux1-121. (C) Auxin stimulates expression of ARR10 in an aux1-dependent manner. Expression of ARR10 in root tips of WT, arr1 arr12 and aux1-121 of 7-day-old seedlings in the presence or absence of 100 nM IAA. (D) Expression of ARR10 in root tips of WT, arr1 arr12 and aux1-121 of 7-day-old seedlings in the presence or absence of membrane-permeant 100 nM NAA. Relative levels of ARR10 in B-D are normalized to the untreated wild-type control. Error bars represent s.e.m. based on three biological replicates (n=3), with each replicate containing 50-100 root tips.

Fig. 4.

Effects ofauxin and cytokinin on expression of ARR10. (A) Cytokinin inhibits expression of ARR10. NanoString analysis of ARR10 levels in 7-day-old 1-mm primary root tips of wild type (WT), arr1 arr12 and aux1-21 treated in the absence or presence of 1 µM cytokinin for 24 h. Groups marked by different letters are significantly different (P<0.05). (B) qRT-PCR validation of the data shown in A in WT, arr1 arr12 and aux1-121. (C) Auxin stimulates expression of ARR10 in an aux1-dependent manner. Expression of ARR10 in root tips of WT, arr1 arr12 and aux1-121 of 7-day-old seedlings in the presence or absence of 100 nM IAA. (D) Expression of ARR10 in root tips of WT, arr1 arr12 and aux1-121 of 7-day-old seedlings in the presence or absence of membrane-permeant 100 nM NAA. Relative levels of ARR10 in B-D are normalized to the untreated wild-type control. Error bars represent s.e.m. based on three biological replicates (n=3), with each replicate containing 50-100 root tips.

The reduced expression of ARR10 observed in the aux1 mutant background suggests that mobilization of auxin is required for maintaining ARR10 expression. We therefore predicted that treatment of the aux1 mutant with exogenous auxin could rescue ARR10 expression back to its wild-type level. For this purpose, we treated seedlings with the natural auxin indole-3-acetic-acid (IAA) as well as with a membrane-permeable auxin naphthalene-acetic-acid (NAA) (Fig. 4C,D). We observed rescue of ARR10 expression in the root tips of aux1 seedlings treated with NAA but not with IAA. These data are consistent with rescue of the aux1 agravitropic phenotype by the membrane-permeable NAA (Marchant et al., 1999). Expression of the known auxin-regulated genes IAA19 and SHY2 was induced by IAA in aux1 (Fig. S2D,E), demonstrating that the IAA treatment was effective and that expression of ARR10 differs from these genes in its requirement for AUX1-mediated transport. Furthermore, auxin induced expression of ARR10 in the arr1 arr12 background (Fig. 4C,D), consistent with auxin being a positive regulator of ARR10 expression and countering the suppression by cytokinin.

Based on the reduced expression of ARR10 in aux1 mutants, we predicted there could be effects on the induction of the type-A ARRs, which are cytokinin primary-response genes (To et al., 2004). We therefore examined expression of the ten type-A ARRs by NanoString analysis with the same RNA samples (wild type, aux1 and arr1 arr12) used for Fig. 4A. Nine of the type-A ARRs were significantly induced by cytokinin in wild-type root tips (Fig. 5A; Fig. S2F). In the cytokinin-insensitive arr1 arr12 mutant, the expression of multiple type-A ARRs was reduced compared with wild type, this effect being particularly apparent in the cytokinin-treated samples (Fig. 5B,C; Fig. S2F), consistent with expression of type-A ARRs being dependent on transcriptional activity of type-B ARRs. In the aux1 mutant, expression of multiple type-A ARRs was reduced compared with wild type, but here the effect was most pronounced on the basal expression level absent of exogenous cytokinin (Fig. 5D,E; Fig. S2F). Taken together, our results support the hypothesis that AUX1 and shootward auxin transport act to maintain ARR10 transcript levels in root apices, thereby influencing the expression of cytokinin primary-response genes. Furthermore, based on the role of ARR10 in mediating cytokinin signaling, control of ARR10 expression represents one mechanism by which AUX1 might positively regulate cytokinin signaling in the root. As discussed later, the interaction of auxin and cytokinin in the regulation of ARR10 could form an autoregulatory circuit controlling sensitivity to these two hormones.

Fig. 5.

Type-A ARR expression is attenuated in aux1-21 and arr1 arr12 mutant backgrounds. Seven-day-old seedlings were treated in the absence or presence of 1 µM BA for 24 h, and NanoString expression analysis of type-A ARRs performed on 1-mm primary root tips. (A) Type-A ARR induction by cytokinin in wild type. (B) Type-A ARR expression in arr1 arr12 compared with wild type in the absence of cytokinin (−BA). (C) Type-A ARR expression in arr1 arr12 compared with wild type in the presence of cytokinin (+BA). (D) Type-A ARR expression in aux1-21 compared with wild type in the absence of cytokinin (−BA). (E) Type-A ARR expression in aux1-21 compared with wild type in the presence of cytokinin (+BA). Points represent the mean of three biological replicates. Black lines at 45° angles in plots indicate position of equivalent expression level. Gray lines are best-fit lines to indicate overall skewing of type-A ARR expression. Numbers next to points label individual type-A ARR genes. Filled symbols indicate significant differences for type-A ARR expression between the conditions examined (P<0.05).

Fig. 5.

Type-A ARR expression is attenuated in aux1-21 and arr1 arr12 mutant backgrounds. Seven-day-old seedlings were treated in the absence or presence of 1 µM BA for 24 h, and NanoString expression analysis of type-A ARRs performed on 1-mm primary root tips. (A) Type-A ARR induction by cytokinin in wild type. (B) Type-A ARR expression in arr1 arr12 compared with wild type in the absence of cytokinin (−BA). (C) Type-A ARR expression in arr1 arr12 compared with wild type in the presence of cytokinin (+BA). (D) Type-A ARR expression in aux1-21 compared with wild type in the absence of cytokinin (−BA). (E) Type-A ARR expression in aux1-21 compared with wild type in the presence of cytokinin (+BA). Points represent the mean of three biological replicates. Black lines at 45° angles in plots indicate position of equivalent expression level. Gray lines are best-fit lines to indicate overall skewing of type-A ARR expression. Numbers next to points label individual type-A ARR genes. Filled symbols indicate significant differences for type-A ARR expression between the conditions examined (P<0.05).

The type-B ARRs and AUX1 are similarly required for cytokinin-dependent regulation of auxin activity in the root

To examine the role of cytokinin in regulation of the root auxin response, we crossed the DR5:GFP auxin reporter into various type-B ARR mutant backgrounds. Treatment with 1 µM BA significantly induced DR5:GFP expression in the outer cell layer of the wild-type LRC, the increased level of auxin activity being observed following 24-h or constant cytokinin treatment (Fig. 6A-E). The region of increased DR5:GFP activity in the LRC extends from a location approximately parallel to the QC up to the transition zone. We also observed significant induction of the DR5:GFP signal in stele tissue but with longer-term kinetics of induction (Fig. 6A,C,E).

Fig. 6.

Cytokinin induction of auxin activity in the root is dependent on type-B ARRs and AUX1. (A,B) Representative images of DR5:GFP reporter activity in wild-type (WT), arr1 arr12 and aux1-7 backgrounds after 24 h in the absence or presence of 1 µM BA. Arrowheads indicate induction of DR5 reporter in the outer cell layers. (C,D) Representative images of DR5:GFP reporter activity in WT, arr1 arr12 and aux1-7 backgrounds grown in the presence or absence of constant 1 µM BA. (B,D) Close-up images in WT showing cytokinin-induced DR5:GFP activity (green) in the LRC; propidium iodide was used as a cell wall stain (purple). (E) Quantification of tissue-specific DR5:GFP signal from experiment shown in C (n=5). Groups marked by different letters are significantly different by ANOVA applying Bonferroni correction post-test comparisons (P<0.05). (F) NanoString expression analysis of AUX1 transcript from 1-mm root tips of 7-day-old seedlings after 24 h in the absence or presence of 1 µM BA. (G) Representative images of pAUX1:AUX1:YFP expression after growth in the absence or presence of 1 µM BA. Numbers are relative quantification of pAUX1:AUX1:YFP fluorescence (±s.e.m.; n=5; P<0.05). (H) ARR12 binds to intron 8 of AUX1 based on ChIP-qPCR analysis. ChIP analysis was performed on 3-week-old seedlings with two independent 35S:ARR12:myc lines treated with 5 µM BA for 30 min. Three biological replicates of each line were analyzed (error bars represent s.d.). TUB2 and intron 6 of AUX1 are negative controls. (I) Representative images of TCS:GFP reporter showing induction of cytokinin activity in 7-day-old root tips treated for 24 h with 1 µM BA or a vehicle control. Scale bars: 100 µm (A-D,I); 50 µm (G).

Fig. 6.

Cytokinin induction of auxin activity in the root is dependent on type-B ARRs and AUX1. (A,B) Representative images of DR5:GFP reporter activity in wild-type (WT), arr1 arr12 and aux1-7 backgrounds after 24 h in the absence or presence of 1 µM BA. Arrowheads indicate induction of DR5 reporter in the outer cell layers. (C,D) Representative images of DR5:GFP reporter activity in WT, arr1 arr12 and aux1-7 backgrounds grown in the presence or absence of constant 1 µM BA. (B,D) Close-up images in WT showing cytokinin-induced DR5:GFP activity (green) in the LRC; propidium iodide was used as a cell wall stain (purple). (E) Quantification of tissue-specific DR5:GFP signal from experiment shown in C (n=5). Groups marked by different letters are significantly different by ANOVA applying Bonferroni correction post-test comparisons (P<0.05). (F) NanoString expression analysis of AUX1 transcript from 1-mm root tips of 7-day-old seedlings after 24 h in the absence or presence of 1 µM BA. (G) Representative images of pAUX1:AUX1:YFP expression after growth in the absence or presence of 1 µM BA. Numbers are relative quantification of pAUX1:AUX1:YFP fluorescence (±s.e.m.; n=5; P<0.05). (H) ARR12 binds to intron 8 of AUX1 based on ChIP-qPCR analysis. ChIP analysis was performed on 3-week-old seedlings with two independent 35S:ARR12:myc lines treated with 5 µM BA for 30 min. Three biological replicates of each line were analyzed (error bars represent s.d.). TUB2 and intron 6 of AUX1 are negative controls. (I) Representative images of TCS:GFP reporter showing induction of cytokinin activity in 7-day-old root tips treated for 24 h with 1 µM BA or a vehicle control. Scale bars: 100 µm (A-D,I); 50 µm (G).

Induction of DR5:GFP in the outer cell layer and stele was eliminated in the cytokinin-insensitive arr1 arr12 mutant (Fig. 6A,C,E), consistent with it being dependent on the transcriptional activity of the type-B ARRs. Induction of DR5:GFP was also attenuated in the single type-B ARR mutants, indicating an overlapping function in the control of auxin activity (Fig. S3). Similar to arr1 arr12, induction of DR5:GFP in response to cytokinin in was also strongly attenuated in the aux1 mutant (Fig. 6A,C,E). We conclude that the cytokinin induction of auxin activity in the root outer cell layer is dependent on both the type-B ARRs and AUX1, consistent with both acting as positive regulators of cytokinin responses in the root.

To determine whether cytokinin regulates auxin activity by controlling expression of AUX1/LAX family genes, we performed NanoString analysis on its four members. Expression was analyzed in root tips in the presence or absence of 24-h treatment with 1 µM BA. Consistent with previous work (Zhang et al., 2013), LAX2 exhibited the most pronounced change, decreasing in response to exogenous cytokinin to 31% of the untreated control; AUX1 exhibited a more modest decrease to 73% of the untreated control (Fig. 6F; Fig. S4B). The decrease in message levels of AUX1 is reflected at the protein level based on fluorescence analysis of a pAUX1:AUX1-YFP translational fusion (Swarup et al., 2004), which decreased to 58% of the untreated control in response to growth on 1 µM BA (Fig. 6G). The BA-induced decrease in pAUX1:AUX1-YFP occurred similarly in both the LRC and in the epidermal cell layer just above it, although the LRC region exhibited 20-fold higher AUX1-reporter expression than the epidermal cell region. We noted that the AUX1 gene was enriched for extended type-B ARR binding motifs in intron 8 (Fig. S4A) (Franco-Zorilla et al., 2014) and therefore hypothesized that AUX1 might be a direct target of the type-B ARRs. ChIP-qPCR with a CaMV35S:ARR12:MYC construct revealed binding of ARR12 to intron 8 but not to intron 6 of AUX1, consistent with cytokinin suppressing AUX1 expression through direct action of the type-B ARRs (Fig. 6H). Additionally, examination of cytokinin transcriptional activity using the TCS:GFP reporter (Zürcher et al., 2013) revealed that cytokinin activity overlaps the region of AUX1 expression (Fig. 6G,I), consistent with cytokinin modulating auxin flux through action of AUX1. These data indicate that the expression level of AUX1 is regulated in part through cytokinin-dependent effects on gene expression, and these may thus contribute to changes in auxin activity.

Changes in auxin activity are likely to involve multiple regulators, and so we also examined the root tip for additional cytokinin-dependent changes in gene expression. NanoString analysis of the PIN family of auxin efflux carriers revealed that cytokinin induced a modest decrease in PIN2 expression to 77% of the untreated control, and modest increases in PIN4 and PIN7 expression to 166% and 160% of the untreated control, respectively (Fig. S4B), consistent with previous reports (Ruzicka et al., 2009). The arr1 arr12 mutant eliminated or attenuated these effects of cytokinin on gene expression. Expression analysis also indicated that cytokinin stimulated the expression of ABCG36, which encodes an indole-3-butyric acid (IBA) efflux carrier, and TAR2, which encodes a tryptophan aminotransferase for auxin biosynthesis (Fig. S4C) (Stepanova et al., 2008; Strader and Bartel, 2009). These data indicate that cytokinin induces additional changes in gene expression that are predicted to affect both auxin transport and biosynthesis. Significantly, PIN2, tissue-specific expression of which overlaps with that of AUX1, exhibits a similar reduction in expression in response to cytokinin.

DISCUSSION

Cytokinin regulates primary root growth through inhibitory effects on both cell proliferation and elongation (Beemster and Baskin, 2000; Hwang et al., 2012; Kieber and Schaller, 2014; Moubayidin et al., 2009; Schaller et al., 2014). Here, we define regulatory elements specific to the mechanism by which cytokinin inhibits root cell elongation, these involving modulation of both auxin and ethylene activity. Our results establish a genetic circuit whereby the auxin-influx carrier AUX1 operates downstream of cytokinin perception to regulate shootward auxin transport, this involving both ethylene-dependent and -independent mechanisms (Fig. 7A). Our results also provide insight into how cytokinin-dependent changes in transporter expression regulate auxin activity and, through a feedback circuit (Fig. 7B), have the capacity to establish oscillating patterns of gene expression. Our results complement the extensive literature on cytokinin-auxin interactions, and, more specifically, the significance of cytokinin control of auxin transport, which, within the root alone, regulates such diverse processes as vascular patterning, lateral root development and the control of meristem size (Bishopp et al., 2011; Schaller et al., 2015). Below, we discuss our results within the context of what is known about the interactions of cytokinin, auxin and ethylene in the control of root cell elongation and RAM size.

Fig. 7.

Model for cytokinin inhibition of root cell elongation and proliferation. (A) Genetic model for control of root cell elongation and proliferation by cytokinin (CK). The cytokinin signal is transmitted through a two-component signaling pathway involving AHKs, AHPs and type-B ARRs. The auxin influx carrier AUX1 functions downstream of the cytokinin signaling pathway to mediate shootward auxin transport, leading to localized increases in auxin activity, and inhibition of cell elongation. The auxin signaling repressor SHY2 functions downstream of the cytokinin signaling pathway to inhibit rootward auxin transport, resulting in reduced cell proliferation of the RAM. The regulation of auxin activity by cytokinin involves ethylene-dependent and -independent mechanisms. The model is based on results from this study, as well as those of Růzicka et al. (2007), Dello Ioio et al. (2008) and Street et al. (2015). (B) An autoregulatory circuit (oscillator) by which auxin and cytokinin regulate expression of ARR10 and AUX1.

Fig. 7.

Model for cytokinin inhibition of root cell elongation and proliferation. (A) Genetic model for control of root cell elongation and proliferation by cytokinin (CK). The cytokinin signal is transmitted through a two-component signaling pathway involving AHKs, AHPs and type-B ARRs. The auxin influx carrier AUX1 functions downstream of the cytokinin signaling pathway to mediate shootward auxin transport, leading to localized increases in auxin activity, and inhibition of cell elongation. The auxin signaling repressor SHY2 functions downstream of the cytokinin signaling pathway to inhibit rootward auxin transport, resulting in reduced cell proliferation of the RAM. The regulation of auxin activity by cytokinin involves ethylene-dependent and -independent mechanisms. The model is based on results from this study, as well as those of Růzicka et al. (2007), Dello Ioio et al. (2008) and Street et al. (2015). (B) An autoregulatory circuit (oscillator) by which auxin and cytokinin regulate expression of ARR10 and AUX1.

Our results define a genetic circuit whereby cytokinin inhibits cell elongation through AUX1-dependent changes in auxin activity at the root tip (Fig. 7A). A role for cytokinin in controlling shootward auxin transport is consistent with the distribution of cytokinin activity based on analysis of the Two-Component signaling Sensor (TCS) reporter and measurement of cytokinin levels in cells of the root apex (Antoniadi et al., 2015). Cytokinin-dependent stimulation of auxin activity in outer cells of the LRC was previously observed (Ruzicka et al., 2009), consistent with what we observe. Our results expand on this prior observation by directly linking the effect of cytokinin on auxin activity in this region to the control of cell elongation, not cell proliferation. Furthermore, we find that cytokinin insensitivity (type-B ARR mutants) or loss of AUX1 result in an inability to induce this zone of auxin activity, as well as an inability to inhibit cell elongation. Because a primary function for AUX1 in these tissues is to mediate shootward auxin transport (Band et al., 2014; Marchant et al., 1999; Swarup et al., 2005), our results support a model in which modulation of shootward auxin flux acts as a key mechanism by which cytokinin controls cell elongation.

We find that AUX1 mediates the inhibitory effects of cytokinin on cell elongation, but is not essential for the inhibition of cell proliferation by cytokinin in the RAM. These results indicate that the regulatory effects of cytokinin on cell expansion and proliferation in the root are separable, such regulatory independence probably being facilitated by the spatial separation of the RAM and elongation zone, with shootward auxin flux controlling cell expansion and rootward auxin flux controlling cell proliferation (Fig. 7A) (Dello Ioio et al., 2008). It has been recently proposed that a shootward auxin flux may mediate communication between the QC and the transition zone to control cell proliferation at the RAM (Moubayidin et al., 2013). However, a prediction of that proposal is that loss of the shootward flux, such as that which occurs in an aux1 mutant, would result in an altered RAM size. We do not observe such an aux1-dependent effect on RAM size (i.e. the ability of cytokinin to inhibit cell proliferation of the RAM is unaffected by the aux1 mutation), indicating that alternative mechanisms exist to coordinate RAM behavior between the QC and the transition zone.

Ethylene also contributes to the inhibitory effects of cytokinin on root cell elongation based on genetic analysis (Fig. 7A). Ethylene-insensitive mutants were first demonstrated to be hyposensitive to cytokinin in regards to overall root growth over two decades ago (Su and Howell, 1992). Since then, a role for ethylene in mediating the effects of cytokinin specifically on root cell elongation has been proposed based on the ability of cytokinin to induce ethylene biosynthesis (Chae et al., 2003; Hansen et al., 2009; Vogel et al., 1998a) and the finding that ethylene inhibits root growth through effects on cell elongation (Bleecker et al., 1988; Kieber et al., 1993; Le et al., 2001). Furthermore, the effects of ethylene on root cell elongation, like cytokinin, require AUX1-dependent changes in auxin distribution (Ru˚zicka et al., 2007; Swarup et al., 2007). Our results confirm the proposed role for ethylene in the cytokinin response but also, in contrast to prior results, indicate that ethylene-independent mechanisms exist by which cytokinin controls auxin activity. Thus, cytokinin directly affects the AUX1-dependent auxin flux. An overestimation of the role played by ethylene in the cytokinin response may have arisen in part due to use of the ethylene biosynthesis inhibitor 2-aminoethoxyvinyl glycine (AVG) and signaling inhibitor silver ion (Ruzicka et al., 2009; Ru˚zicka et al., 2007), which both also affect auxin activity (Soeno et al., 2010; Strader et al., 2009), thereby confounding interpretation of some results. Additionally, ethylene inhibits cell proliferation at the RAM and contributes to the cytokinin response here as well (Street et al., 2015) (Fig. 7A), which may also affect analysis of the role of cytokinin in regulating root growth.

Although AUX1-mediated transport of auxin is necessary for cytokinin-dependent control of cell elongation, we find that the expression of AUX1 is inhibited by cytokinin, a finding that might seem counterintuitive at first. AUX1 is a direct target for cytokinin regulation based on type-B ARR12 binding to intron 8, the repression of gene expression by transcription factor binding to introns being well-documented and serving, for example, to repress the expression of AGAMOUS (Sieburth and Meyerowitz, 1997; Dinh et al., 2012). The expression of PIN2, which encodes an auxin-efflux carrier involved in shootward auxin transport, is also reduced in response to cytokinin (Ruzicka et al., 2009). Cytokinin thus represses the expression of two key regulators that mediate the shootward auxin flux, this correlating with the increase in auxin activity in the LRC. We hypothesize that the transition zone is a ‘bottleneck’ for auxin transport, based on the lower level of AUX1 in the epidermal cells of the transition zone compared with the LRC, such that a decrease in AUX1 levels will reduce auxin transport out of this region and result in increased auxin activity and an inhibition of cell elongation. Thus, AUX1 is needed for shootward auxin transport to its site of action at the transition zone, the observed expression changes serving to concentrate auxin in this region. Consistent with this hypothesis, cytokinin reduces the shootward transport of IAA (Zhou et al., 2011). Cytokinin also induced expression of ABCG36, which encodes an IBA efflux carrier, as well as TAR2, which encodes a tryptophan aminotransferase, further emphasizing the importance of auxin transport and biosynthesis in controlling the cytokinin response at the root tip (Stepanova et al., 2008; Strader and Bartel, 2009).

We uncovered a feedback circuit involving expression of the type-B response regulator ARR10 and AUX1 (Fig. 7B), and it is likely that this circuit also plays a role in integrating the effects of cytokinin and auxin on cell elongation and differentiation. AUX1-dependent increases in auxin activity positively regulate expression of ARR10, which would increase cytokinin activity. However, cytokinin acting through the type-B ARRs negatively regulates expression of AUX1 as well as of ARR10, which would decrease cytokinin activity. Regulation of ARR10 expression, in comparison to other members of the type-B ARR family, may be of particular significance owing to its protein stability (Argyros et al., 2008; Hill et al., 2013; Kim et al., 2013, 2012) and enrichment in the epidermal layer where AUX1 is also most active (Argyros et al., 2008; Band et al., 2014), thereby placing ARR10 within a region particularly sensitive to changes in auxin flux. Such cytokinin-auxin antagonism is a common motif in hormonal regulation (Schaller et al., 2015) and here takes the form of a regulatory feedback circuit similar to that of circadian oscillators. Interestingly, the region bordering the RAM has been referred to as the ‘oscillation zone’ owing to its role in establishing oscillating patterns of gene expression in a manner that is partially dependent on root cap-derived auxin (Moreno-Risueno et al., 2010; Xuan et al., 2015). This is also the region in which type-B ARRs are maximally expressed and mediate effects of cytokinin on cell differentiation. Therefore, the auxin-cytokinin feedback circuit described here could establish oscillating patterns of gene expression and of shootward auxin flux through AUX1 in the root. Non-transcriptional mechanisms might also play a role in short-term regulation of auxin transport, such as phosphorylation and/or subcellular trafficking of the transporters (Kleine-Vehn et al., 2006; Rashotte et al., 2001; Rigó et al., 2013; Robert and Offringa, 2008; Titapiwatanakun and Murphy, 2009; Zourelidou et al., 2014), although cytokinin-dependent changes in membrane localization/endocytosis have not yet been observed for AUX1 or PIN2 (Marhavý et al., 2011).

MATERIALS AND METHODS

Plant material and growth conditions

Wild-type and mutant lines of Arabidopsis thaliana are Columbia ecotype. The type-B ARR, AUX/LAX and ein2-5 mutants have been previously described (Argyros et al., 2008; Mason et al., 2005; Ugartechea-Chirino et al., 2010; Vogel et al., 1998a). We used the arr12-1 and arr1-3 mutant alleles for these studies and refer to these as arr12 and arr1 for convenience. The AUX1:AUX1:YFP (Swarup et al., 2004) and DR5:GFP (Ulmasov et al., 1997) reporter constructs were introduced into mutant backgrounds by crossing; genotyping primers are given in Argyros et al. (2008) and Table S1. The TCS:GFP reporter for cytokinin activity has been previously described (Zürcher et al., 2013). Seedlings for molecular and physiological assays were grown on medium containing 1× Murashige and Skoog (MS) salts with Gamborg's vitamins and MES (Research Products International), 1% (w/v) sucrose and 0.9% (w/v) phytoagar (Research Products International) under continuous white light (100 μE m−2 s−1) at 22°C, as previously described (Argyros et al., 2008). BA was included in the medium for exogenous cytokinin treatment, the control containing the DMSO vehicle.

Mutant screen

For mutagenesis, 5000 M0 generation arr12 or arr1 seeds were treated with 0.2% (v/v) EMS (Sigma), pooled (∼100 seeds per pool), and the M1 generation seeds harvested from the plants and selfed. We screened 20,000 M2 seeds of each genotype, using a pooling strategy with approximately 500 seeds per pool for the identification of err mutants. The M2 seeds were sown on media containing 0.1 µM BA with wild-type and type-B arr mutant background controls. Five-day-old M2 seedlings with long roots relative to the arr12 or arr1 single mutants were selected. Cytokinin insensitivity was confirmed in the M3 generation for six of the candidate err mutants. err mutants were crossed into wild type and arr1 arr12 to assess the contribution of the type-B arr mutant background to the err cytokinin sensitivity. The primers used for genotyping err and arr mutant alleles are given in Table S1, with genotyping performed as previously described (Argyros et al., 2008). Mutant alleles used in this study are given in Table S2.

Root meristem size and cell length determination

Seedlings were cleared with chloral hydrate as described (Perilli and Sabatini, 2010). To determine the size of the root meristem, cells of the cortex layer were counted in a file extending from the QC to where the cell length exceeded its width using a Nikon Eclipse 90i optical microscope with Nomarski optics and the 20× objective as previously described (Perilli and Sabatini, 2010). Cell length was determined from images captured with a Cool Snap HQ2 digital camera (Photometrics) from trichoblast cells at the shootward end of the elongation zone, based on where root hair primordia emerge in wild-type plants (Le et al., 2001). Cell length was measured using ImageJ software (Abramoff et al., 2004).

RNA isolation and expression analysis

Seeds were plated on 20-μm nylon mesh (BioDesign). Fifty root tips (1 mm) from seven-day-old seedlings were harvested following 24-h treatment with 1 µM BA or a vehicle control. Root tips were placed immediately in RNAlater (Life Technologies); the RNAlater solution was removed within 24 h and the tissue frozen in liquid nitrogen. The tissue was ground using a Retsch Tissuelyzer and RNA extracted using an RNeasy Plant RNA Isolation Kit (Qiagen). Reverse transcription was performed using Bio-Rad iScript cDNA Synthesis Kit.

NanoString gene expression analysis was performed using a custom probe set (NanoString Technologies) targeted against type-A and type-B ARRs, AUX1/LAX family members and PIN family members (Table S3). Three biological replicates, with 400 ng of total RNA from 1 mm root tips, were submitted for nCounter analysis. Geometric mean and background subtraction were performed using nSolver software v1.1 (Geiss et al., 2008; Malkov et al., 2009). Counts were normalized using NanoString internal positive controls as well as three Arabidopsis control genes included in the probe set: At1g13320 (PROTEIN PHOSPHATASE 2A), At4g05320 (UBIQUITIN 10) and At5g44340 (BETA-TUBULIN 4). Normalized counts were averaged and analyzed by a two-way ANOVA.

qRT-PCR was performed using the Bio-Rad iTaq SYBR-green system, with three biological replicates and three technical replicates each per treatment. Relative expression was calculated using the ΔΔCt values and normalized to the wild-type non-treated control. Primers are listed in Table S1.

To image and evaluate relative expression of fluorescent reporters, a Nikon A1 confocal microscope was used. At least five seedlings per line were imaged and ImageJ software was used to quantify fluorescence by the ‘corrected total cell fluorescence’ method (Burgess et al., 2010). Cell walls were visualized by staining with 10 µg/ml propidium iodide.

ChIP analysis

ChIP-qPCR was performed in biological triplicate with two independent lines of 35S:ARR12-Myc expressed in wild-type background. The ARR12 construct was generated by cloning a genomic DNA fragment of ARR12 into the vector pEarleyGate 203 (Earley et al., 2006), using primers ATGACTGTTGAACAAAATTTAGAA and TATGCATGTTCTGAGTGAACT for initial amplification of ARR12. Three-week-old seedlings were treated with 5 µM BA in liquid MS media for 30 min, and tissue cross-linking, chromatin isolation, and immunoprecipitation performed as described (Zhang et al., 2013). Immunoprecipitation was performed using anti-Myc (ab9132, Abcam; 5 µg/sample) antibodies and MagnaChIP protein A+G Magnetic beads (EMD Millipore). Input and ChIP DNA were examined by qRT-PCR using the primers listed in Table S1.

Statistical analyses

ANOVA tables were generated using http://www.physics.csbsju.edu/stats/anova.html and multiple comparison tests performed using the QuickCalcs web tool (http://graphpad.com/quickcalcs/posttest1), which uses the Bonferroni correction for post-test comparisons.

Accession numbers

ARR1 (At3g16857), ARR10 (At4g31920), ARR12 (At2g25180), AUX1 (At2g38120), LAX1 (At5g01240), LAX2 (At2g21050), LAX3 (At1g77690), EIN2 (At5g03280).

Acknowledgements

A.S. gratefully acknowledges financial support from Tarbiat Modares University and extends thanks to G.E.S. and his lab for their kindness while he performed research during his sabbatical leave.

Author contributions

I.H.S., J.J.K. and G.E.S. designed the study. I.H.S., with contributions from M.V.Y., R.T.J. and A.S., performed the experiments and analyzed the data. D.E.M., R.S. and M.J.B. generated materials. I.H.S. and G.E.S. wrote the manuscript with input from all authors.

Funding

This work was supported by the National Science Foundation [IOS-1022053 and IOS-1238051 to G.E.S. and J.J.K., IOS-1456487 to G.E.S.]; a Biotechnology and Biological Sciences Research Council (BBSRC) Professorial Research Fellowship award to M.J.B.; and a BBSRC award to the Centre for Plant Integrative Biology (R.S. and M.J.B.). Deposited in PMC for release after 6 months.

References

Abramoff
,
M. D.
,
Magalhães
,
P. J.
and
Ram
,
S. J.
(
2004
).
Image processing with imageJ
.
Biophoton. Int.
11
,
36
-
42
.
Alonso
,
J. M.
(
1999
).
EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis
.
Science
284
,
2148
-
2152
.
Antoniadi
,
I.
,
Plačková
,
L.
,
Simonovik
,
B.
,
Doležal
,
K.
,
Turnbull
,
C.
,
Ljung
,
K.
and
Novák
,
O.
(
2015
).
Cell-type-specific cytokinin distribution within the Arabidopsis primary root apex
.
Plant Cell
27
,
1955
-
1967
.
Argyros
,
R. D.
,
Mathews
,
D. E.
,
Chiang
,
Y.-H.
,
Palmer
,
C. M.
,
Thibault
,
D. M.
,
Etheridge
,
N.
,
Argyros
,
D. A.
,
Mason
,
M. G.
,
Kieber
,
J. J.
and
Schaller
,
G. E.
(
2008
).
Type B response regulators of Arabidopsis play key roles in cytokinin signaling and plant development
.
Plant Cell
20
,
2102
-
2116
.
Band
,
L. R.
,
Wells
,
D. M.
,
Fozard
,
J. A.
,
Ghetiu
,
T.
,
French
,
A. P.
,
Pound
,
M. P.
,
Wilson
,
M. H.
,
Yu
,
L.
,
Li
,
W.
,
Hijazi
,
H. I.
, et al. 
(
2014
).
Systems analysis of auxin transport in the Arabidopsis root apex
.
Plant Cell
26
,
862
-
875
.
Beemster
,
G. T. S.
and
Baskin
,
T. I.
(
2000
).
Stunted plant 1 mediates effects of cytokinin, but not of auxin, on cell division and expansion in the root of Arabidopsis
.
Plant Physiol.
124
,
1718
-
1727
.
Bennett
,
T.
and
Scheres
,
B.
(
2010
).
Root development – two meristems for the price of one?
Curr. Top. Dev. Biol.
91
,
67
-
102
.
Bennett
,
M. J.
,
Marchant
,
A.
,
Green
,
H. G.
,
May
,
S. T.
,
Ward
,
S. P.
,
Millner
,
P. A.
,
Walker
,
A. R.
,
Schulz
,
B.
and
Feldmann
,
K. A.
(
1996
).
Arabidopsis AUX1 gene: a permease-like regulator of root gravitropism
.
Science
273
,
948
-
950
.
Bhargava
,
A.
,
Clabaugh
,
I.
,
To
,
J. P.
,
Maxwell
,
B. B.
,
Chiang
,
Y.-H.
,
Schaller
,
G. E.
,
Loraine
,
A.
and
Kieber
,
J. J.
(
2013
).
Identification of cytokinin-responsive genes using microarray meta-analysis and RNA-seq in Arabidopsis
.
Plant Physiol.
162
,
272
-
294
.
Bishopp
,
A.
,
Help
,
H.
,
El-Showk
,
S.
,
Weijers
,
D.
,
Scheres
,
B.
,
Friml
,
J.
,
Benková
,
E.
,
Mähönen
,
A. P.
and
Helariutta
,
Y.
(
2011
).
A mutually inhibitory interaction between auxin and cytokinin specifies vascular pattern in roots
.
Curr. Biol.
21
,
917
-
926
.
Bleecker
,
A. B.
,
Estelle
,
M. A.
,
Somerville
,
C.
and
Kende
,
H.
(
1988
).
Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana
.
Science
241
,
1086
-
1089
.
Burgess
,
A.
,
Vigneron
,
S.
,
Brioudes
,
E.
,
Labbé
,
J.-C.
,
Lorca
,
T.
and
Castro
,
A.
(
2010
).
Loss of human Greatwall results in G2 arrest and multiple mitotic defects due to deregulation of the cyclin B-Cdc2/PP2A balance
.
Proc. Natl. Acad. Sci. USA
107
,
12564
-
12569
.
Cary
,
A. J.
,
Liu
,
W.
and
Howell
,
S. H.
(
1995
).
Cytokinin action is coupled to ethylene in its effects on the inhibition of root and hypocotyl elongation in Arabidopsis thaliana seedlings
.
Plant Physiol.
107
,
1075
-
1082
.
Chae
,
H. S.
,
Faure
,
F.
and
Kieber
,
J. J.
(
2003
).
The eto1, eto2, and eto3 mutations and cytokinin treatment increase ethylene biosynthesis in Arabidopsis by increasing the stability of ACS protein
.
Plant Cell
15
,
545
-
559
.
De Rybel
,
B.
,
Adibi
,
M.
,
Breda
,
A. S.
,
Wendrich
,
J. R.
,
Smit
,
M. E.
,
Novak
,
O.
,
Yamaguchi
,
N.
,
Yoshida
,
S.
,
Van Isterdael
,
G.
,
Palovaara
,
J.
, et al. 
(
2014
).
Integration of growth and patterning during vascular tissue formation in Arabidopsis
.
Science
345
,
1255215
.
Dello Ioio
,
R.
,
Linhares
,
F. S.
,
Scacchi
,
E.
,
Casamitjana-Martinez
,
E.
,
Heidstra
,
R.
,
Costantino
,
P.
and
Sabatini
,
S.
(
2007
).
Cytokinins determine Arabidopsis root-meristem size by controlling cell differentiation
.
Curr. Biol.
17
,
678
-
682
.
Dello Ioio
,
R.
,
Nakamura
,
K.
,
Moubayidin
,
L.
,
Perilli
,
S.
,
Taniguchi
,
M.
,
Morita
,
M. T.
,
Aoyama
,
T.
,
Costantino
,
P.
and
Sabatini
,
S.
(
2008
).
A genetic framework for the control of cell division and differentiation in the root meristem
.
Science
322
,
1380
-
1384
.
Dinh
,
T. T.
,
Girke
,
T.
,
Liu
,
X.
,
Yant
,
L.
,
Schmid
,
M.
and
Chen
,
X.
(
2012
).
The floral homeotic protein APETALA2 recognizes and acts through an AT-rich sequence element
.
Development
139
,
1978
-
1986
.
Earley
,
K. W.
,
Haag
,
J. R.
,
Pontes
,
O.
,
Opper
,
K.
,
Juehne
,
T.
,
Song
,
K.
and
Pikaard
,
C. S.
(
2006
).
Gateway-compatible vectors for plant functional genomics and proteomics
.
Plant J.
45
,
616
-
629
.
El-Showk
,
S.
,
Ruonala
,
R.
and
Helariutta
,
Y.
(
2013
).
Crossing paths: cytokinin signaling and crosstalk
.
Development
140
,
1373
-
1383
.
Franco-Zorrilla
,
J. M.
,
Lopez-Vidriero
,
I.
,
Carrasco
,
J. L.
,
Godoy
,
M.
,
Vera
,
P.
and
Solano
,
R.
(
2014
).
DNA-binding specificities of plant transcription factors and their potential to define target genes
.
Proc. Natl. Acad. Sci. USA
111
,
2367
-
2372
.
Geiss
,
G. K.
,
Bumgarner
,
R. E.
,
Birditt
,
B.
,
Dahl
,
T.
,
Dowidar
,
N.
,
Dunaway
,
D. L.
,
Fell
,
H. P.
,
Ferree
,
S.
,
George
,
R. D.
,
Grogan
,
T.
, et al. 
(
2008
).
Direct multiplexed measurement of gene expression with color-coded probe pairs
.
Nat. Biotechnol.
26
,
317
-
325
.
Giehl
,
R. F. H.
,
Gruber
,
B. D.
and
von Wirén
,
N.
(
2014
).
It's time to make changes: modulation of root system architecture by nutrient signals
.
J. Exp. Bot.
65
,
769
-
778
.
Hansen
,
M.
,
Chae
,
H. S.
and
Kieber
,
J. J.
(
2009
).
Regulation of ACS protein stability by cytokinin and brassinosteroid
.
Plant J.
57
,
606
-
614
.
Hill
,
K.
,
Mathews
,
D. E.
,
Kim
,
H. J.
,
Street
,
I. H.
,
Wildes
,
S. L.
,
Chiang
,
Y.-H.
,
Mason
,
M. G.
,
Alonso
,
J. M.
,
Ecker
,
J. R.
,
Kieber
,
J. J.
, et al. 
(
2013
).
Functional characterization of type-B response regulators in the Arabidopsis cytokinin response
.
Plant Physiol.
162
,
212
-
224
.
Hwang
,
I.
,
Sheen
,
J.
and
Müller
,
B.
(
2012
).
Cytokinin signaling networks
.
Annu. Rev. Plant Biol.
63
,
353
-
380
.
Ishida
,
K.
,
Yamashino
,
T.
,
Yokoyama
,
A.
and
Mizuno
,
T.
(
2008
).
Three type-B response regulators, ARR1, ARR10 and ARR12, play essential but redundant roles in cytokinin signal transduction throughout the life cycle of Arabidopsis thaliana
.
Plant Cell Physiol.
49
,
47
-
57
.
Jones
,
B.
and
Ljung
,
K.
(
2012
).
Subterranean space exploration: the development of root system architecture
.
Curr. Opin. Plant Biol.
15
,
97
-
102
.
Kieber
,
J. J.
and
Schaller
,
G. E.
(
2014
).
Cytokinins
.
Arabidopsis Book
12
,
e0168
.
Kieber
,
J. J.
,
Rothenberg
,
M.
,
Roman
,
G.
and
Feldmann
,
K. A.
(
1993
).
CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases
.
Cell
72
,
427
-
441
.
Kim
,
K.
,
Ryu
,
H.
,
Cho
,
Y.-H.
,
Scacchi
,
E.
,
Sabatini
,
S.
and
Hwang
,
I.
(
2012
).
Cytokinin-facilitated proteolysis of ARABIDOPSIS RESPONSE REGULATOR 2 attenuates signaling output in two-component circuitry
.
Plant J.
69
,
934
-
945
.
Kim
,
H. J.
,
Chiang
,
Y.-H.
,
Kieber
,
J. J.
and
Schaller
,
G. E.
(
2013
).
SCFKMD controls cytokinin signaling by regulating the degradation of type-B response regulators
.
Proc. Natl. Acad. Sci. USA
110
,
10028
-
10033
.
Kleine-Vehn
,
J.
,
Dhonukshe
,
P.
,
Swarup
,
R.
,
Bennett
,
M.
and
Friml
,
J.
(
2006
).
Subcellular trafficking of the Arabidopsis auxin influx carrier AUX1 uses a novel pathway distinct from PIN1
.
Plant Cell
18
,
3171
-
3181
.
Le
,
J.
,
Vandenbussche
,
F.
,
Van Der Straeten
,
D.
and
Verbelen
,
J.-P.
(
2001
).
In the early response of Arabidopsis roots to ethylene, cell elongation is up- and down-regulated and uncoupled from differentiation
.
Plant Physiol.
125
,
519
-
522
.
Malkov
,
V. A.
,
Serikawa
,
K. A.
,
Balantac
,
N.
,
Watters
,
J.
,
Geiss
,
G.
,
Mashadi-Hossein
,
A.
and
Fare
,
T.
(
2009
).
Multiplexed measurements of gene signatures in different analytes using the nanostring nCounter™ assay system
.
BMC Res. Notes
2
,
80
.
Marchant
,
A.
,
Kargul
,
J.
,
May
,
S. T.
,
Muller
,
P.
,
Delbarre
,
A.
,
Perrot-Rechenmann
,
C.
and
Bennett
,
M. J.
(
1999
).
AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues
.
EMBO J.
18
,
2066
-
2073
.
Marchant
,
A.
,
Bhalerao
,
R.
,
Casimiro
,
I.
,
Eklöf
,
J.
,
Casero
,
P. J.
,
Bennett
,
M.
and
Sandberg
,
G.
(
2002
).
AUX1 promotes lateral root formation by facilitating indole-3-acetic acid distribution between sink and source tissues in the Arabidopsis seedling
.
Plant Cell
14
,
589
-
597
.
Marhavý
,
P.
,
Bielach
,
A.
,
Abas
,
L.
,
Abuzeineh
,
A.
,
Duclercq
,
J.
,
Tanaka
,
H.
,
Pařezová
,
M.
,
Petrášek
,
J.
,
Friml
,
J.
,
Kleine-Vehn
,
J.
, et al. 
(
2011
).
Cytokinin modulates endocytic trafficking of PIN1 auxin efflux carrier to control plant organogenesis
.
Dev. Cell
21
,
796
-
804
.
Mason
,
M. G.
,
Mathews
,
D. E.
,
Argyros
,
D. A.
,
Maxwell
,
B. B.
,
Kieber
,
J. J.
,
Alonso
,
J. M.
,
Ecker
,
J. R.
and
Schaller
,
G. E.
(
2005
).
Multiple type-B response regulators mediate cytokinin signal transduction in Arabidopsis
.
Plant Cell
17
,
3007
-
3018
.
Moreno-Risueno
,
M. A.
,
Van Norman
,
J. M.
,
Moreno
,
A.
,
Zhang
,
J.
,
Ahnert
,
S. E.
and
Benfey
,
P. N.
(
2010
).
Oscillating gene expression determines competence for periodic Arabidopsis root branching
.
Science
329
,
1306
-
1311
.
Moubayidin
,
L.
,
Di Mambro
,
R.
and
Sabatini
,
S.
(
2009
).
Cytokinin–auxin crosstalk
.
Trends Plant Sci.
14
,
557
-
562
.
Moubayidin
,
L.
,
Di Mambro
,
R.
,
Sozzani
,
R.
,
Pacifici
,
E.
,
Salvi
,
E.
,
Terpstra
,
I.
,
Bao
,
D.
,
van Dijken
,
A.
,
Dello Ioio
,
R.
,
Perilli
,
S.
, et al. 
(
2013
).
Spatial coordination between stem cell activity and cell differentiation in the root meristem
.
Dev. Cell
26
,
405
-
415
.
Péret
,
B.
,
Swarup
,
K.
,
Ferguson
,
A.
,
Seth
,
M.
,
Yang
,
Y.
,
Dhondt
,
S.
,
James
,
N.
,
Casimiro
,
I.
,
Perry
,
P.
,
Syed
,
A.
, et al. 
(
2012
).
AUX/LAX genes encode a family of auxin influx transporters that perform distinct functions during Arabidopsis development
.
Plant Cell
24
,
2874
-
2885
.
Perilli
,
S.
and
Sabatini
,
S.
(
2010
).
Analysis of root meristem size development
.
Methods Mol. Biol.
655
,
177
-
187
.
Perilli
,
S.
,
Di Mambro
,
R.
and
Sabatini
,
S.
(
2012
).
Growth and development of the root apical meristem
.
Curr. Opin. Plant Biol.
15
,
17
-
23
.
Rashotte
,
A. M.
,
DeLong
,
A.
and
Muday
,
G. K.
(
2001
).
Genetic and chemical reductions in protein phosphatase activity alter auxin transport, gravity response, and lateral root growth
.
Plant Cell
13
,
1683
-
1697
.
Rigó
,
G.
,
Ayaydin
,
F.
,
Tietz
,
O.
,
Zsigmond
,
L.
,
Kovács
,
H.
,
Páy
,
A.
,
Salchert
,
K.
,
Darula
,
Z.
,
Medzihradszky
,
K. F.
,
Szabados
,
L.
, et al. 
(
2013
).
Inactivation of plasma membrane-localized CDPK-RELATED KINASE5 decelerates PIN2 exocytosis and root gravitropic response in Arabidopsis
.
Plant Cell
25
,
1592
-
1608
.
Robert
,
H. S.
and
Offringa
,
R.
(
2008
).
Regulation of auxin transport polarity by AGC kinases
.
Curr. Opin. Plant Biol.
11
,
495
-
502
.
Růzicka
,
K.
,
Ljung
,
K.
,
Vanneste
,
S.
,
Podhorská
,
R.
,
Beeckman
,
T.
,
Friml
,
J.
and
Benková
,
E.
(
2007
).
Ethylene regulates root growth through effects on auxin biosynthesis and transport-dependent auxin distribution
.
Plant Cell
19
,
2197
-
2212
.
Růzicka
,
K.
,
Simaskova
,
M.
,
Duclercq
,
J.
,
Petrasek
,
J.
,
Zazimalova
,
E.
,
Simon
,
S.
,
Friml
,
J.
,
Van Montagu
,
M. C. E.
and
Benková
,
E.
(
2009
).
Cytokinin regulates root meristem activity via modulation of the polar auxin transport
.
Proc. Natl. Acad. Sci. USA
106
,
4284
-
4289
.
Schaller
,
G. E.
,
Shiu
,
S.-H.
and
Armitage
,
J. P.
(
2011
).
Two-component systems and their co-option for eukaryotic signal transduction
.
Curr. Biol.
21
,
R320
-
R330
.
Schaller
,
G. E.
,
Street
,
I. H.
and
Kieber
,
J. J.
(
2014
).
Cytokinin and the cell cycle
.
Curr. Opin. Plant Biol.
21
,
7
-
15
.
Schaller
,
G. E.
,
Bishopp
,
A.
and
Kieber
,
J. J.
(
2015
).
The yin-yang of hormones: cytokinin and auxin interactions in plant development
.
Plant Cell
27
,
44
-
63
.
Scheres
,
B.
,
Benfey
,
P.
and
Dolan
,
L.
(
2002
).
Root development
.
Arabidopsis Book
1
,
e0101
.
Sieburth
,
L. E.
and
Meyerowitz
,
E. M.
(
1997
).
Molecular dissection of the AGAMOUS control region shows that cis elements for spatial regulation are located intragenically
.
Plant Cell
9
,
355
-
365
.
Soeno
,
K.
,
Goda
,
H.
,
Ishii
,
T.
,
Ogura
,
T.
,
Tachikawa
,
T.
,
Sasaki
,
E.
,
Yoshida
,
S.
,
Fujioka
,
S.
,
Asami
,
T.
and
Shimada
,
Y.
(
2010
).
Auxin biosynthesis inhibitors, identified by a genomics-based approach, provide insights into auxin biosynthesis
.
Plant Cell Physiol.
51
,
524
-
536
.
Stepanova
,
A. N.
,
Hoyt
,
J. M.
,
Hamilton
,
A. A.
and
Alonso
,
J. M.
(
2005
).
A link between ethylene and auxin uncovered by the characterization of two root-specific ethylene-insensitive mutants in Arabidopsis
.
Plant Cell
17
,
2230
-
2242
.
Stepanova
,
A. N.
,
Robertson-Hoyt
,
J.
,
Yun
,
J.
,
Benavente
,
L. M.
,
Xie
,
D.-Y.
,
Doležal
,
K.
,
Schlereth
,
A.
,
Jürgens
,
G.
and
Alonso
,
J. M.
(
2008
).
TAA1-mediated auxin biosynthesis is essential for hormone crosstalk and plant development
.
Cell
133
,
177
-
191
.
Strader
,
L. C.
and
Bartel
,
B.
(
2009
).
The Arabidopsis PLEIOTROPIC DRUG RESISTANCE8/ABCG36 ATP binding cassette transporter modulates sensitivity to the auxin precursor indole-3-butyric acid
.
Plant Cell
21
,
1992
-
2007
.
Strader
,
L. C.
,
Beisner
,
E. R.
and
Bartel
,
B.
(
2009
).
Silver ions increase auxin efflux independently of effects on ethylene response
.
Plant Cell
21
,
3585
-
3590
.
Strader
,
L. C.
,
Chen
,
G. L.
and
Bartel
,
B.
(
2010
).
Ethylene directs auxin to control root cell expansion
.
Plant J.
64
,
874
-
884
.
Street
,
I. H.
,
Aman
,
S.
,
Zubo
,
Y.
,
Ramzan
,
A.
,
Wang
,
X.
,
Shakeel
,
S. N.
,
Kieber
,
J. J.
and
Schaller
,
G. E.
(
2015
).
Ethylene inhibits cell proliferation of the Arabidopsis root meristem
.
Plant Physiol.
169
,
338
-
350
.
Su
,
W.
and
Howell
,
S. H.
(
1992
).
A single genetic locus, Ckr1, defines Arabidopsis mutants in which root growth is resistant to low concentrations of cytokinin
.
Plant Physiol.
99
,
1569
-
1574
.
Swarup
,
R.
,
Friml
,
J.
,
Marchant
,
A.
,
Ljung
,
K.
,
Sandberg
,
G.
,
Palme
,
K.
and
Bennett
,
M.
(
2001
).
Localization of the auxin permease AUX1 suggests two functionally distinct hormone transport pathways operate in the Arabidopsis root apex
.
Genes Dev.
15
,
2648
-
2653
.
Swarup
,
R.
,
Kargul
,
J.
,
Marchant
,
A.
,
Zadik
,
D.
,
Rahman
,
A.
,
Mills
,
R.
,
Yemm
,
A.
,
May
,
S.
,
Williams
,
L.
,
Millner
,
P.
, et al. 
(
2004
).
Structure-function analysis of the presumptive Arabidopsis auxin permease AUX1
.
Plant Cell
16
,
3069
-
3083
.
Swarup
,
R.
,
Kramer
,
E. M.
,
Perry
,
P.
,
Knox
,
K.
,
Leyser
,
H. M. O.
,
Haseloff
,
J.
,
Beemster
,
G. T. S.
,
Bhalerao
,
R.
and
Bennett
,
M. J.
(
2005
).
Root gravitropism requires lateral root cap and epidermal cells for transport and response to a mobile auxin signal
.
Nat. Cell Biol.
7
,
1057
-
1065
.
Swarup
,
R.
,
Perry
,
P.
,
Hagenbeek
,
D.
,
Van Der Straeten
,
D.
,
Beemster
,
G. T. S.
,
Sandberg
,
G.
,
Bhalerao
,
R.
,
Ljung
,
K.
and
Bennett
,
M. J.
(
2007
).
Ethylene upregulates auxin biosynthesis in Arabidopsis seedlings to enhance inhibition of root cell elongation
.
Plant Cell
19
,
2186
-
2196
.
Swarup
,
K.
,
Benková
,
E.
,
Swarup
,
R.
,
Casimiro
,
I.
,
Péret
,
B.
,
Yang
,
Y.
,
Parry
,
G.
,
Nielsen
,
E.
,
De Smet
,
I.
,
Vanneste
,
S.
, et al. 
(
2008
).
The auxin influx carrier LAX3 promotes lateral root emergence
.
Nat. Cell Biol.
10
,
946
-
954
.
Thomann
,
A.
,
Lechner
,
E.
,
Hansen
,
M.
,
Dumbliauskas
,
E.
,
Parmentier
,
Y.
,
Kieber
,
J.
,
Scheres
,
B.
and
Genschik
,
P.
(
2009
).
Arabidopsis CULLIN3 genes regulate primary root Growth and patterning by ethylene-dependent and -independent mechanisms
.
PLoS Genet.
5
,
e1000328
.
Timpte
,
C.
,
Lincoln
,
C.
,
Pickett
,
F. B.
,
Turner
,
J.
and
Estelle
,
M.
(
1995
).
The AXR1 and AUX1 genes of Arabidopsis function in separate auxin-response pathways
.
Plant J.
8
,
561
-
569
.
Titapiwatanakun
,
B.
and
Murphy
,
A. S.
(
2009
).
Post-transcriptional regulation of auxin transport proteins: cellular trafficking, protein phosphorylation, protein maturation, ubiquitination, and membrane composition
.
J. Exp. Bot.
60
,
1093
-
1107
.
To
,
J. P. C.
,
Haberer
,
G.
,
Ferreira
,
F. J.
,
Deruère
,
J.
,
Mason
,
M. G.
,
Schaller
,
G. E.
,
Alonso
,
J. M.
,
Ecker
,
J. R.
and
Kieber
,
J. J.
(
2004
).
Type-A Arabidopsis response regulators are partially redundant negative regulators of cytokinin signaling
.
Plant Cell
16
,
658
-
671
.
Tsai
,
Y.-C.
,
Weir
,
N. R.
,
Hill
,
K.
,
Zhang
,
W.
,
Kim
,
H. J.
,
Shiu
,
S.-H.
,
Schaller
,
G. E.
and
Kieber
,
J. J.
(
2012
).
Characterization of genes involved in cytokinin signaling and metabolism from rice
.
Plant Physiol.
158
,
1666
-
1684
.
Ugartechea-Chirino
,
Y.
,
Swarup
,
R.
,
Swarup
,
K.
,
Péret
,
B.
,
Whitworth
,
M.
,
Bennett
,
M.
and
Bougourd
,
S.
(
2010
).
The AUX1 LAX family of auxin influx carriers is required for the establishment of embryonic root cell organization in Arabidopsis thaliana
.
Ann. Bot.
105
,
277
-
289
.
Ulmasov
,
T.
,
Murfett
,
J.
,
Hagen
,
G.
and
Guilfoyle
,
T. J.
(
1997
).
Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements
.
Plant Cell
9
,
1963
-
1971
.
Vanstraelen
,
M.
and
Benkova
,
E.
(
2012
).
Hormonal interactions in the regulation of plant development
.
Annu. Rev. Cell Dev. Biol.
28
,
463
-
487
.
Vogel
,
J. P.
,
Schuerman
,
P.
,
Woeste
,
K.
,
Brandstatter
,
I.
and
Kieber
,
J. J.
(
1998a
).
Isolation and characterization of Arabidopsis mutants defective in the induction of ethylene biosynthesis by cytokinin
.
Genetics
149
,
417
-
427
.
Vogel
,
J. P.
,
Woeste
,
K. E.
,
Theologis
,
A.
and
Kieber
,
J. J.
(
1998b
).
Recessive and dominant mutations in the ethylene biosynthetic gene ACS5 of Arabidopsis confer cytokinin insensitivity and ethylene overproduction, respectively
.
Proc. Natl. Acad. Sci. USA
95
,
4766
-
4771
.
Werner
,
T.
and
Schmülling
,
T.
(
2009
).
Cytokinin action in plant development
.
Curr. Opin. Plant Biol.
12
,
527
-
538
.
Werner
,
T.
,
Motyka
,
V.
,
Laucou
,
V.
,
Smets
,
R.
,
Van Onckelen
,
H.
and
Schmülling
,
T.
(
2003
).
Cytokinin-deficient transgenic Arabidopsis plants show multiple developmental alterations indicating opposite functions of cytokinins in the regulation of shoot and root meristem activity
.
Plant Cell
15
,
2532
-
2550
.
Xuan
,
W.
,
Audenaert
,
D.
,
Parizot
,
B.
,
Moller
,
B. K.
,
Njo
,
M. F.
,
De Rybel
,
B.
,
De Rop
,
G.
,
Van Isterdael
,
G.
,
Mahonen
,
A. P.
,
Vanneste
,
S.
, et al. 
(
2015
).
Root cap-derived auxin pre-patterns the longitudinal axis of the Arabidopsis root
.
Curr. Biol.
25
,
1381
-
1388
.
Zhang
,
W.
,
To
,
J. P. C.
,
Cheng
,
C.-Y.
,
Schaller
,
G. E.
and
Kieber
,
J. J.
(
2011
).
Type-A response regulators are required for proper root apical meristem function through post-transcriptional regulation of PIN auxin efflux carriers
.
Plant J.
68
,
1
-
10
.
Zhang
,
W.
,
Swarup
,
R.
,
Bennett
,
M.
,
Schaller
,
G. E.
and
Kieber
,
J. J.
(
2013
).
Cytokinin induces cell division in the quiescent center of the Arabidopsis root apical meristem
.
Curr. Biol.
23
,
1979
-
1989
.
Zhou
,
Z.-Y.
,
Zhang
,
C.-G.
,
Wu
,
L.
,
Zhang
,
C.-G.
,
Chai
,
J.
,
Wang
,
M.
,
Jha
,
A.
,
Jia
,
P.-F.
,
Cui
,
S.-J.
,
Yang
,
M.
, et al. 
(
2011
).
Functional characterization of the CKRC1/TAA1 gene and dissection of hormonal actions in the Arabidopsis root
.
Plant J.
66
,
516
-
527
.
Zourelidou
,
M.
,
Absmanner
,
B.
,
Weller
,
B.
,
Barbosa
,
I. C. R.
,
Willige
,
B. C.
,
Fastner
,
A.
,
Streit
,
V.
,
Port
,
S. A.
,
Colcombet
,
J.
,
de la Fuente van Bentem
,
S.
, et al. 
(
2014
).
Auxin efflux by PIN-FORMED proteins is activated by two different protein kinases, D6 PROTEIN KINASE and PINOID
.
Elife
3
,
e02860
.
Zürcher
,
E.
,
Tavor-Deslex
,
D.
,
Lituiev
,
D.
,
Enkerli
,
K.
,
Tarr
,
P. T.
and
Müller
,
B.
(
2013
).
A robust and sensitive synthetic sensor to monitor the transcriptional output of the cytokinin signaling network in planta
.
Plant Physiol.
161
,
1066
-
1075
.

Competing interests

The authors declare no competing or financial interests.

Supplementary information