There were errors published in Development 142, 858-870.
In the supplementary information, the sequences of four of the primers shown in Table S2 were incorrect. The correct sequences of these primers are as follows (5′-3′):
Hes1 mRNA reverse primer, gcgcggtatttccccaaca;
Onecut1 mRNA forward primer, agttccagcgcatgtcgg;
Onecut1 mRNA reverse primer, tttttgggggtgttgcctct;
Tcf7 mRNA reverse primer, agttcatagtacttggcctgctcttc.
The authors apologise to readers for these mistakes.
© 2016. Published by The Company of Biologists Ltd
2016