In animals, specification of the primordial germ cells (PGCs), the stem cells of the germ line, is required to transmit genetic information from one generation to the next. Bucky ball (Buc) is essential for germ plasm (GP) assembly in oocytes, and its overexpression results in excess PGCs in zebrafish embryos. However, the mechanistic basis for the excess PGCs in response to Buc overexpression, and whether endogenous Buc functions during embryogenesis, are unknown. Here, we show that endogenous Buc, like GP and overexpressed Buc-GFP, accumulates at embryonic cleavage furrows. Furthermore, we show that the maternally expressed zebrafish Kinesin-1 Kif5Ba is a binding partner of Buc and that maternal kif5Ba (Mkif5Ba) plays an essential role in germline specification in vivo. Specifically, Mkif5Ba is required to recruit GP to cleavage furrows and thereby specifies PGCs. Moreover, Mkif5Ba is required to enrich Buc at cleavage furrows and for the ability of Buc to promote excess PGCs, providing mechanistic insight into how Buc functions to assemble embryonic GP. In addition, we show that Mkif5Ba is also essential for dorsoventral (DV) patterning. Specifically, Mkif5Ba promotes formation of the parallel vegetal microtubule array required to asymmetrically position dorsal determinants (DDs) towards the prospective dorsal side. Interestingly, whereas Syntabulin and wnt8a translocation depend on kif5Ba, grip2a translocation does not, providing evidence for two distinct mechanisms by which DDs might be asymmetrically distributed. These studies identify essential roles for maternal Kif5Ba in PGC specification and DV patterning, and provide mechanistic insight into Buc functions during early embryogenesis.
INTRODUCTION
In sexually reproducing animals, primordial germ cells (PGCs), germline stem cells that form the gametes, are specified early in development via induction by zygotic factors or inheritance of maternally deposited RNAs and proteins, termed germ plasm (GP) (Hartung and Marlow, 2014; Lesch and Page, 2012; Seervai and Wessel, 2013). Although key regulators of germline development are conserved, maternal inheritance modes utilize diverse regulators (e.g. oskar in insects and buc in vertebrates) and mechanisms of GP assembly (Hartung and Marlow, 2014; Lesch and Page, 2012; Seervai and Wessel, 2013). GP is both necessary and sufficient for germline specification (Hashimoto et al., 2004; Hathaway and Selman, 1961; Illmensee and Mahowald, 1974; Togashi et al., 1986), yet it remains mysterious how this process is regulated.
Maternal GP is produced in oocytes and assembled into ribonucleoprotein (RNP) complexes that are stabilized in specific subcellular locations (Hartung and Marlow, 2014). In zebrafish, maternal GP components, including vasa, nanos3 and dazl, localize to the Balbiani body (Bb), an ancient asymmetric structure of primary oocytes (Howley and Ho, 2000; Kloc et al., 2004; Kosaka et al., 2007; Marlow, 2010). In zygotes, GP accumulates at distal cleavage furrows (Hashimoto et al., 2004; Knaut et al., 2000; Koprunner et al., 2001; Maegawa et al., 1999; Yoon et al., 1997), resulting in asymmetric inheritance of GP by four PGCs. After genome activation, GP is symmetrically inherited, resulting in four PGC clusters (Knaut et al., 2000). Although GP localization in zebrafish was first described nearly two decades ago, the molecular mechanisms governing GP inheritance remain elusive.
To date, zebrafish mutants disrupting GP assembly during early cleavages also perturb cleavages (Nair et al., 2013; Pelegri et al., 1999; Yabe et al., 2009). Both microtubule (MT) and F-actin networks are implicated in GP accumulation at cleavage furrows (Nair et al., 2013; Pelegri et al., 1999; Theusch et al., 2006; Yabe et al., 2009). MTs are enriched in distal cleavage furrows (Jesuthasan, 1998), and MT tips colocalize with GP-RNPs (Nair et al., 2013); however, it is unknown whether specific aggregation or stabilization factors exist and whether molecular motors are involved. Buc, a female germline-specific protein, is necessary and sufficient for Bb formation, in which GP localizes in primary oocytes (Bontems et al., 2009; Heim et al., 2014; Marlow and Mullins, 2008), and zebrafish and Xenopus Buc/Velo interact with RNAbps that bind GP-RNAs (Heim et al., 2014; Nijjar and Woodland, 2013). Furthermore, when buc-gfp RNA is injected into embryos, the translated Buc-GFP protein localizes to cleavage furrows, like GP, and increases PGC numbers (Bontems et al., 2009), indicating that exogenous Buc can promote PGC formation. Although maternal buc mutants do exist (Dosch et al., 2004; Marlow and Mullins, 2008), the polarity defects of buc oocytes preclude loss-of-function (LOF) analysis of potential Buc roles in GP recruitment in embryos.
In teleosts and amphibians, dorsoventral (DV) patterning, like germline specification, depends on maternally provided RNAs and proteins called dorsal determinants (DDs) (Langdon and Mullins, 2011; Marlow, 2010) that reside within the Bb and undergo Buc-dependent Bb-mediated translocation to the vegetal cortex (Ge et al., 2014; Lu et al., 2011; Nojima et al., 2010). Following fertilization, MT reorganization underlies dorsal determination (Houliston and Elinson, 1991; Jesuthasan and Strähle, 1997), as vegetal parallel microtubule arrays (pMTAs) govern asymmetric redistribution of the vegetally localized DDs relative to the animal-vegetal axis (Ge et al., 2014; Gerhart et al., 1989; Houliston and Elinson, 1991; Jesuthasan and Strähle, 1997; Tran et al., 2012). In zebrafish, pMTA formation roughly coincides with asymmetric translocation of Syntabulin protein and wnt8a and grip2a RNAs (Ge et al., 2014; Lu et al., 2011; Nojima et al., 2010; Tran et al., 2012). Although maternal grip2a contributes to alignment and bundling of the pMTA (Ge et al., 2014), and vegetal MT plus-ends are oriented dorsalward (Tran et al., 2012), it remains unclear how pMTA rearrangements are initiated and which other factors are involved. Nevertheless, evidence from Xenopus, using antibodies and rigor mutants, implicates Kinesin-mediated transport of vegetal RNAs in oocytes (Gagnon et al., 2013; Messitt et al., 2008) and Kinesin-dependent pMTA formation (Marrari et al., 2000). Importantly, however, the specific Kinesin superfamily protein (Kif) involved is not known.
Here, we show that zebrafish maternal kif5Ba is essential for PGC specification and DV patterning. Our mutant analysis shows that maternal kif5Ba is dispensable for oocyte polarity, but acts in embryos to recruit GP to cleavage furrows, for PGC specification and for fertility. Moreover, Kif5Ba recruits or enriches Buc in cleavage furrows, where it probably mediates GP recruitment or stabilization, thus providing mechanistic insight into how GP is assembled at cleavage furrows. We further provide evidence for two mechanisms to asymmetrically distribute DDs in activated eggs: a kif5Ba-independent mechanism that mediates grip2a translocation, and a kif5Ba-dependent mechanism that organizes the pMTA and redistributes Syntabulin and wnt8a. These results provide mechanistic insight into Buc activities in embryos, PGC specification and the maternal mechanisms that generate DV asymmetry in early embryos.
RESULTS
Endogenous Buc localizes to the germ plasm of embryos and binds Kinesin-1
Buc is necessary and sufficient for GP recruitment in oocytes (Bontems et al., 2009; Heim et al., 2014; Marlow and Mullins, 2008), and, when overexpressed, Buc-GFP localizes to cleavage furrows in embryos (Bontems et al., 2009). However, it is unknown how Buc-GFP localizes to cleavage furrows and whether endogenous Buc does so, too. We examined endogenous Buc in cleavage-stage embryos using α-Buc antibodies (Heim et al., 2014) and found that endogenous Buc was enriched at distal cleavage furrows of wild-type (WT) embryos. These accumulations were cell cycle dependent, and were most apparent when chromosomes were decondensed (Fig. 1A; n=24/32 embryos with accumulation at ≥1 furrow) and rarely visible during mitosis (Fig. 1B; n=0/25 metaphase embryos and n=1/18 anaphase embryos). To investigate further Buc recruitment to cleavage furrows, we performed a pull-down assay from ovary lysates using anti-Buc antibody and identified Kif5B as a binding partner by mass spectrometry (peptide threshold=95%; n=10 peptides; 7% coverage). To validate this interaction, we performed co-immunoprecipitation assays in HEK293T cells using GFP-Buc and HA-tagged Kif5Ba. Immunoprecipitation with anti-GFP showed that GFP-Buc, but not GFP, co-precipitated HA-Kif5Ba (Fig. 1C). To determine whether Kif5Ba and Buc colocalize in vivo we injected exogenous ha-kif5Ba and gfp-buc RNA into WT eggs. At the 16-cell stage, GFP-Buc was enriched in cleavage furrows as previously reported (Bontems et al., 2009), whereas HA-Kif5Ba was uniformly distributed (Fig. 1D-F). Together with our previous studies showing that kif5Ba is the main maternally expressed kif5 (Campbell and Marlow, 2013), these results indicate that Kif5Ba binds Buc and might mediate Buc localization in embryos.
Endogenous Buc localizes to the germ plasm of embryos and binds Kinesin-1. (A,B) Endogenous Buc localizes to distal cleavage furrows of 4-cell embryos when chromosomes are decondensed (A), but not during metaphase (B) or anaphase. Insets show DAPI. Arrowheads indicate Buc accumulation. Scale bars: 100 µm for main images, 10 µm for insets. See text for quantification. (C) GFP-Buc, but not GFP, co-immunoprecipitates HA-Kif5Ba in HEK293T cells. (D-F) Overexpressed GFP-Buc localizes to cleavage furrows and overexpressed HA-Kif5Ba is expressed throughout blastomeres, potentially allowing them to interact in vivo. Arrowheads indicate Buc accumulation. (G) Schematic protein structure of Kif5Ba, illustrating motor, stalk and tail domains. Red dashed line indicates CRISPR target site. (H) DNA and predicted protein sequences of WT and mutant kif5Ba alleles (ae11 and ae12). Yellow indicates protospacer, orange indicates PAM, gray area/red dashed line indicates a deletion and pink indicates altered amino acids. (I) qRT-PCR for kif5Ba from pools of 5-dpf WT and homozygous mutants. kif5Ba undergoes nonsense-mediated decay in kif5Baae11/ae11 but not kif5Baae12/ae12 mutants. Error bars show mean±s.e.m.; Student's t-test, *P=0.0388.
Endogenous Buc localizes to the germ plasm of embryos and binds Kinesin-1. (A,B) Endogenous Buc localizes to distal cleavage furrows of 4-cell embryos when chromosomes are decondensed (A), but not during metaphase (B) or anaphase. Insets show DAPI. Arrowheads indicate Buc accumulation. Scale bars: 100 µm for main images, 10 µm for insets. See text for quantification. (C) GFP-Buc, but not GFP, co-immunoprecipitates HA-Kif5Ba in HEK293T cells. (D-F) Overexpressed GFP-Buc localizes to cleavage furrows and overexpressed HA-Kif5Ba is expressed throughout blastomeres, potentially allowing them to interact in vivo. Arrowheads indicate Buc accumulation. (G) Schematic protein structure of Kif5Ba, illustrating motor, stalk and tail domains. Red dashed line indicates CRISPR target site. (H) DNA and predicted protein sequences of WT and mutant kif5Ba alleles (ae11 and ae12). Yellow indicates protospacer, orange indicates PAM, gray area/red dashed line indicates a deletion and pink indicates altered amino acids. (I) qRT-PCR for kif5Ba from pools of 5-dpf WT and homozygous mutants. kif5Ba undergoes nonsense-mediated decay in kif5Baae11/ae11 but not kif5Baae12/ae12 mutants. Error bars show mean±s.e.m.; Student's t-test, *P=0.0388.
kif5Ba recruits germ plasm RNAs to cleavage furrows and promotes germ cell specification
To test potential Kif5Ba involvement in localizing Buc, we generated zebrafish kif5Ba mutants using CRISPR-Cas9 mutagenesis (Chang et al., 2013; Hruscha et al., 2013) to disrupt the Kif5Ba motor domain (Fig. 1G). Two alleles were recovered and propagated. Sequencing of genomic DNA of F1 progeny and cDNA of homozygous mutants identified a 5 base pair (bp) deletion predicted to produce a premature stop codon (kif5Baae11) and a 6 bp deletion predicted to delete two amino acids (kif5Baae12) (Fig. 1H). qRT-PCR revealed nonsense-mediated decay of kif5Baae11 but not of kif5Baae12 transcripts in homozygous mutants (Fig. 1I). Despite mild craniofacial defects of kif5Baae12/ae12 but not of kif5Baae11/ae11 mutant larvae (data not shown), fertile adult homozygotes and transheterozygotes were recovered; thus, zygotic kif5Ba is dispensable through adulthood.
We next assessed germ cell specification in maternal kif5Ba mutants, hereafter called Mkif5Ba mutants, by examining GP-RNA localization in progeny of kif5Ba−/− females. During the first three cell cleavages, GP components accumulate at distal cleavage furrows and thereby become enriched in PGCs (Eno and Pelegri, 2013; Hashimoto et al., 2004; Knaut et al., 2000; Koprunner et al., 2001; Maegawa et al., 1999; Nair et al., 2013; Yabe et al., 2009; Yoon et al., 1997). The GP-RNAs nanos3 and vasa accumulated at the cleavage furrows of 4-cell-stage embryos (Fig. 2A,E) and later in PGCs of shield stage WT (Fig. 2C,G), but not at the furrows of Mkif5Ba embryos (Fig. 2B,F); and thus, no PGCs were detected in Mkif5Ba mutants (Fig. 2D,H). Conversely, vegetal localization of dazl RNA was intact in Mkif5Ba mutant embryos (Fig. 2I,J), suggesting that vegetal localization occurs independently of kif5Ba. Although GP-RNAs were absent from furrows, RT-PCR confirmed their presence in WT and Mkif5Ba embryos through 2 h post-fertilization (hpf) (Fig. 2K), suggesting that kif5Ba mediates furrow enrichment.
kif5Ba recruits germ plasm RNAs to cleavage furrows and promotes germ cell specification. (A,B,E,F) nanos3 (A,B) and vasa (E,F) localize to distal furrows in WT (A,E), but not in Mkif5Ba mutants (B,F), at 4-cell stage. Arrowheads indicate nanos3 and vasa accumulations. [nanos3: n=1/28 for Mkif5Baae11/ae12 (N=2 females), n=0/15 for Mkif5Baae11/ae11 (N=1 female), n=30/36 for WT (N=2 females) embryos have signal at ≥1 furrow; vasa: n=0/17 for Mkif5Baae11/ae12 (N=1 female), n=0/19 for Mkif5Baae11/ae11 (N=1 female), n=0/12 for Mkif5Baae12/ae12 (N=1 female), n=31/31 for WT (N=2 females) embryos have signal at ≥1 furrow.] (C,D,G,H) nanos3 (C,D) and vasa (G,H) are enriched in PGCs in WT (C,G), but not in Mkif5Ba mutants (D,H) at shield stage. Arrowheads indicate PGCs. [nanos3: n=0/32 for Mkif5Baae11/ae12 (N=2 females), n=0/19 for Mkif5Bae1/e1 (N=1 female), n=28/28 for WT (N=2 females) embryos have PGCs; vasa: n=0/18 for Mkif5Baae11/ae12 (N=1 female), n=0/22 for Mkif5Baae11/ae11 (N=1 female), n=0/17 for Mkif5Baae12/ae12 (N=1 female), n=37/37 for WT (N=2 females) embryos have PGCs.] (I,J) Vegetal localization of dazl is intact in WT (I) and Mkif5Ba mutants (J) at 4-cell stage. [n=19/19 for Mkif5Baae11/ae12 (N=2 females), n=20/20 for WT (N=2 females) embryos have vegetal signal.] (K) RT-PCR shows that germ plasm RNAs vasa, nanos3 and dazl are inherited by WT and Mkif5Ba mutant eggs (4-cell stage) and are maintained in WT and Mkif5Ba embryos (2 hpf). ef1α, loading control. NT, no template. (L-O) Vasa+ PGCs are present in WT (L,M) but not in Mkif5Ba mutant (N,O) embryos at 30 hpf. Scale bars: 10 µm. [n=0/48 for Mkif5Baae11/ae12 (N=2 females), n=19/67 for Mkif5Baae11/ae11 (N=3 females), n=0/20 for Mkif5Baae12/ae12 (N=3 females), n=53/53 for WT (N=4 females) have PGCs.] (P-Q″) H&E-stained transverse sections of adult WT (P) and MZkif5Ba mutants (Q) show that MZkif5Ba testes (green arrows) lack germ cells. P′,Q′ and P″,Q″ are higher magnification images of left and right testes, respectively. [n=4/4 Mkif5Baae12/ae12 adult males had empty testes; in addition, n=18/18 adult Mkif5Baae11/ae12 males dissected had testes devoid of germ cells.]
kif5Ba recruits germ plasm RNAs to cleavage furrows and promotes germ cell specification. (A,B,E,F) nanos3 (A,B) and vasa (E,F) localize to distal furrows in WT (A,E), but not in Mkif5Ba mutants (B,F), at 4-cell stage. Arrowheads indicate nanos3 and vasa accumulations. [nanos3: n=1/28 for Mkif5Baae11/ae12 (N=2 females), n=0/15 for Mkif5Baae11/ae11 (N=1 female), n=30/36 for WT (N=2 females) embryos have signal at ≥1 furrow; vasa: n=0/17 for Mkif5Baae11/ae12 (N=1 female), n=0/19 for Mkif5Baae11/ae11 (N=1 female), n=0/12 for Mkif5Baae12/ae12 (N=1 female), n=31/31 for WT (N=2 females) embryos have signal at ≥1 furrow.] (C,D,G,H) nanos3 (C,D) and vasa (G,H) are enriched in PGCs in WT (C,G), but not in Mkif5Ba mutants (D,H) at shield stage. Arrowheads indicate PGCs. [nanos3: n=0/32 for Mkif5Baae11/ae12 (N=2 females), n=0/19 for Mkif5Bae1/e1 (N=1 female), n=28/28 for WT (N=2 females) embryos have PGCs; vasa: n=0/18 for Mkif5Baae11/ae12 (N=1 female), n=0/22 for Mkif5Baae11/ae11 (N=1 female), n=0/17 for Mkif5Baae12/ae12 (N=1 female), n=37/37 for WT (N=2 females) embryos have PGCs.] (I,J) Vegetal localization of dazl is intact in WT (I) and Mkif5Ba mutants (J) at 4-cell stage. [n=19/19 for Mkif5Baae11/ae12 (N=2 females), n=20/20 for WT (N=2 females) embryos have vegetal signal.] (K) RT-PCR shows that germ plasm RNAs vasa, nanos3 and dazl are inherited by WT and Mkif5Ba mutant eggs (4-cell stage) and are maintained in WT and Mkif5Ba embryos (2 hpf). ef1α, loading control. NT, no template. (L-O) Vasa+ PGCs are present in WT (L,M) but not in Mkif5Ba mutant (N,O) embryos at 30 hpf. Scale bars: 10 µm. [n=0/48 for Mkif5Baae11/ae12 (N=2 females), n=19/67 for Mkif5Baae11/ae11 (N=3 females), n=0/20 for Mkif5Baae12/ae12 (N=3 females), n=53/53 for WT (N=4 females) have PGCs.] (P-Q″) H&E-stained transverse sections of adult WT (P) and MZkif5Ba mutants (Q) show that MZkif5Ba testes (green arrows) lack germ cells. P′,Q′ and P″,Q″ are higher magnification images of left and right testes, respectively. [n=4/4 Mkif5Baae12/ae12 adult males had empty testes; in addition, n=18/18 adult Mkif5Baae11/ae12 males dissected had testes devoid of germ cells.]
PGCs reach gonad anlagen at 30 hpf (Raz and Reichman-Fried, 2006). In WT embryos, Vasa+ PGCs localized adjacent to the yolk extension (Fig. 2L,M), but were absent in Mkif5Ba mutants (Fig. 2N,O), indicating failed PGC specification. Consequently, Mkif5Ba embryos developed exclusively as sterile males (Table 1) devoid of germ cells (Fig. 2P-Q″). These results indicate that maternal kif5Ba is essential for GP recruitment to cleavage furrows, for PGC specification and for fertility.
Germ plasm RNA localization is intact in kif5Ba mutant oocytes
In primary oocytes, GP components are enriched in the Bb (Hartung and Marlow, 2014; Kosaka et al., 2007) in a Buc-dependent manner (Bontems et al., 2009; Heim et al., 2014; Marlow and Mullins, 2008). After Bb translocation to the vegetal pole, it disperses in stage-II oocytes; thereafter, GP component localization diverges (Hartung and Marlow, 2014; Braat et al., 1999; Knaut et al., 2000; Kosaka et al., 2007; Draper et al., 2007; Howley and Ho, 2000; Maegawa et al., 1999). RT-PCR analysis indicated that GP-RNAs were present in embryos; however, impaired GP-RNA localization in oocytes could cause GP defects in embryos. Buc protein localization and H&E staining, labeling with the ER and mitochondria marker DiOC6, confirmed that oocyte polarity was intact in kif5Ba−/− primary oocytes (supplementary material Fig. S1A,B,E-H). Later-stage oocytes also appeared grossly normal (supplementary material Fig. S1C,D). Fluorescent in situ hybridization (FISH) (Gross-Thebing et al., 2014) revealed enrichment of vasa and nanos3 RNAs in the Bbs of WT and kif5Ba−/− mutants (supplementary material Fig. S1I-L,O-R). Moreover, vasa and nanos3 were comparable in WT and kif5Ba−/− oocytes after Bb dispersal (supplementary material Fig. S1M,N,S,T). Together, these results show that kif5Ba is dispensable for animal-vegetal polarity and GP-RNA localization in oocytes, suggesting that maternal kif5Ba probably acts to recruit GP in embryos.
Cleavage furrows appear normal in Mkif5Ba mutants
Several lines of evidence indicate that cleavage furrow integrity and cytoskeletal architecture are crucial for GP recruitment to furrows. First, maternal-effect mutants that disrupt cytokinesis disrupt GP aggregation (Nair et al., 2013; Pelegri et al., 1999; Yabe et al., 2009). Second, during cytokinesis the cleavage furrow is flanked by MTs oriented perpendicular to the furrow, known as the furrow microtubule array (FMA), (Jesuthasan, 1998). During furrow maturation, FMA enrichment resembles that of GP, and angles to form a distal furrow-oriented V-like structure. Finally, MT inhibitors disrupt the FMA and GP aggregation (Nair et al., 2013; Pelegri et al., 1999; Theusch et al., 2006). We investigated furrow-associated F-actin integrity in Mkif5Ba embryos and found no differences between WT and Mkif5Ba embryos in the medial contractile band, the F-actin accumulations flanking the FMA, nor in the circumferential actin bands around the blastomeres (supplementary material Fig. S2A-F) (Theusch et al., 2006; Urven et al., 2006). β-tubulin staining confirmed that FMA MTs properly formed adjacent to the F-actin contractile band, with an intervening MT-free zone (supplementary material Fig. S2C-F), and angled MTs distally (supplementary material Fig. S2G,H). These results indicated that failed GP recruitment in Mkif5Ba embryos was not due to furrow-associated cytoskeleton abnormalities.
Providing exogenous kif5Ba to Mkif5Ba mutants following fertilization rescues PGC specification
Because oocytes and cleavage furrows were intact, and GP components were available but not recruited in Mkif5Ba embryos, we hypothesized that injection of kif5Ba RNA into Mkif5Ba embryos might rescue GP recruitment and PGC specification. Unlike WT embryos, which recruited nanos3 RNA to the first three cleavage furrows (Fig. 3A; n=22/24 embryos), enriched nanos3 RNA in PGCs at sphere stage (Fig. 3D; 3.14±0.41 PGCs/embryo; n=28 embryos) and had clusters of Vasa+ PGCs at 30 hpf (Fig. 3G; 13.24±4.09 PGCs/side; n=21 embryos), Mkif5Ba mutants failed to recruit nanos3 to cleavage furrows (Fig. 3B; n=18/18 embryos) and thus lacked PGCs at sphere stage (Fig. 3E; 0.01±0.01 PGCs/embryo; one PGC in n=1/73, zero in n=72/73 embryos) and 30 hpf (Fig. 3H; zero PGCS in n=35/35 embryos). Injection of ha-kif5Ba RNA into Mkif5Ba embryos, however, promoted nanos3 RNA recruitment to one or two furrows (Fig. 3C; n=6/32 embryos), and a small number of PGCs were detected at sphere stage (Fig. 3F; 0.15±0.04 PGCs/embryo; one PGC in n=13/85, zero in n=72/85 embryos) and 30 hpf (Fig. 3I; n=6/45 embryos with PGCs; 2.00±1.10 PGCs/side in those embryos with PGCs). Importantly, injection of RNA encoding Cherry had no effect on PGC number in WT nor did it rescue PGC number in Mkif5Ba mutants (supplementary material Fig. S3). Together, these results suggest that Kif5Ba functions after fertilization to mediate GP recruitment to the cleavage furrows.
Overexpression of kif5Ba in Mkif5Ba mutants following fertilization is sufficient to specify germ cells. (A-C) nanos3 RNA is recruited to the first three cleavage furrows in WT (A) but is not recruited to furrows in Mkif5Ba mutants (B) at 16-cell stage. Injection of ha-kif5Ba restores nanos3 recruitment to 1-2 furrows in a fraction of Mkif5Ba mutants (C). Black arrowheads denote recruited nanos3. (D-F) nanos3 RNA becomes enriched in the prospective PGCs of WT (D) but is not enriched in Mkif5Ba mutants (E). Injection of ha-kif5Ba restores nanos3 enrichment to one PGC in a fraction of Mkif5Ba mutants (F). White arrowheads denote PGCs. (G-I) Vasa+ PGCs are present in WT (G) but not in Mkif5Ba mutants (H) at the yolk-yolk extension intersection. Injection of ha-kif5Ba restores small numbers of PGCs in Mkif5Ba mutants (arrowhead in I). See text for quantification. Scale bars: 50 µm.
Overexpression of kif5Ba in Mkif5Ba mutants following fertilization is sufficient to specify germ cells. (A-C) nanos3 RNA is recruited to the first three cleavage furrows in WT (A) but is not recruited to furrows in Mkif5Ba mutants (B) at 16-cell stage. Injection of ha-kif5Ba restores nanos3 recruitment to 1-2 furrows in a fraction of Mkif5Ba mutants (C). Black arrowheads denote recruited nanos3. (D-F) nanos3 RNA becomes enriched in the prospective PGCs of WT (D) but is not enriched in Mkif5Ba mutants (E). Injection of ha-kif5Ba restores nanos3 enrichment to one PGC in a fraction of Mkif5Ba mutants (F). White arrowheads denote PGCs. (G-I) Vasa+ PGCs are present in WT (G) but not in Mkif5Ba mutants (H) at the yolk-yolk extension intersection. Injection of ha-kif5Ba restores small numbers of PGCs in Mkif5Ba mutants (arrowhead in I). See text for quantification. Scale bars: 50 µm.
Kif5Ba localizes Buc to cleavage furrows and mediates germ plasm assembly in embryos
Because kif5Ba RNA injection restored GP recruitment in Mkif5Ba mutants, we postulated that Kif5Ba localizes a GP recruitment or aggregation factor. Based on its localization to cleavage furrows (Fig. 1), its ability to promote excess PGCs when overexpressed (Bontems et al., 2009), and its interaction and colocalization with Kif5Ba (Fig. 1), we hypothesized that Kif5Ba might mediate GP recruitment or stabilization by localizing Buc. Therefore, we injected GFP-Buc into 1-cell-stage WT or Mkif5Ba mutant embryos and examined its localization. GFP-Buc accumulated at distal cleavage furrows of WT embryos (n=32/32), as previously reported (Bontems et al., 2009), but was not recruited in most Mkif5Ba mutants (Fig. 4A,B; n=45/62). When present at the furrows of mutants, GFP-Buc did not aggregate distally but remained distributed along the furrow (n=17/62). Like GFP-Buc, endogenous Buc was enriched at distal furrows of WT (n=24/32 have Buc at ≥1 furrow), but this rarely occurred in Mkif5Ba mutants (n=4/32 have Buc at ≥1 furrow) (Fig. 4C,D). Together with our binding data, these results suggest that Kif5Ba enriches Buc and GP at cleavage furrows.
Kif5Ba localizes Buc to cleavage furrows to mediate germ plasm assembly in the embryo. (A,B) GFP-Buc is recruited to distal furrows of WT (arrowheads in A) but not of Mkif5Ba mutants (B). [n=0/29 for Mkif5Baae11/ae12 (N=2 females), n=0/18 for Mkif5Baae11/ae11 (N=3 females), n=0/15 for kif5Baae12/ae12 (N=1 female), n=32/32 for WT (N=4 females) have compact distal GFP-Buc; n=2/29 for Mkif5Baae11/ae12, n=15/18 for Mkif5Baae11/ae11, n=0/15 for Mkif5Baae12/ae12 have some furrow recruitment of GFP-Buc, although distal furrow compaction is defective.] (C,D) Endogenous Buc localizes to distal cleavage furrows of WT (arrowheads in C) but not Mkif5Ba mutants (D). [n=2/15 for Mkif5Baae12/ae12 (N=2 females), n=2/17 for Mkif5Baae11/ae11 (N=1 female), n=24/32 for WT (N=4 females) of cells with decondensed chromosomes have Buc at ≥1 distal cleavage furrow.] (E-H) Compared with uninjected WT (E), gfp-buc injected WT (F) embryos have additional nanos3+ PGCs (arrowheads), whereas uninjected (G) and gfp-buc-injected (H) Mkif5Ba mutants lacked nanos3+ cells. See text for quantification.
Kif5Ba localizes Buc to cleavage furrows to mediate germ plasm assembly in the embryo. (A,B) GFP-Buc is recruited to distal furrows of WT (arrowheads in A) but not of Mkif5Ba mutants (B). [n=0/29 for Mkif5Baae11/ae12 (N=2 females), n=0/18 for Mkif5Baae11/ae11 (N=3 females), n=0/15 for kif5Baae12/ae12 (N=1 female), n=32/32 for WT (N=4 females) have compact distal GFP-Buc; n=2/29 for Mkif5Baae11/ae12, n=15/18 for Mkif5Baae11/ae11, n=0/15 for Mkif5Baae12/ae12 have some furrow recruitment of GFP-Buc, although distal furrow compaction is defective.] (C,D) Endogenous Buc localizes to distal cleavage furrows of WT (arrowheads in C) but not Mkif5Ba mutants (D). [n=2/15 for Mkif5Baae12/ae12 (N=2 females), n=2/17 for Mkif5Baae11/ae11 (N=1 female), n=24/32 for WT (N=4 females) of cells with decondensed chromosomes have Buc at ≥1 distal cleavage furrow.] (E-H) Compared with uninjected WT (E), gfp-buc injected WT (F) embryos have additional nanos3+ PGCs (arrowheads), whereas uninjected (G) and gfp-buc-injected (H) Mkif5Ba mutants lacked nanos3+ cells. See text for quantification.
Next, we tested whether Kif5Ba was required to increase PGC numbers in embryos overexpressing Buc. As previously reported (Bontems et al., 2009), additional nanos3+ cells were detected in GFP-Buc-injected WT compared with uninjected siblings at 4 hpf (Fig. 4E,F; n=10 uninjected and injected embryos with averages of 4.0 and 5.7 cells, respectively; P=0.0314, Student's t-test:). By contrast, GFP-Buc produced no increase in nanos3+ cells in Mkif5Ba mutants (Fig. 4G,H; n=3/63 uninjected and 6/50 injected: averages of 0.05 and 0.14 PGCs, respectively; P=0.1221, Student's t-test). These results indicate that Kif5Ba is required to promote excess PGC formation in response to Buc overexpression and that the presence of Buc at the cleavage furrows is integral to GP assembly.
Maternal kif5Ba is required for proper dorsoventral patterning
In addition to lacking germ cells, Mkif5Ba mutants were ventralized to varying degrees at 1 day post-fertilization (dpf) (Fig. 5A-F), ranging from lack of notochord (V1, Fig. 5B) to complete axis radialization (V5, Fig. 5F). Additionally, a subset had secondary axes with duplicated rostral structures and a fused caudal body (Fig. 5G,G′), reminiscent of Mgrip2a mutants (Ge et al., 2014). Because ventralization was only observed in progeny of homozygous kif5Baae11/ae11 and kif5Baae12/ae12 and transheterozygous kif5Baae11/ae12 females, but not WT or heterozygous genotypes, we concluded that kif5Ba mutation caused ventralization (Fig. 5H). kif5Baae11/ae12 and kif5Baae12/ae12 were more severe than kif5Baae11/ae11 females, and had similar penetrance and expressivity. No phenotypes were observed in heterozygotes for either allele. Together, these results are consistent with both kif5Baae11 and kif5Baae12 having LOF character, with kif5Baae12 probably being a stronger LOF allele than kif5Baae11. Although unlikely, we cannot exclude the possibility that kif5Baae12 acts as a weak dominant negative allele by dimerizing with other Kifs to form non-functional motors or competing for cargo.
Maternal kif5Ba is required for dorsal fate. (A-G) Mkif5Ba mutant embryos are variably ventralized at 1 dpf: V1, nearly complete AP axis lacking notochord and blocky somites (B); V2, reduced head structures (C); V3, largely lacking head structures except the posteriormost ones (D); V4, lack all head structures but possess an AP axis (E); V5, completely radialized axis (F). A small fraction of mutant embryos had duplicated anterior axes with fused caudal bodies (G,G′). (H) Distribution of phenotypic classes for homozygous and transheterozygous Mkif5Ba mutant embryos. The number of females assayed is indicated at the base of each bar. At least two clutches of embryos from each female were analyzed. Total number of embryos assayed for each genotype: n=1247 for Mkif5Baae11/ae12, n=2748 for Mkif5Baae11/ae11, n=2158 for Mkif5Baae12/ae12 and n=988 for siblings.
Maternal kif5Ba is required for dorsal fate. (A-G) Mkif5Ba mutant embryos are variably ventralized at 1 dpf: V1, nearly complete AP axis lacking notochord and blocky somites (B); V2, reduced head structures (C); V3, largely lacking head structures except the posteriormost ones (D); V4, lack all head structures but possess an AP axis (E); V5, completely radialized axis (F). A small fraction of mutant embryos had duplicated anterior axes with fused caudal bodies (G,G′). (H) Distribution of phenotypic classes for homozygous and transheterozygous Mkif5Ba mutant embryos. The number of females assayed is indicated at the base of each bar. At least two clutches of embryos from each female were analyzed. Total number of embryos assayed for each genotype: n=1247 for Mkif5Baae11/ae12, n=2748 for Mkif5Baae11/ae11, n=2158 for Mkif5Baae12/ae12 and n=988 for siblings.
kif5Ba localizes dorsal determinants in the activated egg
Dorsal specification in zebrafish is apparent around the mid-blastula transition and can be detected by nuclear β-catenin accumulation in dorsal blastomeres (Schneider et al., 1996), although syntabulin (sybu) and grip2a maternal mutants show that DV patterning begins earlier (Ge et al., 2014; Nojima et al., 2010). These maternal factors are thought to mediate dorsalward translocation of vegetally localized factors, including wnt8a RNA, during the first hour following fertilization. Asymmetry in wnt8a RNA is postulated to translate into asymmetric Wnt8a protein distribution and eventually β-catenin activation in dorsal blastomeres (Lu et al., 2011).
To determine whether maternal Kif5Ba localizes maternal regulators of DV patterning, we performed in situ hybridization for sybu, grip2a and wnt8a RNA in eggs. As previously reported (Ge et al., 2014; Lu et al., 2011; Nojima et al., 2010), sybu, grip2a and wnt8a RNA were vegetally localized at 2 min post-egg activation (mpa) (Fig. 6A,F,J), and by 45 mpa grip2a and wnt8a RNA, but not sybu RNA, asymmetrically translocated in WT (Fig. 6C,H,L). In Mkif5Ba mutants, sybu RNA was initially vegetally localized (Fig. 6B), but was more dispersed [sybu domain angle in Mkif5Ba (n=57 eggs; 3 females) was 1.14-fold that of WT (n=57 eggs; 4 females); Student's t-test: P=6.78×10−8]. At 45 mpa, two sybu RNA expression classes, strong and weak, were observed in both WT and Mkif5Ba mutants, although more Mkif5Ba mutants showed weak expression (Fig. 6C-D′). qRT-PCR for sybu RNA confirmed that it was significantly elevated in Mkif5Ba mutants at 2 mpa, and, although not significantly different, trended towards lower levels at 45 mpa (Fig. 6E). As no transcription occurs during this period, these results indicate that sybu RNA is not properly maintained in Mkif5Ba mutants. Unlike sybu RNA, in Mkif5Ba activated eggs grip2a and wnt8a RNA localization resembled WT initially (Fig. 6G,K; grip2a RNA mutant angle was 0.98±0.03 times that of WT and wnt8a RNA mutant angle was 1.07±0.05 times that of WT; Student's t-test, P=0.77 and P=0.43, respectively); however, by 45 mpa, grip2a translocated asymmetrically in Mkif5Ba activated eggs (Fig. 6I,N), but wnt8a did not (Fig. 6M,N). These data suggest that kif5Ba maintains sybu RNA at the vegetal pole and is necessary for wnt8a, but not grip2a, RNA translocation.
Maternal kif5Ba localizes dorsal determination components in activated eggs. (A-D′) sybu is vegetally localized at 2 mpa (A,B) and at 45 mpa (C,D) in both WT (A,C) and Mkif5Ba mutant (B,D) activated eggs. However, sybu is more dispersed at 2 mpa (B) and appears less abundant in most Mkif5Ba eggs at 45 mpa (D,D′). [2 mpa: n=30/30 for Mkif5Baae11/ae12 (N=2 females), n=29/29 for Mkif5Baae12/ae12 (N=1 female), n=63/63 for WT (N=3 females) have vegetally localized sybu; 45 mpa: quantification in panels.] (E) qRT-PCR reveals significantly more abundant sybu RNA in Mkif5Ba mutants at 2 mpa, although this RNA excess is not maintained at 45 mpa. Error bars show mean±s.d.; Student's t-test, *P=0.0219. (F-I) grip2a is vegetally localized at 2 mpa (F,G) and shifts asymmetrically by 45 mpa (H,I) in both WT (F,H) and Mkif5Ba mutant (G,I) activated eggs. [2 mpa: n=37/37 for Mkif5Baae11/ae12 (N=2 females), n=23/23 for WT (N=2 females) have vegetally localized grip2a; 45 mpa: see N for quantification.] (J-M) wnt8a is vegetally localized at 2 mpa in both WT (J) and Mkif5Ba mutant (K) activated eggs. However, wnt8a is asymmetric at 45 mpa in WT (L) but not Mkif5Ba mutant (M) activated eggs. [2 mpa: n=24/24 for Mkif5Baae11/ae12 (N=2 females), n=29/29 for WT (N=2 females) have vegetally localized wnt8a; 45 mpa: see N for quantification.] (N) Fraction of eggs exhibiting dorsally translocated RNA at 45 mpa. Number at base of columns indicates the number of eggs assayed. Chi-square, P=0.0312 (grip2a: n=2 females for each genotype; wnt8a: n=4 Mkif5Ba and n=3 WT females). (O-R″) Sybu is vegetally localized at 2 mpa (O) and is asymmetric at 45 mpa (P) in WT activated eggs. This is normal in some Mkif5Ba mutant eggs (Q,R), but others show aberrant localization at 2 mpa (Q′,Q″) and at 45 mpa (R′,R″). See text for quantification. (S) Injection of ha-kif5Ba RNA into 1-cell-stage Mkif5Ba mutants fails to suppress DV patterning defects. [n=138 uninjected and n=81 injected Mkif5Baae11/ae12 (N=1 female), n=172 uninjected and n=80 injected Mkif5Baae11/ae12 (N=2 females)]. Arrowheads designate the lateral limits of each expression domain.
Maternal kif5Ba localizes dorsal determination components in activated eggs. (A-D′) sybu is vegetally localized at 2 mpa (A,B) and at 45 mpa (C,D) in both WT (A,C) and Mkif5Ba mutant (B,D) activated eggs. However, sybu is more dispersed at 2 mpa (B) and appears less abundant in most Mkif5Ba eggs at 45 mpa (D,D′). [2 mpa: n=30/30 for Mkif5Baae11/ae12 (N=2 females), n=29/29 for Mkif5Baae12/ae12 (N=1 female), n=63/63 for WT (N=3 females) have vegetally localized sybu; 45 mpa: quantification in panels.] (E) qRT-PCR reveals significantly more abundant sybu RNA in Mkif5Ba mutants at 2 mpa, although this RNA excess is not maintained at 45 mpa. Error bars show mean±s.d.; Student's t-test, *P=0.0219. (F-I) grip2a is vegetally localized at 2 mpa (F,G) and shifts asymmetrically by 45 mpa (H,I) in both WT (F,H) and Mkif5Ba mutant (G,I) activated eggs. [2 mpa: n=37/37 for Mkif5Baae11/ae12 (N=2 females), n=23/23 for WT (N=2 females) have vegetally localized grip2a; 45 mpa: see N for quantification.] (J-M) wnt8a is vegetally localized at 2 mpa in both WT (J) and Mkif5Ba mutant (K) activated eggs. However, wnt8a is asymmetric at 45 mpa in WT (L) but not Mkif5Ba mutant (M) activated eggs. [2 mpa: n=24/24 for Mkif5Baae11/ae12 (N=2 females), n=29/29 for WT (N=2 females) have vegetally localized wnt8a; 45 mpa: see N for quantification.] (N) Fraction of eggs exhibiting dorsally translocated RNA at 45 mpa. Number at base of columns indicates the number of eggs assayed. Chi-square, P=0.0312 (grip2a: n=2 females for each genotype; wnt8a: n=4 Mkif5Ba and n=3 WT females). (O-R″) Sybu is vegetally localized at 2 mpa (O) and is asymmetric at 45 mpa (P) in WT activated eggs. This is normal in some Mkif5Ba mutant eggs (Q,R), but others show aberrant localization at 2 mpa (Q′,Q″) and at 45 mpa (R′,R″). See text for quantification. (S) Injection of ha-kif5Ba RNA into 1-cell-stage Mkif5Ba mutants fails to suppress DV patterning defects. [n=138 uninjected and n=81 injected Mkif5Baae11/ae12 (N=1 female), n=172 uninjected and n=80 injected Mkif5Baae11/ae12 (N=2 females)]. Arrowheads designate the lateral limits of each expression domain.
Previous studies have shown that, like grip2a and wnt8a RNA, Syntabulin (Sybu) protein translocates after egg activation (Fig. 6O,P) (Nojima et al., 2010). In Mkif5Ba activated eggs, Sybu protein, like sybu RNA, was mislocalized in some Mkif5Ba eggs at 2 mpa, either aberrantly present on the lateral cortex or diffuse about the cortex (Fig. 6Q-Q″; Sybu was vegetally localized in n=3/12 Mkif5Baae11/ae12, n=4/9 Mkif5Baae11/ae11 and n=2/9 Mkif5Baae12/ae12 compared with n=13/15 WT eggs). At 45 mpa, in a subset of eggs, Sybu either failed to translocate or was not detectable (Fig. 6R-R″; Sybu translocated normally in n=1/11 Mkif5Baae11/ae12, n=12/18 Mkif5Baae11/ae11 and n=3/11 for Mkif5Baae12/ae12 compared with n=16/19 WT eggs). Thus, kif5Ba might function to maintain vegetal localization of Sybu and for its subsequent asymmetric movement. Because Sybu can link Kif5s and their cargo in other biological contexts (Cai et al., 2005; Su et al., 2004), and zebrafish Sybu and Kif5Ba interact in vitro (Nojima et al., 2010), Sybu probably localizes in oocytes or early embryos via its interaction with Kif5Ba.
To determine when Kif5Ba acts in DV patterning, we attempted to rescue the Mkif5Ba ventralization phenotype by injecting ha-kif5Ba RNA into Mkif5Ba embryos; however, this did not suppress the penetrance or expressivity of Mkif5Ba ventralized phenotypes (Fig. 6S). Notably, other maternal-effect mutants that disrupt early translocation events also cannot be rescued by RNA injection after fertilization (Ge et al., 2014; Nojima et al., 2010). Together, these results are consistent with roles for Kif5Ba in positioning Sybu in oocytes or during egg activation.
Vegetal microtubules fail to organize in kif5Ba mutants
Prior to asymmetric translocation of Sybu protein and wnt8a RNA (∼20 mpa), the vegetal MT network reorganizes to form the vegetal pMTA (Jesuthasan and Strähle, 1997), which predicts the DV axis (Tran et al., 2012). Disrupting this network, as occurs in Mgrip2a mutants (Ge et al., 2014), or by treating activated eggs with MT inhibitors, cold temperature or UV irradiation (Lu et al., 2011; Nojima et al., 2010), blocks Sybu protein and wnt8a RNA translocation. To determine whether Mkif5Ba DV patterning defects were due to pMTA defects we analyzed the MT network of activated eggs. Surprisingly, although pMTA formation was robust in WT (Fig. 7A,M), it failed in most Mkif5Ba activated eggs (Fig. 7D,M). Instead, Mkif5Ba vegetal MTs either appeared bundled and randomly oriented (Fig. 7G,M) or non-bundled with a crosshatch appearance (Fig. 7J,M). No differences were observed between the lateral cortex MT networks of WT and Mkif5Ba eggs (Fig. 7N,Q).
Maternal kif5Ba organizes vegetal microtubules. (A-M) Vegetal microtubules are in a parallel orientation and bundled in WT activated eggs (A), but in Mkif5Ba mutants are either bundled and parallel (D), bundled but not parallel (G), or not bundled or parallel (J). Mkif5Ba mutant activated eggs display variable CG exocytosis defects (compare B with E,H,K). Importantly, the degree of CG retention does not correlate with the severity of the microtubule phenotype in Mkif5Ba mutants (M). Scale bars: 10 µm. Blue dotted line in M represents the upper limit of CG retention observed in WT activated eggs. Error bars show mean±s.d.; one-way ANOVA. (N-S) There is no difference between lateral microtubule organization in WT (N-P) and Mkif5Ba mutant (Q-S) activated eggs. Scale bars: 10 µm.
Maternal kif5Ba organizes vegetal microtubules. (A-M) Vegetal microtubules are in a parallel orientation and bundled in WT activated eggs (A), but in Mkif5Ba mutants are either bundled and parallel (D), bundled but not parallel (G), or not bundled or parallel (J). Mkif5Ba mutant activated eggs display variable CG exocytosis defects (compare B with E,H,K). Importantly, the degree of CG retention does not correlate with the severity of the microtubule phenotype in Mkif5Ba mutants (M). Scale bars: 10 µm. Blue dotted line in M represents the upper limit of CG retention observed in WT activated eggs. Error bars show mean±s.d.; one-way ANOVA. (N-S) There is no difference between lateral microtubule organization in WT (N-P) and Mkif5Ba mutant (Q-S) activated eggs. Scale bars: 10 µm.
Cortical granules (CGs) are normally rapidly exocytosed following egg activation (Becker and Hart, 1999). Persisting CGs in zebrafish maternal-effect mutants disrupting heterogeneous nuclear ribonucleoprotein I (hnRNPI) are thought to interfere with vegetal pMTA formation and disrupt DV patterning (Mei et al., 2009). To determine whether persisting CGs could explain the disrupted pMTA in Mkif5Ba mutants, CGs were labeled with Maclura pomifera agglutinin (MPA) lectin (Becker and Hart, 1996, 1999). Mkif5Ba activated eggs at 25 mpa displayed variable CG exocytosis impairment (Fig. 7E,H,K); however, quantification of the number of retained CGs within a defined vegetal region revealed no difference in the density of CGs retained between Mkif5Ba mutants, regardless of pMTA defect severity (Fig. 7M). Specifically, Mkif5Ba mutants with severe CG exocytosis deficits but normal vegetal pMTAs and Mkif5Ba mutants with mild CG exocytosis defects but disorganized MTs were observed (Fig. 7M). Furthermore, consistent with their more severe ventralization phenotypes, pMTA defects were more severe in Mkif5Baae12/ae12 mutants than Mkif5Baae11/ae11 mutants; however, the number of retained CGs was not significantly different between these genotypes (supplementary material Fig. S4A,B). Together, these data indicate that maternal kif5Ba mediates pMTA formation and CG exocytosis, but persisting CGs do not account for the cytoskeletal defects.
DISCUSSION
Our study identifies the key maternal motor required for specification of the germline and the DV axis in zebrafish (Fig. 8). Moreover, our findings that Kif5Ba binds to Buc, mediates Buc recruitment to the cleavage furrow, where GP assembles in the embryo, and is required for excess PGC formation in response to Buc overexpression, provide new insight into the mechanism by which Buc promotes germ plasm assembly in embryos. Furthermore, our studies show that Kif5Ba-mediated MT reorganization underlies cortical rotation-like events to promote asymmetric localization of Syntabulin and wnt8a, and that asymmetry of grip2a occurs independently of kif5Ba. Thus, our results provide evidence for distinct MT-dependent translocation events that mediate maternal DV patterning.
Model for Kif5Ba functions in dorsoventral patterning and germ cell formation. In WT activated eggs Kif5Ba mediates vegetal pMTA formation and dorsal determinant (DD) translocation towards the prospective dorsal side. Kif5Ba localizes endogenous Buc to distal cleavage furrows and promotes recruitment of GP-RNAs to furrows and subsequent PGC specification. In Mkif5Ba mutants the vegetal pMTA fails to form, resulting in ventralization. Furthermore, Buc localization to furrows is lost, resulting in failed GP recruitment to specify PGCs and adult sterility. Our data support a model whereby Kif5Ba is required to recruit Buc and GP-RNAs to cleavage furrows, although it is unclear whether it also acts to compact GP-RNAs within distal regions of the cleavage furrow.
Model for Kif5Ba functions in dorsoventral patterning and germ cell formation. In WT activated eggs Kif5Ba mediates vegetal pMTA formation and dorsal determinant (DD) translocation towards the prospective dorsal side. Kif5Ba localizes endogenous Buc to distal cleavage furrows and promotes recruitment of GP-RNAs to furrows and subsequent PGC specification. In Mkif5Ba mutants the vegetal pMTA fails to form, resulting in ventralization. Furthermore, Buc localization to furrows is lost, resulting in failed GP recruitment to specify PGCs and adult sterility. Our data support a model whereby Kif5Ba is required to recruit Buc and GP-RNAs to cleavage furrows, although it is unclear whether it also acts to compact GP-RNAs within distal regions of the cleavage furrow.
A Kif5Ba-Buc interaction required for germ plasm assembly and germline specification
Although germline development in all animals relies on conserved genetic factors, two main modes of germline specification exist (Ewen-Campen et al., 2010; Lesch and Page, 2012; Seervai and Wessel, 2013). Germline stem cells are either induced by zygotic factors or rely on the inheritance of maternal GP to specify PGCs (Dosch, 2014; Hartung and Marlow, 2014; Marlow, 2010). In zebrafish, GP-RNAs and proteins localize to the Bb of primary oocytes in a Buc-dependent manner (Bontems et al., 2009; Heim et al., 2014; Kosaka et al., 2007; Marlow and Mullins, 2008) and are later inherited and stabilized in the distal cleavage furrows during the first embryonic cleavage cycles (Hashimoto et al., 2004; Knaut et al., 2000; Koprunner et al., 2001; Maegawa et al., 1999; Theusch et al., 2006; Yoon et al., 1997). Manual ablation of GP prevents PGC specification (Hashimoto et al., 2004), indicating that it is essential for fertility; however, the mechanisms governing embryonic GP segregation are poorly understood.
Along with the absence of overt defects in oocyte polarity and GP localization in kif5Ba mutant ovaries, our ha-kif5Ba RNA injection rescue experiments provide compelling evidence that Kif5Ba functions during cleavage stages to localize GP components. However, RNA injection only partially suppresses deficits. Because GP recruitment to the furrows only occurs between the 2-cell stage and 16-cell stage, the rescue activity of ha-kif5Ba RNA is probably limited by the time required to produce sufficient functional Kif5Ba protein during this 1.5-h window. Nonetheless, it is clear that exogenous kif5Ba RNA provided following fertilization can promote GP recruitment to cleavage furrows of 16-cell embryos, suggesting that endogenous Kif5Ba performs this function during the first three cleavages. Significantly, this is the first maternal factor identified in zebrafish that is required for GP recruitment which does not interfere with the furrow-associated cytoskeleton or cleavage furrow formation.
We have shown that endogenous Buc, a necessary factor for GP assembly in oocytes, localizes, like GP, to distal cleavage furrows of embryos. Furthermore, loss of Buc localization to furrows, as occurs in Mkif5Ba mutants, coincides with failed GP recruitment and ultimately failure to specify PGCs. Additionally, although Buc overexpression can promote PGC formation in WT (Bontems et al., 2009), we show that this activity requires MKif5Ba; therefore, Buc probably acts at the furrow to recruit or stabilize GP. Because Buc interacts with RNAbps (Heim et al., 2014), it might recruit GP-RNPs indirectly, although we cannot exclude the possibility that Buc possesses uncharacterized RNA binding elements.
Our observation that Buc localization to distal furrows is dynamic, occurring preferentially when chromosomes are decondensed, is consistent with a model whereby Buc seeds GP recruitment and assembly until sufficient GP proteins and RNAs accumulate and Buc is no longer required. Additionally, the distal cleavage furrows are enriched with MTs that form V-shaped structures oriented toward the site of GP assembly during furrow maturation (Jesuthasan, 1998; Urven et al., 2006). Because we observed interactions between Kif5Ba and Buc, it is tempting to speculate that Kif5Ba might mediate transport of Buc to the furrows along these MTs. It is possible that cytoskeletal reorganization accompanying furrow maturation could subsequently account for the dynamic localization of Buc.
Maternal Kif5Ba mediates vegetal microtubule reorganization and the cortical rotation-like event
In zebrafish and Xenopus, DV axis specification requires cytoskeletal reorganization to form a pMTA that facilitates asymmetric localization of maternal DDs (Houliston and Elinson, 1991; Jesuthasan and Strähle, 1997). In zebrafish, previous work shows that maternal grip2a, sybu and wnt8a regulate DV patterning (Ge et al., 2014; Lu et al., 2011; Nojima et al., 2010). Grip2a is implicated in pMTA formation, and Syntabulin is hypothesized to tether vegetally localized DDs, such as wnt8a (Ge et al., 2014; Lu et al., 2011; Nojima et al., 2010). However, little is known about how these events are regulated.
Our observation that vegetal pMTA formation fails in Mkif5Ba mutants probably accounts for deficits in wnt8a localization and, ultimately, ventralization of mutant progeny. Interestingly, asymmetric localization of grip2a is intact in Mkif5Ba mutants. Previous studies indicate that grip2a translocation is disrupted by nocodazole, which disrupts formation of the vegetal pMTA (Ge et al., 2014). Thus, it appears that distinct MT-dependent mechanisms asymmetrically localize cargoes in activated eggs: a Kif5Ba-independent mechanism used by grip2a, and a Kif5Ba- and pMTA-dependent mechanism used by wnt8a and Sybu. These results raise the interesting possibility that movement of grip2a RNA might anticipate vegetal pMTA formation. Interestingly, Grip1, a grip2a family member, directly interacts with Kif5s (Setou et al., 2002). Therefore, following grip2a RNA translocation, an asymmetric Kif5Ba-Grip2a complex might mediate pMTA formation. Alternatively, Kif5Ba could mediate pMTA formation and bundling by crosslinking MTs using its head and tail MT-binding elements. Such a configuration could also support the zebrafish cortical rotation-like event by MT-MT sliding, as has been described for Kinesin-1 in other contexts (del Castillo et al., 2015; Jolly et al., 2010).
Our finding that kif5Ba is required to maintain Sybu at the vegetal cortex and for its subsequent asymmetric translocation supports previous work showing that Sybu interacts with Kif5Ba (Nojima et al., 2010). We also observed that sybu RNA was present at higher levels and appeared more dispersed in Mkif5Ba mutants following egg activation, and that these increased levels were not maintained. Although it is unclear why sybu RNA would initially be more abundant, a role for MKif5Ba in tethering sybu RNA at the vegetal cortex to protect it from degradation might explain its dispersal and lack of maintenance. Notably, because Sybu was mislocalized at 2 mpa but vegetal localization of grip2a and wnt8a were intact, this suggests that Sybu probably does not tether these RNAs. It remains possible that Sybu tethers Grip2a or Wnt8a proteins or other uncharacterized DDs. Alternatively, Sybu might contribute to DV patterning by another mechanism.
MATERIALS AND METHODS
Animals
AB strain wild-type zebrafish embryos were obtained from natural pairwise matings and were reared according to standard procedures (Westerfield, 2000). Embryos were raised in 1× Embryo Medium at 28.5°C and staged as described (Kimmel et al., 1995). All procedures and experimental protocols were in accordance with NIH guidelines and approved by the Einstein IACUC (protocol #20140502).
Mutagenesis
kif5Ba zebrafish mutants were created using CRISPR-Cas9-mediated mutagenesis (http://www.addgene.org/crispr/jounglab/CRISPRzebrafish/) (Hwang et al., 2013a,,b). A guide RNA (gRNA) targeting the motor domain of kif5Ba was designed using ZiFiT Targeter software (http://zifit.partners.org/ZiFiT/). The primers gRNA-F: TAGGACAGGATAGCGTCGTGAT and gRNA-R: AAACATCACGACGCTATCCTGT were annealed and ligated into BsaI-HF-linearized pDR272 to create pDR272-kif5Ba-gRNA. Oligo insertions were sequence-verified, and gRNAs were synthesized using MAXIscript T7 Kit (Life Technologies, AM1312M) on DraI-linearized pDR272-kif5Ba-gRNA. Cas9 RNA was synthesized using mMESSAGE mMACHINE SP6 Transcription Kit (Life Technologies, AM1340) on MssI-linearized MLM3613 and poly-Adenylated with the Poly(A) Tailing Kit (Life Technologies, AM1350). gRNA and Cas9 RNA were co-injected (2 nl at 12.5 ng/μl and 300 ng/μl, respectively). T7 endonuclease I assays (Hwang et al., 2013b) and sequencing were used to determine mutagenesis efficiency. Injected embryos were raised to adulthood, their progeny were screened, and two founders bearing distinct mutations were identified and propagated.
Genotyping
Genomic DNA was extracted from adult fins or embryos using standard procedures (Westerfield, 2000). The region surrounding the kif5Baae11 and kif5Baae12 mutations was amplified with primers 5′-GGAGTGCACCATTAAAGTCATGTG and 5′-GTCGGTGTCAAATATTGAGGTC. Restriction enzyme (RE) digestion with PvuI for kif5Baae11 produced two smaller fragments for the mutant allele. RE digestion with MboI for kif5Baae12 produced two smaller fragments for the wild-type allele but not the mutant allele.
In situ hybridization
For chromogenic in situ hybridization, embryos or activated eggs at the specified stages were fixed in 4% paraformaldehyde overnight at 4°C. In situ hybridization was performed according to Thisse and Thisse (2014), except that maleic acid buffer (100 mM maleic acid, pH 8, 150 mM NaCl) was substituted for PBS during antibody incubations and BM Purple was used to develop (Roche, 1442074). FISHs were performed using the Multiplex Fluorescent Reagent Kit (ACD Bio, 320850) according to the whole-mount RNAscope protocol (Gross-Thebing et al., 2014). Dissected ovaries were fixed for 30 min in 4% paraformaldehyde at room temperature (RT), washed with PBT (0.1% Tween), dehydrated in MeOH and placed at −20°C overnight. RNAscope Blank C1 probe, Dr-nanos3-C2 probe (ACD Bio, 404521-C2) and Dr-vasa-C3 probe (ACD Bio, 407271-C3) were used.
Immunofluorescence and F-actin, cortical granule and DiOC6 labeling
For whole-mount IF of microtubules, F-actin and Buc, eggs and embryos were fixed with microtubule staining buffer (80 mM K-PIPES pH 6.8, 5 mM EGTA, 1 mM MgCl2, 3.7% formaldehyde, 0.25% glutaraldehyde, 0.2% Triton X-100) for 4-5 h at RT. Staining was performed immediately. All other stainings: embryos or ovaries were fixed in 4% paraformaldehyde overnight at 4°C, dehydrated in MeOH and placed at −20°C. Anti-β-tubulin (Millipore, MAB3408) was diluted at 1:1000, Anti-Bucky ball y1165 at 1:500 (Heim et al., 2014), Anti-Syntabulin Syn1 at 1:1000 (Nojima et al., 2010), Anti-Vasa at 1:5000 (Knaut et al., 2000) and Anti-HA at 1:500 (Roche, 11867423001). Alexa Fluor 488 and Alexa Fluor 568 (Molecular Probes) secondary antibodies were diluted at 1:500. CGs were stained by incubation in 50 μg/ml FITC-conjugated Maclura pomifera lectin (EY Labs, F-3901-2) for 90 min at RT in PBS-Triton X-100. CGs were counted in a defined vegetal region at depth×height×width of 4 µm×59.45 µm×59.45 µm. F-actin was stained by incubating with Rhodamine-Phalloidin (Life Technologies, R415) at 1:50 overnight at 4°C. DiOC6 staining was performed as previously described (Marlow and Mullins, 2008).
RT-PCR
Total RNA was extracted from pooled embryos (n=20-30/stage) using Trizol (Life Technologies, 15596). cDNA was prepared with SuperScript III Reverse Transcription Kit (Life Technologies, 18080-051). RT-PCR was performed using the following primers: ef1α (Fig. 1) and vasa: (Heim et al., 2014); dazl and nanos3 (Hartung et al., 2014); kif5Ba: 5′-GACTTTGCACAACCTCAGGAAA and 5′-GCAGACGCTTCTCCAGTTTAGG; ef1α (Fig. 6): 5′-CTGGTTCAAGGGATGGAAGA and 5′-CTGGTTCAAGGGATGGAAGA; sybu: 5′-GGAAGCTACAAGACCCGAGAAA and 5′-TGATGCCATGATTGTCTCCACA. qRT-PCR reactions were performed in triplicate with SYBR Green Master Mix (Thermo Scientific) and an Eppendorf realplex2 Mastercycler. Expression relative to WT was quantified with the ΔΔCt method using ef1α as the standard gene.
Histology
Females or males were anesthetized in Tricaine as described (Westerfield, 2000), and the ovaries or testes were dissected and fixed in 4% paraformaldehyde overnight at 4°C. Fixed ovaries were washed in PBS, dehydrated in methanol, embedded in paraffin and sectioned. Deparaffinized slides were stained in H&E, coated with Permount solution (Fisher Scientific), coverslipped and imaged. Oocytes were staged according to Selman et al. (1993).
RNA injection
ha-kif5Ba RNA was transcribed from pCS2+HA-Kif5Ba (Nojima et al., 2010) with the mMESSAGE mMACHINE SP6 Transcription Kit (Life Technologies, AM1340). pCS-GFP-Buc was created by recombining pCR8-cbuc80 (Heim et al., 2014) with pCSGFPDest (Villefranc et al., 2007) (Invitrogen). gfp-buc RNA was transcribed from pCS-GFP-Buc with the mMESSAGE mMACHINE SP6 Transcription Kit. cherry-24xMBS RNA was used as a control and prepared as previously described (Campbell et al., 2015). Embryos from kif5Ba−/− females were collected within 15 min of spawning. Approximately 1 nl of 500-800 ng/μl (ha-kif5Ba or cherry-MBS) or 400 ng/μl (gfp-buc) injection solution was injected into 1-cell-stage embryos.
Buc pull-down
To reduce yolk content, ovaries were dissected from alk6b−/− adults (Neumann et al., 2011) and lysed in RIPA buffer. To pre-clear the lysate and to bind the antibody, respectively, 500 μg ovary lysate+50 μl Protein G beads (New England Biolabs, S1430S) and 50 μl Protein-G beads+100 μl y1165 (Heim et al., 2014) were simultaneously incubated at 4°C for 1 h. Pre-cleared lysate and antibody-bound beads were incubated at 4°C for 1 h and beads were then washed with RIPA. Proteins were eluted in 60 μl SDS-BME at 70°C for 5 min. Eluates were run on pre-cast polyacrylamide gels (Bio-Rad, 161-1174), stained with Gel Code Blue stain (Pierce, PI24592), and bands were extracted and analyzed with mass spectrometry and Scaffold software (Einstein Proteomics Facility).
Co-immunoprecipitation in HEK293T cells
HEK293T cells were transfected with pCS-GFP-Buc and pCS2+HA-Kif5Ba (Nojima et al., 2010) using Optimem (Life Technologies, 31985) and PEI, and lysed at 48 h post-transfection using RIPA plus protease-inhibitors (Sigma, P2714). Lysates were pre-cleared with Protein-G Beads (New England Biolabs, S1430S) at 4°C for 1 h, then immunoprecipitated with anti-GFP antibody clone 3E6 (Life Technologies, A11120). Eluates were run on Fisher EZ-Run 12.5% SDS-PAGE (Fisher, BP7712) and blotted with anti-HA 3F10 antibody (Roche, 11867423001). Proteins were detected with HRP-conjugated anti-Rat IgG (H+L) (Jackson ImmunoResearch, 112-036-003), using the Amersham ECL Plus Chemiluminescence kit (GE Healthcare, RPN2132).
Image acquisition and processing
Whole-mount chromogenic in situ hybridization and live whole-mount 1 dpf embryos were imaged using an Olympus SZ61 dissecting microscope with a high-resolution digital camera (model S97809, Olympus America) and Picture Frame 3.0 software (Optronics). H&E stainings were imaged using a Zeiss Axioskop2 plus microscope with a Zeiss AxioCam MRc camera and Zeiss AxioVision Rel. 4.6 software. Anti-Syntabulin-stained eggs, RNAscope in situ hybridization, cytoskeleton at the cleavage furrows, oocyte immunofluorescence and anti-Vasa-stained embryos were imaged using a Zeiss Axio Observer inverted microscope equipped with Apotome and AxioCam MRm CCD camera and Zeiss AxioVision Rel. 4.6 software. Vegetal microtubules and high magnification anti-Vasa-stained PGCs were imaged using a Zeiss 5Live Duoscan line-scanning confocal microscope.
Acknowledgements
We thank F. Pelegri, M. Hibi and H. Knaut for reagents, Marlow lab members for discussions, our animal staff, and the Analytical Imaging (NCI P30CA013330), Histotechnology and Proteomics Facilities for technical support.
Author contributions
P.D.C. and M.Z.S. identified kif5Ba alleles. P.D.C., A.E.H. and F.L.M. performed dissections and histological analysis. P.D.C. and A.E.H. performed all other experiments and analysis in consultation with F.L.M. P.D.C., A.E.H. and F.L.M. conceived and designed experiments. F.L.M. contributed reagents, materials and analysis tools. All authors discussed data and the manuscript. P.D.C. and F.L.M. wrote the manuscript.
Funding
This work was supported by the National Institutes of Health [R01GM089979 and start-up funds to F.L.M.; T32-GM007288 and 1F31NS083258 to P.D.C.]. Deposited in PMC for release after 12 months.
References
Competing interests
The authors declare no competing or financial interests.