Striated muscle development requires the coordinated expression of genes involved in sarcomere formation and contractility, as well as genes that determine muscle morphology. However, relatively little is known about the molecular mechanisms that control the early stages of muscle morphogenesis. To explore this facet of myogenesis, we performed a genetic screen for regulators of somatic muscle morphology in Drosophila, and identified the putative RNA-binding protein (RBP) Hoi Polloi (Hoip). Hoip is expressed in striated muscle precursors within the muscle lineage and controls two genetically separable events: myotube elongation and sarcomeric protein expression. Myotubes fail to elongate in hoip mutant embryos, even though the known regulators of somatic muscle elongation, target recognition and muscle attachment are expressed normally. In addition, a majority of sarcomeric proteins, including Myosin Heavy Chain (MHC) and Tropomyosin, require Hoip for their expression. A transgenic MHC construct that contains the endogenous MHC promoter and a spliced open reading frame rescues MHC protein expression in hoip embryos, demonstrating the involvement of Hoip in pre-mRNA splicing, but not in transcription, of muscle structural genes. In addition, the human Hoip ortholog NHP2L1 rescues muscle defects in hoip embryos, and knockdown of endogenous nhp2l1 in zebrafish disrupts skeletal muscle development. We conclude that Hoip is a conserved, post-transcriptional regulator of muscle morphogenesis and structural gene expression.

INTRODUCTION

The transcriptional regulatory networks that direct muscle precursor cell specification and the expression of muscle structural genes have been well defined. However, the possible post-transcriptional contribution to mesoderm development is only beginning to come to light (Biedermann et al., 2010; Toledano-Katchalski et al., 2007; Yarnitzky et al., 1998). The unique properties of Drosophila, including external development and an extensive array of genetic tools, have allowed the discrete cellular processes directing muscle development to be dissected in detail (Guerin and Kramer, 2009a; Schejter and Baylies, 2010; Schnorrer and Dickson, 2004).

Embryonic somatic muscle development in Drosophila is a multistep process that initiates with the specification of founder cells from a field of myogenic competent cells in the mesoderm (Carmena et al., 1995; Jagla et al., 1998). Founder cells express a unique set of muscle identity genes, encoding transcription factors, that direct differentiation into one of 30 somatic muscles (de Joussineau et al., 2012). Once specified, muscle founders begin the process of migration and elongation that can be divided into three phases (Schnorrer and Dickson, 2004). During the first phase, founder cells migrate to their correct position within the segment. The second phase begins when the founder cells initiate myoblast fusion and form polarized myotubes that elongate along a single axis. The myotubes then form extensive filopodia in the direction of initial polarity, presumably in response to guidance cues from tendon cells in the overlying epidermis (Guerin and Kramer, 2009a; Schnorrer and Dickson, 2004). The center of the myotube remains localized while the ends of the myotube elongate towards their respective muscle-attachment sites (Schnorrer and Dickson, 2004). The final phase of elongation initiates when the myotube ends reach their muscle attachment sites and filopodia no longer form. The myotube then localizes integrin-mediated adhesion complexes with the overlying tendon cells to establish strong myotendinous junctions (Schejter and Baylies, 2010).

The mechanisms that control myotube elongation during somatic muscle morphogenesis are poorly understood. Slit is the single guidance molecule known to direct both myotube elongation and target site recognition, but loss of Slit modestly affects the elongation of only a subset of myotubes (Kramer et al., 2001). Nascent myotubes must undergo extensive cytoskeletal rearrangements during elongation, and recent work has focused on the role of microtubule dynamics in this process (Folker et al., 2012; Guerin and Kramer, 2009b). Tumbleweed (Tum) is a Rac family GTPase-activating protein that becomes localized to the nuclear periphery via its association with the microtubule-associated protein Pavarotti (Pav). Loss of pav or tum disrupts microtubule polarity and polarized growth, mislocalizes the minus-end microtubule nucleator γ-tubulin and causes modest myotube elongation defects (Guerin and Kramer, 2009b). A second regulator of microtubule dynamics, Dynein heavy chain (Dhc64C), is also required for myotube elongation but its role is restricted to the final stages of elongation (Folker et al., 2012). Although microtubule dynamics plays a key role in the process, the mechanisms that initiate myotube elongation and the downstream targets of intracellular messenger proteins, such as Tum, remain largely unknown.

The cellular events that regulate myotube morphology are distinct from the molecular processes that direct terminal differentiation and structural gene expression. Embryos defective in myoblast fusion express Myosin Heavy Chain (MHC) in unfused mononucleate founder cells; this striking phenotype has been exploited in genetic screens to identify novel regulators of myoblast fusion (Chen and Olson, 2001). Components of the sarcomere, the basic unit of muscle contraction, are subject to extensive post-transcriptional regulation. For example, Drosophila MHC is encoded by a single genomic locus that can produce 480 unique protein isoforms (Zhang and Bernstein, 2001). These isoforms encode variant regions of the MHC globular head and provide diversity in contractile performance (Kronert et al., 1994). However, the RNA-binding proteins (RBPs) that regulate the production of different MHC isoforms have not been identified.

In a screen for genes that regulate somatic muscle morphology in Drosophila, we identified the putative RBP Hoi polloi (Hoip). hoip embryos show two dramatic phenotypes: myotube elongation does not initiate, even though founder cell specification and myoblast fusion initiate normally and striated muscles fail to express multiple sarcomeric proteins, including MHC and Tropomyosin (Tm). hoip expression is tissue specific and within the muscle lineage is restricted to striated muscle precursors. By RNA deep sequencing (RNA-seq), we found that known regulators of myotube elongation are expressed correctly in hoip mutant embryos, suggesting Hoip orchestrates a previously unrecognized post-transcriptional mechanism to initiate elongation. Functional rescue experiments demonstrate that Hoip directs pre-mRNA splicing during myogenesis. The human Hoip ortholog NHP2L1 can rescue the hoip phenotype in Drosophila, and morpholino (MO) knockdown experiments in zebrafish indicate that nhp2l1 is a conserved essential regulator of myogenesis. This is the first study to show a tissue-specific role for Hoip or its orthologs in vivo, to identify a robust genetic block in the second phase of myotube elongation, and to address post-transcriptional regulation of sarcomeric gene expression by a putative RBP during Drosophila embryogenesis.

MATERIALS AND METHODS

Drosophila genetics

All stocks were obtained from the Bloomington Stock Center unless otherwise noted. The stocks used in this study were: Df(2L)ED90, Df(2L)ED678, Df(2L)Exel6024, Df(2L)Exel7043, Df(2L)Exel7042, Df(2L)Exel8041, Df(2L)BSC216, Df(2L)BSC108, Df(3R)Exel6191, P{lacW}hoipk07104, P{Mhc.EMB} (Wells et al., 1996), Mhc1 (Wells et al., 1996), P{Gal4-kirrerP298}, P{kirrerP298.lacZ} (Nose et al., 1998) and the Baylor P-element Mapping Kit (Zhai et al., 2003). The Cyo, P{Gal4-Twi}, P{2X-UAS.eGFP}; Cyo, P{wg.lacZ}; and TM3, P{ftz.lacZ} balancers were used to identify homozygous embryos.

EMS mutagenesis and gene mapping

Isogenic, starved w1118 males were fed 25 mM EMS in 1% sucrose overnight and mated en masse as shown (supplementary material Fig. S1A). Mapping of hoip1 was performed as described previously (Zhai et al., 2003).

Immunohistochemistry, in situ hybridization and imaging

Antibodies used include anti-Mef2 (Lilly et al., 1995), anti-Nau (Wei et al., 2007), anti-Tin (Venkatesh et al., 2000), anti-MHC (Kiehart and Feghali, 1986), anti-Kr (Kosman et al., 1998), anti-MF20 (DSHB), anti-Tropomyosin (Abcam, MAC141), anti-GFP (Torrey Pines Laboratories), anti-βPS (DSHB), anti-Talin (DSHB), anti-22C10 (DSHB) and anti-βgal (Promega). Alexa488-, Alexa633- and HRP-conjugated secondary antibodies in conjunction with the TSA system (Molecular Probes) were used to detect primary antibodies. Antibody staining and in situ hybridization was performed as described (Johnson et al., 2007). Mef2 was directly conjugated with Zenon633 (Molecular Probes) for co-labeling with rabbit primary antibodies. The following templates were used to generate in situ probes: RE51843 (hoip; DGRC) and Mhc.Exon4-6 (a gift from S. Bernstein, SDSU, San Diego, CA, USA). Images were generated with LSM510 and LSM710 confocal microscopes. Control and mutant embryos were prepared and imaged in parallel.

RT-PCR

Appropriately aged embryos were dechorionated (Drosophila) or devitellinated (Danio), hand sorted to isolate homozygous mutants where needed, and homogenized in TRizol (Invitrogen). RNA was then extracted as per manufacturer’s specification. cDNA was generated using Superscript III (Invitrogen) and qPCR was performed with SYBR Green (Promega) using an ABI Prism 7000. Primers were designed to be intron spanning. qPCR reactions were run in triplicate and normalized to RpL32 (Drosophila) or GAPDH (zebrafish) expression. Primer sequences are provided in supplementary material Table S6.

Western blot

COS-1 cells were transfected with 1 μg of DNA according to manufacturer’s instructions (Fugene6, Roche), maintained for 48 hours, collected and lysed with NP40 lysis buffer. Western blots were performed as described previously (Mokalled et al., 2010).

Transgenes and site-directed mutagenesis

UAS constructs were generated by subcloning hoip (DGRC RE51843) and NHP2L1 (DF/HCC HSCD00326196) ORFs into pUASt. HA-tagged Hoip was made by PCR amplifying the hoip ORF and cloning the PCR fragment into pEntr (Invitrogen); after sequence verification, L/R clonase (Invitrogen) was used to recombine hoip into THW. For reporter genes, genomic DNA was PCR amplified, cloned into pCRII (Invitrogen), sequence verified, subcloned into pH.Stinger.eGFP (Barolo et al., 2004). Transgenic vectors were injected by standard methods to establish stable transgenic insertions. Multiple independent lines were characterized for each construct. Primer sequences are available upon request. Site-directed mutagenesis to generate Hoip.-225GFP.ΔE was carried out as described previously (Johnson et al., 2011).

RNA-Seq

The SOLiD Total RNA-Seq Kit was used for RNA purification from 6-10 hour embryos and DNA library construction. Libraries were prepared in duplicate and sequenced on a 5500xl SOLiD Sequencer (Life Technologies) using a paired-end reading strategy. Sequencing reads were mapped to the UCSC reference genome using LifeScope (Life Technologies), then assembled and quantified using the Cufflinks algorithm (Trapnell et al., 2010). Assembled sequence reads were visualized using the Integrative Genomics Viewer (Robinson et al., 2011) and GO analysis was performed using the DAVID 6.7 bioinformatics resources (Dennis et al., 2003).

Zebrafish embryology

Fertilized, one-cell stage Tg(α-actin:GFP) zebrafish embryos were injected with 0.08 ng or 0.8 ng of nhp2l1b ATG-MO (GGTTCACTTCAGCTTCAGTCATCTT) or 0.8 ng of Cntrl-MO (Gene Tools). At 14 hpf, embryos were live imaged for GFP, fixed and analyzed for GFP and MF20 expression, or used for RNA isolation and qPCR analysis, by standard methods. Similar experiments were performed for nhp2l1b 5′UTR-MO (TTACTTAATAACACACGGTCCTCTC). Annealed oligonucleotides encoding the ATG-MO target sequence were cloned into 5′RV EGFP T7TS (Small et al., 2005). Linearized template was transcribed with T7 mMessage machine (Ambion) to generate injectable RNA. Control and morphant embryos were prepared and imaged in parallel.

RESULTS

A forward genetic screen identified hoip as an essential regulator of myogenesis

We performed an EMS genetic screen to identify novel mutations that specifically affect somatic muscle morphology. Our screening strategy employed two reporter genes: MHC.τGFP, which expresses a membrane-localized GFP in embryonic somatic muscles (Chen and Olson, 2001); and Hand.nGFP that expresses a nuclear-localized GFP in cardioblasts (CBs) by embryonic stage 12 (St12) (Johnson et al., 2011). The Hand.nGFP reporter served as a control to distinguish mutations that affected early mesoderm patterning events and cardiac cell fate specification, allowing us to focus on mutations that specifically affected somatic muscle morphology. We screened ∼10,000 genomes and identified 96 mutations on the second chromosome that caused somatic muscle defects (supplementary material Fig. S1A). We mapped two mutations to Kon-tiki (Kon), a known regulator of target site recognition (Schnorrer et al., 2007), and a second mutation to mind bomb 2, a known regulator of muscle attachment (Carrasco-Rando and Ruiz-Gómez, 2008).

One mutation that solely affected the pattern of MHC.τGFP expression mapped to a region of chromosome 2L that contains eight genes (Fig. 1A). Genetic analysis in this region showed that the mutation failed to complement P{lacW}hoipk07104, so we named the EMS allele hoip1. The Hoip orthologs Snu13 in yeast and NHP2L1 (Non-Histone Protein 2 Like-1) in humans are RNA-binding proteins that bind noncoding RNAs associated with the spliceosome (Dobbyn and O’Keefe, 2004; Vidovic et al., 2000; Watkins et al., 2002). Compared with live wild-type (WT) embryos (Fig. 1B), somatic muscle morphology was aberrant in live hoip1 homozygous (Fig. 1C), hoip1/Df(2L)ED690 (Fig. 1D) and hoip1/P{lacW}hoipk07104 transheterozygous embryos (Fig. 1E). In particular, the lateral transverse (LT1-4), lateral longitudinal (LL1), lateral oblique (LO1) and dorsal oblique (DO3-5) somatic muscles showed pronounced membrane extensions towards target sites, yet remained rounded in hoip mutant embryos (Fig. 1C-E; supplementary material Table S1). This failure in myogenesis prevented hoip1, hoip1/Df(2L)ED690 and hoip1/P{lacW}hoipk07104 embryos from emerging from the chorion after embryogenesis.

Fig. 1.

A mutation adversely affecting somatic muscle development maps to hoip. (A) The genomic region uncovered by Df(2L)ED690. Genes and direction of transcription are shown with blue arrows. Deficiencies that fail to complement hoip1 are shown in red; deficiencies that complement hoip1 are shown in dark blue. The minimal overlapping area among the deficiencies that fail to complement hoip1 contains eight genes. Of the four lethal transgene insertions (triangles) in the minimal overlapping area, only P{lacW}hoipk07104 (red triangle) failed to complement hoip1. (B-E) MHC.τGFP, Hand.nGFP expression in St17 embryos. (B) Wild-type embryos express membrane-localized τGFP in each somatic muscle in all embryonic segments. Somatic muscles are severely rounded (arrowheads) in hoip1 (C), hoip1/Df(2L)ED690 (D) and hoip1/P{lacW}hoipk07104 embryos (E). (B′-E′) High-magnification views of embryos shown in B-E. (F) hoip1 is a G37E missense mutation (see supplementary material Fig. S1I). In this and subsequent figures, embryos are oriented with anterior towards the left and dorsal towards the top. Coordinates refer to base pair positions on chromosome 2L. Scale bars: 20 μm.

Fig. 1.

A mutation adversely affecting somatic muscle development maps to hoip. (A) The genomic region uncovered by Df(2L)ED690. Genes and direction of transcription are shown with blue arrows. Deficiencies that fail to complement hoip1 are shown in red; deficiencies that complement hoip1 are shown in dark blue. The minimal overlapping area among the deficiencies that fail to complement hoip1 contains eight genes. Of the four lethal transgene insertions (triangles) in the minimal overlapping area, only P{lacW}hoipk07104 (red triangle) failed to complement hoip1. (B-E) MHC.τGFP, Hand.nGFP expression in St17 embryos. (B) Wild-type embryos express membrane-localized τGFP in each somatic muscle in all embryonic segments. Somatic muscles are severely rounded (arrowheads) in hoip1 (C), hoip1/Df(2L)ED690 (D) and hoip1/P{lacW}hoipk07104 embryos (E). (B′-E′) High-magnification views of embryos shown in B-E. (F) hoip1 is a G37E missense mutation (see supplementary material Fig. S1I). In this and subsequent figures, embryos are oriented with anterior towards the left and dorsal towards the top. Coordinates refer to base pair positions on chromosome 2L. Scale bars: 20 μm.

The P{lacW}hoipk07104 insertion was originally identified in a peripheral nervous system (PNS) screen (Kania et al., 1995; Prokopenko et al., 2000). P{lacW}hoipk07104 embryos showed disorganized dorsal clusters of PNS neurons and axonal path finding defects (Kania et al., 1995). However, the P-element itself was not revertible (Kania et al., 1995) and P{lacW}hoipk07104 embryos showed global patterning defects that we did not observe in other hoip mutant combinations (supplementary material Fig. S1B,C). We assayed PNS morphology in hoip1 and hoip1/P{lacW}hoipk07104 embryos (n≥3) but could not confirm the previously reported PNS defects (supplementary material Fig. S1D-F). These data suggest a lethal mutation on the P{lacW}hoipk07104 chromosome outside hoip disrupts a powerful regulator of embryonic patterning that could affect PNS development.

Sequencing the hoip1 allele revealed a G37E missense mutation (Fig. 1F; supplementary material Fig. S1I) within the predicted Hoip RNA-binding domain (Schultz et al., 2006). Based on the predicted crystal structure of this domain (supplementary material Fig. S1G), the acidic amino acid substitution would be expected to eliminate Hoip RNA-binding activity (Vidovic et al., 2000). A tagged hoip protein harboring the G37E mutation was detectable by western blot in transfected COS-1 cells, demonstrating that hoip1 is not a protein null mutation (supplementary material Fig. S1H).

Myotube elongation does not initiate in hoip embryos

To understand the stage of myogenesis regulated by Hoip, we performed time-lapse studies in embryos expressing τGFP under the control of the founder cell driver rp298.gal4. Our analysis focused on the LL, LT, LO and DO muscles, as these muscles were most often disrupted in hoip mutant embryos (supplementary material Table S1). Our analysis began in late St12 embryos that expressed rp298>τGFP in nascent myotubes (Fig. 2A). In wild-type embryos, myotubes showed obvious polarization and had elongated to 50% of segment width after 30 minutes. By 60 minutes, the myotubes had largely completed their extension and created extensive filopodia for attachment site recognition (Fig. 2A; n=2). By contrast, nascent myotubes failed to elongate in hoip1 embryos after 30 minutes even though the myotubes showed an initial polarity (Fig. 2B). By 60 minutes, myotubes failed to extend to 50% of segment width in hoip1 embryos and had lost their polarity (Fig. 2B; n=3). These results demonstrate that myotubes failed to elongate and reach their attachment sites in hoip1 embryos.

Fig. 2.

hoip embryos have myotube elongation defects. (A,B) Time-lapse images of rp298>τGFP embryos initiated at late St12. (A) Wild-type embryos showed robust myotube elongation at 30 minutes (double arrows) and developed extensive filopodia for attachment site recognition at 60 minutes (white arrows). (B) Myotubes established polarity in hoip1 embryos at 15 minutes but failed to elongate by 30 minutes. Polarized myofibers at 15 minutes compacted over time (double-headed arrows). (C,D) St16 rp298>τGFP embryos double labeled for GFP and βPS. (C) βPS localizes to myotendinous junctions in wild-type embryos. (D) Tendon cells express βPS in hoip1 embryos but localization is diffuse (red arrowheads). (C′,D′) βPS expression alone. (E,F) St16 rp298>τGFP embryos double labeled for GFP and Talin. Talin is expressed in tendon cells of wild-type (E) and hoip1 (F) embryos. (E′,F′) Talin expression alone. mg, midgut. Scale bars: 20 μm.

Fig. 2.

hoip embryos have myotube elongation defects. (A,B) Time-lapse images of rp298>τGFP embryos initiated at late St12. (A) Wild-type embryos showed robust myotube elongation at 30 minutes (double arrows) and developed extensive filopodia for attachment site recognition at 60 minutes (white arrows). (B) Myotubes established polarity in hoip1 embryos at 15 minutes but failed to elongate by 30 minutes. Polarized myofibers at 15 minutes compacted over time (double-headed arrows). (C,D) St16 rp298>τGFP embryos double labeled for GFP and βPS. (C) βPS localizes to myotendinous junctions in wild-type embryos. (D) Tendon cells express βPS in hoip1 embryos but localization is diffuse (red arrowheads). (C′,D′) βPS expression alone. (E,F) St16 rp298>τGFP embryos double labeled for GFP and Talin. Talin is expressed in tendon cells of wild-type (E) and hoip1 (F) embryos. (E′,F′) Talin expression alone. mg, midgut. Scale bars: 20 μm.

To understand whether Hoip controls target site recognition, we repeated time-lapse imaging at higher magnification to document filopodia in detail (supplementary material Fig. S2; n=3). hoip1 embryos extended filopodia exclusively in the direction of myotube polarity. This phenotype contrasts with that of Kon mutant embryos, which initiate myotube elongation but, instead of orienting filopodia solely toward muscle attachment sites, extend ectopic filopodia in all directions (Schnorrer et al., 2007). Kon is a transmembrane receptor that regulates myotube target site recognition. As hoip myotubes do not phenocopy Kon myotubes, we conclude that Hoip does not control attachment site recognition.

Muscle attachment sites are specified in hoip embryos

To understand whether tendon cells, which mediate muscle attachment, were specified in hoip1 embryos, we assayed expression of βPS (myospheroid), an effector of muscle attachment. βPS is expressed in tendon cells and localizes to myotendinous junctions after attachment-site recognition (Martin-Bermudo and Brown, 2000). βPS was clearly detectable in the epidermis of hoip1 embryos, but showed diffuse localization along the dorsoventral axis compared with wild-type embryos (Fig. 2C,D). As βPS is also expressed in somatic muscle, we next examined Talin expression. Talin is restricted to tendon cells and acts as a linker between βPS and the cytoskeleton. Similar to βPS, Talin is clearly expressed in the epidermis of hoip1 embryos (Fig. 2E,F). Taken together, these results show that the rounded muscle phenotype in hoip1 embryos is due to a block at, or prior to, myotube elongation and is not a result of tendon cell mis-specification.

Hoip does not regulate founder cell specification or the first round of myoblast fusion

To further characterize the myogenic phenotype in hoip1 embryos, we examined founder cell specification and myoblast fusion. After specification, founder cells undergo an initial round of fusion that is complete by the end of St12 (Bate, 1990). Subsequent fusion then determines final muscle size and each muscle undergoes a unique number of fusion events. MHC serves as a classic marker for identifying myoblast fusion defects; embryos with defects in the first round of myoblast fusion robustly express MHC in single unfused founder cells (Chen and Olson, 2001). To control against possible dominant mutations on the EMS chromosome, we compared MHC expression in hoip1 embryos with heterozygous hoip1/Cyo.lacZ embryos. Strikingly, the somatic musculature of St16 hoip1 embryos showed almost no MHC protein expression, whereas hoip1/Cyo embryos showed normal MHC expression and somatic muscle morphology (Fig. 3A,B; Table 1).

Fig. 3.

Hoip regulates somatic muscle and cardioblast maturation but not precursor specification. (A,B) Mef2 and MHC protein expression in St16 embryos. Lateral views. Robust MHC and Mef2 expression is detectable in somatic muscles of hoip1/Cyo.lacZ embryos (A). Mef2 expression is unaffected in hoip1 embryos, whereas MHC is nearly absent from the somatic muscle (B). (C-F) St16 rp298.gal4>τ.GFP, rp298.nlacZ embryos double-labeled for GFP (red) and lacZ (green). (C-D′) Dorsal muscles. The number of lacZ+ nuclei is reduced in hoip1 embryos (C) compared with hoip1/Cyo.lacZ embryos (D); however, binucleated dorsal muscles show complete elongation (arrowheads). (E-F′) Lateral and ventral muscles. The number of lacZ+ nuclei is also reduced in lateral and ventral muscles in hoip1 embryos. Multinucleate lateral muscles show incomplete elongation (arrows). (G,H) Mef2 and MHC protein expression in St16 embryos. Dorsal views. (G) hoip1/Cyo.lacZ embryos express Mef2 and MHC in mature CBs. (H) hoip1 embryos express Mef2 but not MHC in a great majority of CBs. (I-L′) Mef2 and Tin protein expression. (I,J) hoip1/Cyo.lacZ embryos express Mef2 in all myogenic precursors, including CBs. Tin is expressed in four Mef2+ CBs per hemisegment at St13 (I; lateral view) and St16 (K; dorsal view). Mef2 and Tin expression in hoip1 CBs is comparable with control embryos at St13 (J) and St16 (L). (K′,L′) Tin expression alone. (M,N) High magnification micrographs of visceral muscles in St16 embryos. MHC expression is comparable between hoip1/Cyo.lacZ embryos (M) and hoip1 embryos (N). Both genotypes develop LVMs and CVMs in the visceral mesoderm. (O) hoip1 rp298>Hoip embryos express MHC protein at near wild-type levels in the somatic mesoderm. SM, somatic muscle; VM, visceral muscle; LVM, longitudinal visceral muscle; CVM, circular visceral muscle; CBs, cardioblasts. Open arrowheads in I,K show ectodermal cytoplasmic lacZ expression that distinguishes hoip1 heterozygotes from homozygotes. Scale bars: 20 μm.

Fig. 3.

Hoip regulates somatic muscle and cardioblast maturation but not precursor specification. (A,B) Mef2 and MHC protein expression in St16 embryos. Lateral views. Robust MHC and Mef2 expression is detectable in somatic muscles of hoip1/Cyo.lacZ embryos (A). Mef2 expression is unaffected in hoip1 embryos, whereas MHC is nearly absent from the somatic muscle (B). (C-F) St16 rp298.gal4>τ.GFP, rp298.nlacZ embryos double-labeled for GFP (red) and lacZ (green). (C-D′) Dorsal muscles. The number of lacZ+ nuclei is reduced in hoip1 embryos (C) compared with hoip1/Cyo.lacZ embryos (D); however, binucleated dorsal muscles show complete elongation (arrowheads). (E-F′) Lateral and ventral muscles. The number of lacZ+ nuclei is also reduced in lateral and ventral muscles in hoip1 embryos. Multinucleate lateral muscles show incomplete elongation (arrows). (G,H) Mef2 and MHC protein expression in St16 embryos. Dorsal views. (G) hoip1/Cyo.lacZ embryos express Mef2 and MHC in mature CBs. (H) hoip1 embryos express Mef2 but not MHC in a great majority of CBs. (I-L′) Mef2 and Tin protein expression. (I,J) hoip1/Cyo.lacZ embryos express Mef2 in all myogenic precursors, including CBs. Tin is expressed in four Mef2+ CBs per hemisegment at St13 (I; lateral view) and St16 (K; dorsal view). Mef2 and Tin expression in hoip1 CBs is comparable with control embryos at St13 (J) and St16 (L). (K′,L′) Tin expression alone. (M,N) High magnification micrographs of visceral muscles in St16 embryos. MHC expression is comparable between hoip1/Cyo.lacZ embryos (M) and hoip1 embryos (N). Both genotypes develop LVMs and CVMs in the visceral mesoderm. (O) hoip1 rp298>Hoip embryos express MHC protein at near wild-type levels in the somatic mesoderm. SM, somatic muscle; VM, visceral muscle; LVM, longitudinal visceral muscle; CVM, circular visceral muscle; CBs, cardioblasts. Open arrowheads in I,K show ectodermal cytoplasmic lacZ expression that distinguishes hoip1 heterozygotes from homozygotes. Scale bars: 20 μm.

Table 1.

MHC expression

MHC expression
MHC expression

Another method for identifying myoblast fusion defects is to quantify the temporal expression of muscle identity genes in the dorsal mesoderm (Chen and Olson, 2001). The identity gene nautilus (nau) is expressed in a subset of founder cells that give rise to the somatic muscles affected in hoip1 embryos, including DA3, DO3, DO4, DO5, VA1, LO1 (Wei et al., 2007). The number of Nau+ nuclei in hoip1 embryos was comparable with hoip1/Cyo.lacZ embryos at St12, but significantly less at St14 (supplementary material Fig. S3A,B). Thus, founder cell specification and the first round of myoblast fusion proceed normally in hoip1 embryos; however, the later rounds of fusion do not occur.

To confirm this result, we used the founder cell transgene rp298.nlacZ to assay founder cell specification and myoblast fusion. Similar to Nau, the number of lacZ-positive nuclei was comparable between hoip1 and hoip1/Cyo.lacZ embryos at St12 (supplementary material Fig. S3C,D), but significantly reduced at St14 and St16 (Fig. 3C-F; supplementary material Fig. S3E-H). However, the fusion defects in hoip1 embryos were not restricted to the muscles that showed elongation defects. For example, DO1 and DA1 muscles elongated normally in hoip1 embryos but showed dramatically fewer lacZ-positive nuclei than hoip1/Cyo.lacZ embryos (Fig. 3C,D). However, LL1 and LO5 were multinucleate in hoip1 embryos but failed to elongate (Fig. 3E,F).

Somatic and cardiac muscle maturation is Hoip dependent

One explanation for the somatic muscle defects in hoip1 embryos was that MHC itself is required for myotube elongation. However, embryos homozygous for the null mutation MHC1 (Wells et al., 1996) showed normal myotube elongation (supplementary material Fig. S3I,J). Sarcomere assembly occurs after myotube elongation and myofiber attachment (Rui et al., 2010) and embryos defective for the first round of myoblast fusion do express MHC (Chen and Olson, 2001). Together, these observations demonstrate that muscle morphogenesis is genetically separable from muscle structural expression and prompted us to define a secondary role for Hoip during myogenesis.

In Drosophila, MHC is the single muscle myosin and is expressed in cardiac, somatic and visceral muscle (Bernstein et al., 1983). Mef2 is also expressed in all myogenic cells and is a direct transcriptional activator of MHC (Bour et al., 1995). Mef2 was expressed at comparable levels in the somatic and cardiac mesoderm of hoip1 and hoip1/Cyo.lacZ embryos (Fig. 3A,B,G-L), even though MHC was largely absent from both tissues in hoip1 embryos (Fig. 3B,H). The expression of a second transcription factor, Tinman (Tin), is restricted to and orchestrates the maturation of a subset of cardioblasts (CBs) (Reim et al., 2005). Cardiac Tin expression was also comparable between hoip1 and hoip1/Cyo.lacZ embryos (Fig. 3I-L). As Drosophila CBs are mononucleate, do not undergo elongation, yet fail to express MHC in hoip1 embryos, we conclude that Hoip regulates muscle maturation (i.e. muscle structural protein expression) independently of myotube elongation.

Even though MHC expression was largely absent from CBs and somatic muscles in hoip1 embryos, MHC expression in mature visceral muscle was comparable between hoip1 and hoip1/Cyo.lacZ embryos (Fig. 3M,N). These results suggest that Hoip performs tissue-specific functions during myogenesis to specifically regulate striated muscle maturation.

Hoip regulates terminal muscle differentiation

To confirm that Hoip regulates myogenesis after founder cell specification, we expressed Hoip with rp298.Gal4 in hoip1 embryos and assayed MHC expression. Founder cell-specific expression of Hoip was indeed sufficient to rescue myotube elongation and MHC protein expression in somatic muscles of hoip1 embryos (Fig. 3O; Table 1). Hoip therefore regulates myogenesis after founder cell specification in a mesoderm cell-autonomous manner.

hoip is expressed in striated but not visceral muscle progenitors

In situ hybridization using a probe antisense to the full-length hoip transcript (Fig. 4A) showed hoip expression initiates at low levels in the mesoderm and endoderm of St9 embryos (supplementary material Fig. S4A-C). Robust expression hoip mRNA could be detected in St11 embryos and, consistent with the tissue-restricted MHC phenotype in hoip1 embryos, is expressed in the Mef2-expressing cells of the somatic and cardiac mesoderm, but not in the Mef2-expressing cells of the visceral mesoderm (Fig. 4B). hoip mRNA is also expressed in the fat body and the endoderm at this stage, but is absent from the neuroectoderm ventral to the Mef2 expression domain. hoip mRNA continues to be expressed in the somatic musculature throughout embryogenesis (Fig. 4C; supplementary material Fig. S4D,E). We did not detect hoip in the PNS by in situ hybridization.

Fig. 4.

hoip is expressed in striated but not visceral muscle progenitors. (A) hoip gene organization and conservation within the Drosophila genus. The red line identifies genomic sequences used to generate the -225.nGFP and -225ΔE.nGFP hoip reporter genes. (B) St11 embryo labeled for hoip mRNA (green) and Mef2 (red). hoip mRNA is expressed in the Mef2-expressing cells of the somatic mesoderm, as well as in the fat body and the endoderm, but is absent from the neuroectoderm. (B′) hoip expression alone. (B′,B′′) High magnification micrograph of the mesoderm shows hoip mRNA expression in the somatic but not the visceral mesoderm. (C-C′) At St13, hoip mRNA is still detectable in the developing somatic musculature. (D-E′) Hoip.-225.GFP embryos labeled for GFP (green) and Mef2 (red). GFP expression recapitulates hoip mRNA expression at St11 (D) and St13 (E). (F-G′) Hoip.-225ΔE.GFP embryos labeled for GFP (green) and Mef2 (red). GFP expression recapitulates hoip mRNA expression at St11 (F) but is undetectable at St13 (G). SM, somatic mesoderm; VM, visceral mesoderm; EN, endoderm. Scale bars: 20 μm.

Fig. 4.

hoip is expressed in striated but not visceral muscle progenitors. (A) hoip gene organization and conservation within the Drosophila genus. The red line identifies genomic sequences used to generate the -225.nGFP and -225ΔE.nGFP hoip reporter genes. (B) St11 embryo labeled for hoip mRNA (green) and Mef2 (red). hoip mRNA is expressed in the Mef2-expressing cells of the somatic mesoderm, as well as in the fat body and the endoderm, but is absent from the neuroectoderm. (B′) hoip expression alone. (B′,B′′) High magnification micrograph of the mesoderm shows hoip mRNA expression in the somatic but not the visceral mesoderm. (C-C′) At St13, hoip mRNA is still detectable in the developing somatic musculature. (D-E′) Hoip.-225.GFP embryos labeled for GFP (green) and Mef2 (red). GFP expression recapitulates hoip mRNA expression at St11 (D) and St13 (E). (F-G′) Hoip.-225ΔE.GFP embryos labeled for GFP (green) and Mef2 (red). GFP expression recapitulates hoip mRNA expression at St11 (F) but is undetectable at St13 (G). SM, somatic mesoderm; VM, visceral mesoderm; EN, endoderm. Scale bars: 20 μm.

To confirm the in situ results, we generated a GFP reporter construct that contained 225 bp of genomic DNA upstream of the hoip-coding sequence (Hoip.-225.GFP). This reporter gene directed GFP expression in a pattern that recapitulated hoip mRNA expression in St11 and St13 embryos (Fig. 4D,E). Interestingly, the Hoip.-225 sequence contains a conserved E-box sequence (CANNTG, supplementary material Fig. S4F). Basic helix-loop-helix (bHLH) transcription factors bind E-box sequences and a hoip reporter gene with a mutated E-box (Hoip.-225ΔE.GFP) initiated GFP expression in a manner comparable with Hoip.-225.GFP (Fig. 4F) but did not maintain GFP expression in the mesoderm through St13 (Fig. 4G). These findings demonstrate that hoip is expressed in the striated muscle lineage after precursor cell specification, and that maintenance of hoip expression depends on a conserved E-box sequence that is likely a bHLH target.

We next assayed Hoip localization in the somatic musculature using an HA-tagged Hoip transgene. Surprisingly, Mef2>Hoip-HA embryos showed both nuclear and cytoplasmic localization of Hoip-HA (supplementary material Fig. S5). Hoip may thus perform multiple molecular functions during myogenesis.

Several sarcomeric genes are downregulated in hoip embryos

The Hoip orthologs Snu13 in yeast and NHP2L1 in humans are spliceosomal RNA-binding proteins (Dobbyn and O’Keefe, 2004; Vidovic et al., 2000; Watkins et al., 2002). In eukaryotes, spliceosomes that contain small nuclear (sn) RNAs are believed to remove intronic sequences from pre-mRNAs, whereas spliceosomes that contain small nucleolar (sno) RNAs orchestrate ordered cleavages along pre-rRNAs. Snu13/NHP2L1 proteins preferentially bind to GA-rich RNA sequences in the kink-turn motif of both snRNAs and snoRNAs (Cléry et al., 2007; Nottrott et al., 1999; Schultz et al., 2006; Vidovic et al., 2000).

We took a non-biased approach to identify potential Hoip targets in the developing mesoderm. As robust hoip expression initiates at St11 and continues at high levels through St13, we performed RNA-seq in St11-13 (6-10 hour) embryos. Our analysis identified 353 transcripts that were differentially expressed and 60 transcripts that were expressed approximately at wild-type levels but inappropriately processed in hoip1 embryos (supplementary material Tables S2, S3). This RNA-seq analysis also identified the G37E missense mutation in hoip1 embryos, confirming the initial genomic sequencing data. In addition, 45S pre-rRNA was processed correctly in hoip1 St11-13 embryos, suggesting that Hoip does not regulate ribosome biogenesis during these stages of development (supplementary material Fig. S6A). These in vivo results demonstrate that Hoip is not required to process all pre-mRNA or pre-rRNA transcripts during embryogenesis.

We analyzed the misregulated transcripts in hoip1 embryos by Gene Ontology (GO) functional annotation clustering and found the most significant cluster associated with the GO term Contractile Fiber (Fig. 5A). Strikingly, transcripts within the Contractile Fiber cluster (Table 2) include Mhc and other sarcomere components, including inflated (if), Myosin light chain 2 (Mlc2), Tropomyosin 2 (Tm2), Troponin C at 47D (TpnC47D) and Troponin C at 73F (TpnC73F). We confirmed the RNA-seq data for these sarcomeric genes by quantitative PCR (qPCR) and found that each transcript was dramatically downregulated in hoip1 embryos compared with controls (Fig. 5B). The RNA-seq data showed that the embryonic sarcomeric actins Act57B and Act87E, and Mef2, the only known robust transcriptional regulator of terminal muscle differentiation genes in Drosophila, were expressed at wild-type levels in hoip1 embryos (supplementary material Fig. S6B, Table S2). The developmental time point of our RNA-seq coincided with the onset of muscle structural gene expression at St12. However, hoip1 embryos fail to express MHC protein at all developmental stages (Fig. 3B). These observations suggest that Hoip is required to both initiate and maintain muscle structural gene expression during embryogenesis.

Fig. 5.

Hoip processes transcripts encoding sarcomere components. (A) Functional Gene Ontology (GO) analysis of misregulated transcripts in hoip1 embryos. Clusters of down- and upregulated transcripts are shown in red and green, respectively. The most significant cluster is associated with the term Contractile Fiber. (B) qPCR of Contractile Fiber transcript expression in hoip1 embryos compared with wild type. (C) The MHCemb transgene. The construct contains endogenous, somatic muscle MHC enhancer elements, multiple transcriptional start sites (colored 1st exons), an embryonic MHC cDNA and the endogenous poly A sites. bs, binding site. (D-F′′) St16 embryos double-labeled for Tropomyosin (Tm) and MHC. Compared with hoip1/Cyo.lacZ embryos (D), both MHC and Tm are largely undetectable in the somatic and cardiac musculature of hoip1 embryos (E). In hoip1; MHCemb embryos, MHC protein expression is restored to near wild-type levels in somatic but not cardiac muscles; Tm remains largely undetectable in hoip1; MHCemb embryos (F). MHCemb does not rescue somatic muscle morphology defects (arrowheads) or MHC expression in cardioblasts (CBs). The Tm antibody recognizes both Tm1 and Tm2: RNA-seq showed a 0.50 (Tm1) and 0.09 (Tm2) fold change in hoip1 embryos compared with wild type (Table 2). (G,H) St16 embryos co-labeled for MHC mRNA and Hoechst. (G,G′) MHC mRNA shows both nuclear and cytoplasmic localization in the somatic muscle fibers of control embryos. (H,H′) MHC mRNA is exclusively detected in somatic muscle nuclei of hoip1 embryos. High magnification views in G′ and H′ show three segments of ventral oblique (VO) and ventral lateral (VL) muscles. (I) Quantification of MHC expression in the somatic musculature. Mean fluorescent intensity was calculated for lateral muscles over an entire segment (see supplementary material Fig. S7). The number of segments assayed is given for each genotype. Error bars represent s.e.m. Scale bars: 20 μm.

Fig. 5.

Hoip processes transcripts encoding sarcomere components. (A) Functional Gene Ontology (GO) analysis of misregulated transcripts in hoip1 embryos. Clusters of down- and upregulated transcripts are shown in red and green, respectively. The most significant cluster is associated with the term Contractile Fiber. (B) qPCR of Contractile Fiber transcript expression in hoip1 embryos compared with wild type. (C) The MHCemb transgene. The construct contains endogenous, somatic muscle MHC enhancer elements, multiple transcriptional start sites (colored 1st exons), an embryonic MHC cDNA and the endogenous poly A sites. bs, binding site. (D-F′′) St16 embryos double-labeled for Tropomyosin (Tm) and MHC. Compared with hoip1/Cyo.lacZ embryos (D), both MHC and Tm are largely undetectable in the somatic and cardiac musculature of hoip1 embryos (E). In hoip1; MHCemb embryos, MHC protein expression is restored to near wild-type levels in somatic but not cardiac muscles; Tm remains largely undetectable in hoip1; MHCemb embryos (F). MHCemb does not rescue somatic muscle morphology defects (arrowheads) or MHC expression in cardioblasts (CBs). The Tm antibody recognizes both Tm1 and Tm2: RNA-seq showed a 0.50 (Tm1) and 0.09 (Tm2) fold change in hoip1 embryos compared with wild type (Table 2). (G,H) St16 embryos co-labeled for MHC mRNA and Hoechst. (G,G′) MHC mRNA shows both nuclear and cytoplasmic localization in the somatic muscle fibers of control embryos. (H,H′) MHC mRNA is exclusively detected in somatic muscle nuclei of hoip1 embryos. High magnification views in G′ and H′ show three segments of ventral oblique (VO) and ventral lateral (VL) muscles. (I) Quantification of MHC expression in the somatic musculature. Mean fluorescent intensity was calculated for lateral muscles over an entire segment (see supplementary material Fig. S7). The number of segments assayed is given for each genotype. Error bars represent s.e.m. Scale bars: 20 μm.

Table 2.

Contractile fiber mRNA expression

Contractile fiber mRNA expression
Contractile fiber mRNA expression

We examined 22 genes experimentally shown to regulate myotube elongation, attachment site recognition or myotendinous junction formation in our RNA-seq data (supplementary material Table S4). Surprisingly, pav expression was not changed in hoip1 embryos, whereas tum was upregulated (fold change=2.04). However, tum overexpression does not affect myotube elongation (Guerin and Kramer, 2009b). Of the remaining 19 genes, only MSP-300 showed significant downregulation in hoip1 embryos (fold change=0.27). Unlike hoip1 embryos, MSP-300 mutant embryos show only a modest somatic muscle phenotype that initiates late in embryogenesis (Rosenberg-Hasson et al., 1996); however, MSP-300 larvae do show defects in nuclear positioning and microtubule organization (Elhanany-Tamir et al., 2012). The 22 genes regulating somatic muscle morphology also showed normal splicing in hoip1 embryos, further arguing that Hoip regulates the expression of other transcripts to initiate myotube elongation.

Post-transcriptional regulation of MHC

The RNA analyses suggested that Hoip processes pre-mRNAs encoding sarcomeric proteins but does not regulate transcription or rRNA processing. To confirm these results, we performed a functional rescue experiment with the MHCemb transgene (Fig. 5C), which uses the endogenous MHC promoter to express a MHC cDNA specifically in somatic muscle (Hess et al., 2007; Wells et al., 1996). If Hoip regulated either ribosome biogenesis or processing of an mRNA whose protein product activates MHC transcription, then MHCemb would not be expected to rescue MHC protein expression in hoip1 embryos. However, if Hoip acts post-transcriptionally to splice the MHC pre-mRNA, then the MHC cDNA, which is expressed from the MHCemb transgene, would generate a functional mRNA that would be appropriately translated in hoip1 embryos.

Indeed, the MHCemb transgene restored MHC protein expression in somatic but not cardiac muscle of hoip1 embryos (Fig. 5D-F,I; supplementary material Fig. S7). This experiment corroborated our MHC.τGFP expression studies in which the endogenous MHC promoter directed GFP protein expression throughout the somatic mesoderm of hoip1 embryos (Fig. 1C-E). In addition, the MHCemb transgene did not restore somatic muscle morphology in hoip1 embryos, further confirming that Hoip regulates myotube elongation independent of MHC expression. We conclude Hoip is required to perform at least one splice in the MHC pre-mRNA and functions independently of ribosome biogenesis to direct somatic muscle maturation.

MHC mRNA does not translocate out of the nucleus in hoip embryos

Two separate transgenes harboring MHC promoters (MHC.τGFP and MHCemb) were able to direct cDNA expression in hoip1 embryos (Fig. 1C, Fig. 5F). However, MHC mRNA was nearly undetectable in hoip1 embryos by RNA-seq and qPCR (Fig. 5B). We assayed MHC mRNA localization by in situ hybridization and found only punctate, nuclear MHC mRNA localization in hoip1 embryos, even though wild-type embryos showed MHC mRNA localized throughout the myofiber (Fig. 5G,H). These transgenic and in situ results clearly demonstrate that MHC is transcribed in hoip1 embryos but that the transcript fails to translocate out of the nucleus.

Hoip orthologs are essential regulators of myogenesis

The remarkable homology between Hoip and human NHP2L1 (supplementary material Fig. S1I) suggested that the function of Hoip during myogenesis is conserved across species. To test this hypothesis, we expressed human NHP2L1 in founder cells of hoip1 embryos with rp298.gal4 and assayed MHC protein expression. Although human NHP2L1 did not rescue hoip1 embryos as effectively as Drosophila Hoip (Table 1), we observed a significant restoration of myotube elongation and MHC expression in the somatic musculature, demonstrating that Hoip and human NHP2L1 can perform similar functions during myogenesis (Fig. 6A,B).

Fig. 6.

Hoip is a conserved regulator of myogenesis. (A,B) St16 Drosophila embryos labeled for MHC protein. Compared with hoip1 embryos (A), hoip1 rp298>human NHP2L1 embryos show a significant restoration of MHC protein expression and muscle morphology in the somatic mesoderm (B). (C-E) Dorsal views of 14 hpf Tg (α-actin:GFP) zebrafish embryos. Embryos injected with control MO at the one-cell stage express robust GFP in somites (C, white arrowheads). Embryos injected with nhp2l1b ATG-MO (D) or 5′UTR-MO (E) do not initiate GFP expression. ATG-MO and 5′UTR-MO embryos develop a distinguishable neural tube by 14 hpf (black arrowheads). (F-G′) Dorsal view of 14 hpf Tg(α-actin:GFP) zebrafish embryos labeled for GFP and MF20 (which reacts with muscle MyHC isoforms). Embryos injected with control MO show robust GFP and MF20 expression in the somatic mesoderm (F), whereas ATG-MO injected embryos display little or no GFP or MF20 staining (G). (H) Dose-dependent response to nhp2l1b MOs. Percent penetrance was calculated as the number of embryos without detectable GFP fluorescence, relative to all injected embryos. Significance between ATG-MO/5′UTR-MO and Cntrl MO was calculated using a t-test. **P<0.01, ***P<0.001. (I) qPCR of mesoderm transcript expression. Relative expression was calculated as mRNA levels in control versus ATG-MO-injected embryos after normalization to GAPDH. Error bars represent s.e.m.

Fig. 6.

Hoip is a conserved regulator of myogenesis. (A,B) St16 Drosophila embryos labeled for MHC protein. Compared with hoip1 embryos (A), hoip1 rp298>human NHP2L1 embryos show a significant restoration of MHC protein expression and muscle morphology in the somatic mesoderm (B). (C-E) Dorsal views of 14 hpf Tg (α-actin:GFP) zebrafish embryos. Embryos injected with control MO at the one-cell stage express robust GFP in somites (C, white arrowheads). Embryos injected with nhp2l1b ATG-MO (D) or 5′UTR-MO (E) do not initiate GFP expression. ATG-MO and 5′UTR-MO embryos develop a distinguishable neural tube by 14 hpf (black arrowheads). (F-G′) Dorsal view of 14 hpf Tg(α-actin:GFP) zebrafish embryos labeled for GFP and MF20 (which reacts with muscle MyHC isoforms). Embryos injected with control MO show robust GFP and MF20 expression in the somatic mesoderm (F), whereas ATG-MO injected embryos display little or no GFP or MF20 staining (G). (H) Dose-dependent response to nhp2l1b MOs. Percent penetrance was calculated as the number of embryos without detectable GFP fluorescence, relative to all injected embryos. Significance between ATG-MO/5′UTR-MO and Cntrl MO was calculated using a t-test. **P<0.01, ***P<0.001. (I) qPCR of mesoderm transcript expression. Relative expression was calculated as mRNA levels in control versus ATG-MO-injected embryos after normalization to GAPDH. Error bars represent s.e.m.

Zebrafish nhp2l1b is expressed in the paraxial mesoderm at 10 hour post-fertilization (hpf) and throughout the myotome at 19 hpf (Thisse and Thisse, 2001). We asked whether nhp2l1b is essential for zebrafish muscle development using two independent MOs to knockdown endogenous nhp2l1b. One MO targets the nhp2l1b translational start site with 100% identity (ATG-MO), but does not target the highly divergent nhp2l1a (supplementary material Fig. S8A-C). The other MO targets the nhp2l1b 5′UTR 57 bp upstream of the translational start site and shows no sequence similarity to nhp2l1a (supplementary material Fig. S8B). The α-actin:GFP transgenic (Tg) line harbors a skeletal muscle reporter (Higashijima et al., 1997) and Tg(α-actin:GFP) embryos injected with control-MO showed robust GFP expression in the somitic mesoderm by 14 hpf (Fig. 6C). However, both ATG-MO- and 5′UTR-MO-injected embryos showed little or no GFP expression (Fig. 6D,E). The MF20 antibody reacts with all muscle MyHC isoforms, and we observed robust somitic MF20 staining in control-MO but not ATG-MO-injected embryos at 14 hpf (Fig. 6F,G).

Tg(α-actin:GFP) expression showed a dose-dependent response to MO concentrations (Fig. 6H). Sixty-five percent (n=259) of embryos injected with 0.08 ng ATG-MO and 96% (n=233) of embryos injected with 0.8 ng ATG-MO failed to initiate α-actin:GFP expression; 43% (n=58) of embryos injected with 0.08 ng 5′UTR-MO and 72% (n=87) of embryos injected with 0.8 ng 5′UTR-MO failed to initiate α-actin:GFP expression; 11% (n=302) of embryos injected with 0.8 ng Cntrl-MO showed changes in α-actin:GFP expression. With the exception of skeletal muscle marker expression, 0.8 ng ATG-MO-treated embryos appeared normal through 16 hpf; however, MO treatment induced lethality after 16 hpf (supplementary material Fig. S8F,G). The ATG-MO also blocked eGFP translation when the nhp2l1b ATG-MO target site was placed upstream of the eGFP-coding sequence (supplementary material Fig. S8D,E). Thus, the ATG-MO targets nhp2l1b.

By qPCR, we found that several transcripts encoding sarcomeric proteins were present at reduced levels in ATG-MO 14 hpf embryos, including two slow MyHCs, two troponins and one tropomyosin. Importantly, the expression of other genes essential for mesoderm development, such as mef2 and notch1, was unaffected in ATG-MO embryos. Taken together, these results indicate that the function of Hoip is highly conserved and that nhp2l1b regulates myogenesis in vertebrates.

DISCUSSION

The results of this study reveal a specific and essential role for the putative RBP Hoip in the control of embryonic muscle development. hoip is expressed in the striated muscle lineage and regulates two distinct processes: myotube elongation and sarcomeric protein expression. Using functional rescue experiments, we have established that Hoip regulates MHC pre-mRNA splicing but not MHC transcription. The human hoip ortholog human NHP2L1 can rescue myogenesis in hoip mutant embryos, and antisense nhp2l1b knockdown blocks muscle development in zebrafish. This study is the first to identify a tissue-specific function for hoip or its orthologs in vivo and highlights the essential role of post-transcriptional gene regulation during tissue morphogenesis.

Non-coding RNAs that function as ‘core’ spliceosome components can have tissue-specific functions in vivo. For example, the mouse genome encodes multiple U2 snRNA genes and the rnu2-8 U2 snRNA is differentially expressed in the mouse nervous system with peak expression levels in the cerebellum (Jia et al., 2012). Rnu2-8 knockout mice show normal splicing of constitutive exons, but incomplete splicing of alternative exons solely within the cerebellum (Jia et al., 2012), and rnu2-8 U2 snRNA is essential for neuron survival in the cerebellum.

The Hoip orthologs Snu13/NHP2L1 proteins have been characterized as ‘core’ spliceosome components that bind the kink turn motif of U4 snRNAs, U3 snoRNAs and U14 snoRNAs (Schultz et al., 2006). However, we found Hoip expression and function is restricted to the striated muscle lineage within the Drosophila mesoderm. RNA-seq and MHCemb rescue data clearly demonstrate that Hoip is not a global regulator of pre-mRNA splicing or ribosome biogenesis, but acts specifically on a set of RNAs that encode functionally related proteins.

The MHCemb transgene contains a fully spliced MHC cDNA that encodes exons 2-19 (Wells et al., 1996). The 5′ end of the transgene comprises genomic DNA that initiates 450 bp upstream of the first transcriptional start site and terminates in exon 2. This 5′ sequence contains the necessary enhancer and promoter elements for transgene expression in the somatic mesoderm, as well as three alternative transcriptional start sites. The 3′ end of the transgene contains a complete exon 19 with multiple polyadenylation (poly A) sites, but it does not contain an exogenous poly A signal (i.e. SV40). As MHCemb rescues MHC protein expression in hoip embryos, Hoip must not regulate transcriptional start site selection or 5′UTR stability. In addition, the endogenous 3′UTR is sufficient to restore MHC protein expression, indicating that Hoip does not regulate poly A site choice, polyadenylation itself or 3′UTR stability. Hoip therefore acts post-transcriptionally to control at least one splicing event in exons 2-19.

The apparent specificity with which Hoip targets sarcomeric RNAs is striking. One explanation for this specificity is that the Hoip paralog Nhp2 fulfills the spliceosome functions that Hoip does not. A more intriguing hypothesis is that Hoip facilitates ribonucleotide modifications in a subset of transcripts. For example, NHP2L1/snoRNA processomes direct 2′-O methylation of ribosomal pre-RNAs (Watkins et al., 2002) and 2′-O methylation has been reported to enhance pre-mRNA splicing in some contexts (Ge et al., 2010). Perhaps Hoip confers a similar modification to sarcomeric RNAs that is permissive for pre-mRNA splicing; in this model, unmodified pre-mRNAs would not be spliced and would degrade in the nucleus. We envision Hoip-mediated modifications to be a rate-limiting step that ensures proper stoichiometry of sarcomeric proteins.

This study also identified myotube elongation defects in hoip embryos. To our knowledge, this is the first mutation reported that blocks the initiation of myotube elongation (supplementary material Table S4). Accordingly, we failed to identify robust misregulation of genes known to regulate myotube elongation, attachment site recognition or myotendinous junction formation in hoip embryos (supplementary material Table S4). The strength of the hoip phenotype suggests that a suite of proteins is required for myotube elongation. A second possibility is that some sarcomeric proteins could be required for myotube elongation. We have shown that MHC does not regulate elongation; however, tropomyosins regulate actin dynamics outside the sarcomere that influence cell polarity and cell outgrowth in Drosophila (Li and Gao, 2003; Zimyanin et al., 2008).

One known regulator of microtubule dynamics during elongation, Tum, is a Rac family GTPase-activating protein (RacGAP). We searched the RNA-seq data for other Rac/Rho family regulators and identified two RhoGAPs and one Rho guanine nucleotide exchange factor (RhoGEF) that were misregulated in hoip embryos (supplementary material Table S5). We also identified two Rab family GTPases, the function of which in synaptic endosome trafficking has been well established (Gurkan et al., 2005). Rab family members are essential for microtubule-dependent outgrowth of tracheal and bristle cells (Nagaraj and Adler, 2012; Schottenfeld-Roames and Ghabrial, 2012) and the myotube guidance molecule Grip localizes to endosomes at the ends of extending myotubes (Swan et al., 2004). Finally, overexpressing the tendon cell regulator Stripe in the ectoderm upregulates a number of novel genes (Gilsohn and Volk, 2010a; Gilsohn and Volk, 2010b), including the transmembrane protein Tetraspanin 42Ea (Tsp42Ea). Tsp42Ea orthologs function in cell motility and signal transduction, and Tsp42Ea was downregulated in hoip embryos. It will be interesting to determine which of these genes are required for myotube elongation in vivo.

The zebrafish Hoip ortholog nhp2l1b is expressed in the paraxial mesoderm during the 10- to 14-somite stage and in the myotome during the 20- to 25-somite stage (Thisse and Thisse, 2001). Thus, the expression and myogenic function of hoip/nhp2l1b appears to be conserved in vertebrates. Despite being one of the most intensely studied developmental systems, skeletal muscle continues to reveal novel developmental mechanisms. In the future, it will be of particular interest to characterize the interactions between transcriptional and post-transcriptional mechanisms that coordinate final muscle morphology and function.

Acknowledgements

We appreciate Mike Buszczak for insights and discussions throughout this study. We thank Sandy Bernstein, Elizabeth Chen, Richard Cripps and Bruce Paterson for reagents.

Funding

E.N.O. is supported by grants from the National Institutes of Health (NIH) [HL-077439], The American Heart Association (AHA)-Jon Holden DeHaan Foundation [0970518N], Foundation Leducq Networks of Excellence, Cancer Prevention & Research Institute of Texas and the Robert A. Welch Foundation [1-0025]. A.N.J. is supported by a Scientist Development Grant [12SDG12030160] from the AHA. K.D.P. is supported by the NIH [GM074057 and HL081674]. Deposited in PMC for release after 12 months.

Author contributions

Experiments were carried out by A.N.J., M.H.M. and J.M.V. Experimental design, analyses and preparation of the manuscript were carried out by A.N.J., M.H.M., J.M.V., K.D.P. and E.N.O.

References

Barolo
S.
,
Castro
B.
,
Posakony
J. W.
(
2004
).
New Drosophila transgenic reporters: insulated P-element vectors expressing fast-maturing RFP
.
Biotechniques
36
, 436-440, 442.
Bate
M.
(
1990
).
The embryonic development of larval muscles in Drosophila
.
Development
110
,
791
804
.
Bernstein
S. I.
,
Mogami
K.
,
Donady
J. J.
,
Emerson
C. P.
Jr
(
1983
).
Drosophila muscle myosin heavy chain encoded by a single gene in a cluster of muscle mutations
.
Nature
302
,
393
397
.
Biedermann
B.
,
Hotz
H. R.
,
Ciosk
R.
(
2010
).
The Quaking family of RNA-binding proteins: coordinators of the cell cycle and differentiation
.
Cell Cycle
9
,
1929
1933
.
Bloor
J. W.
,
Brown
N. H.
(
1998
).
Genetic analysis of the Drosophila alphaPS2 integrin subunit reveals discrete adhesive, morphogenetic and sarcomeric functions
.
Genetics
148
,
1127
1142
.
Bour
B. A.
,
O’Brien
M. A.
,
Lockwood
W. L.
,
Goldstein
E. S.
,
Bodmer
R.
,
Taghert
P. H.
,
Abmayr
S. M.
,
Nguyen
H. T.
(
1995
).
Drosophila MEF2, a transcription factor that is essential for myogenesis
.
Genes Dev.
9
,
730
741
.
Brown
N. H.
(
1994
).
Null mutations in the alpha PS2 and beta PS integrin subunit genes have distinct phenotypes
.
Development
120
,
1221
1231
.
Brown
N. H.
,
Gregory
S. L.
,
Rickoll
W. L.
,
Fessler
L. I.
,
Prout
M.
,
White
R. A.
,
Fristrom
J. W.
(
2002
).
Talin is essential for integrin function in Drosophila
.
Dev. Cell
3
,
569
579
.
Bunch
T. A.
,
Graner
M. W.
,
Fessler
L. I.
,
Fessler
J. H.
,
Schneider
K. D.
,
Kerschen
A.
,
Choy
L. P.
,
Burgess
B. W.
,
Brower
D. L.
(
1998
).
The PS2 integrin ligand tiggrin is required for proper muscle function in Drosophila
.
Development
125
,
1679
1689
.
Callahan
C. A.
,
Bonkovsky
J. L.
,
Scully
A. L.
,
Thomas
J. B.
(
1996
).
derailed is required for muscle attachment site selection in Drosophila
.
Development
122
,
2761
2767
.
Carmena
A.
,
Bate
M.
,
Jiménez
F.
(
1995
).
Lethal of scute, a proneural gene, participates in the specification of muscle progenitors during Drosophila embryogenesis
.
Genes Dev.
9
,
2373
2383
.
Carrasco-Rando
M.
,
Ruiz-Gómez
M.
(
2008
).
Mind bomb 2, a founder myoblast-specific protein, regulates myoblast fusion and muscle stability
.
Development
135
,
849
857
.
Chanana
B.
,
Graf
R.
,
Koledachkina
T.
,
Pflanz
R.
,
Vorbrüggen
G.
(
2007
).
AlphaPS2 integrin-mediated muscle attachment in Drosophila requires the ECM protein Thrombospondin
.
Mech. Dev.
124
,
463
475
.
Chen
E. H.
,
Olson
E. N.
(
2001
).
Antisocial, an intracellular adaptor protein, is required for myoblast fusion in Drosophila
.
Dev. Cell
1
,
705
715
.
Cléry
A.
,
Senty-Ségault
V.
,
Leclerc
F.
,
Raué
H. A.
,
Branlant
C.
(
2007
).
Analysis of sequence and structural features that identify the B/C motif of U3 small nucleolar RNA as the recognition site for the Snu13p-Rrp9p protein pair
.
Mol. Cell. Biol.
27
,
1191
1206
.
de Joussineau
C.
,
Bataillé
L.
,
Jagla
T.
,
Jagla
K.
(
2012
).
Diversification of muscle types in Drosophila: upstream and downstream of identity genes
.
Curr. Top. Dev. Biol.
98
,
277
301
.
Dennis
G.
Jr
,
Sherman
B. T.
,
Hosack
D. A.
,
Yang
J.
,
Gao
W.
,
Lane
H. C.
,
Lempicki
R. A.
(
2003
).
DAVID: Database for annotation, visualization, and integrated discovery
.
Genome Biol.
4
,
3
.
Dobbyn
H. C.
,
O’Keefe
R. T.
(
2004
).
Analysis of Snu13p mutations reveals differential interactions with the U4 snRNA and U3 snoRNA
.
RNA
10
,
308
320
.
Elhanany-Tamir
H.
,
Yu
Y. V.
,
Shnayder
M.
,
Jain
A.
,
Welte
M.
,
Volk
T.
(
2012
).
Organelle positioning in muscles requires cooperation between two KASH proteins and microtubules
.
J. Cell Biol.
198
,
833
846
.
Estrada
B.
,
Gisselbrecht
S. S.
,
Michelson
A. M.
(
2007
).
The transmembrane protein Perdido interacts with Grip and integrins to mediate myotube projection and attachment in the Drosophila embryo
.
Development
134
,
4469
4478
.
Folker
E. S.
,
Schulman
V. K.
,
Baylies
M. K.
(
2012
).
Muscle length and myonuclear position are independently regulated by distinct Dynein pathways
.
Development
139
,
3827
3837
.
Frommer
G.
,
Vorbrüggen
G.
,
Pasca
G.
,
Jäckle
H.
,
Volk
T.
(
1996
).
Epidermal egr-like zinc finger protein of Drosophila participates in myotube guidance
.
EMBO J.
15
,
1642
1649
.
Ge
J.
,
Liu
H.
,
Yu
Y. T.
(
2010
).
Regulation of pre-mRNA splicing in Xenopus oocytes by targeted 2′-O-methylation
.
RNA
16
,
1078
1085
.
Gilsohn
E.
,
Volk
T.
(
2010a
).
Slowdown promotes muscle integrity by modulating integrin-mediated adhesion at the myotendinous junction
.
Development
137
,
785
794
.
Gilsohn
E.
,
Volk
T.
(
2010b
).
A screen for tendon-specific genes uncovers new and old components involved in muscle-tendon interaction
.
Fly (Austin)
4
,
149
153
.
Guerin
C. M.
,
Kramer
S. G.
(
2009a
).
Cytoskeletal remodeling during myotube assembly and guidance: coordinating the actin and microtubule networks
.
Commun. Integr. Biol.
2
,
452
457
.
Guerin
C. M.
,
Kramer
S. G.
(
2009b
).
RacGAP50C directs perinuclear gamma-tubulin localization to organize the uniform microtubule array required for Drosophila myotube extension
.
Development
136
,
1411
1421
.
Gurkan
C.
,
Lapp
H.
,
Alory
C.
,
Su
A. I.
,
Hogenesch
J. B.
,
Balch
W. E.
(
2005
).
Large-scale profiling of Rab GTPase trafficking networks: the membrome
.
Mol. Biol. Cell
16
,
3847
3864
.
Hess
N. K.
,
Singer
P. A.
,
Trinh
K.
,
Nikkhoy
M.
,
Bernstein
S. I.
(
2007
).
Transcriptional regulation of the Drosophila melanogaster muscle myosin heavy-chain gene
.
Gene Expr. Patterns
7
,
413
422
.
Higashijima
S.
,
Okamoto
H.
,
Ueno
N.
,
Hotta
Y.
,
Eguchi
G.
(
1997
).
High-frequency generation of transgenic zebrafish which reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin
.
Dev. Biol.
192
,
289
299
.
Jagla
T.
,
Bellard
F.
,
Lutz
Y.
,
Dretzen
G.
,
Bellard
M.
,
Jagla
K.
(
1998
).
ladybird determines cell fate decisions during diversification of Drosophila somatic muscles
.
Development
125
,
3699
3708
.
Jia
Y.
,
Mu
J. C.
,
Ackerman
S. L.
(
2012
).
Mutation of a U2 snRNA gene causes global disruption of alternative splicing and neurodegeneration
.
Cell
148
,
296
308
.
Johnson
A. N.
,
Burnett
L. A.
,
Sellin
J.
,
Paululat
A.
,
Newfeld
S. J.
(
2007
).
Defective decapentaplegic signaling results in heart overgrowth and reduced cardiac output in Drosophila
.
Genetics
176
,
1609
1624
.
Johnson
A. N.
,
Mokalled
M. H.
,
Haden
T. N.
,
Olson
E. N.
(
2011
).
JAK/Stat signaling regulates heart precursor diversification in Drosophila
.
Development
138
,
4627
4638
.
Kania
A.
,
Salzberg
A.
,
Bhat
M.
,
D’Evelyn
D.
,
He
Y.
,
Kiss
I.
,
Bellen
H. J.
(
1995
).
P-element mutations affecting embryonic peripheral nervous system development in Drosophila melanogaster
.
Genetics
139
,
1663
1678
.
Kiehart
D. P.
,
Feghali
R.
(
1986
).
Cytoplasmic myosin from Drosophila melanogaster
.
J. Cell Biol.
103
,
1517
1525
.
Kosman
D.
,
Small
S.
,
Reinitz
J.
(
1998
).
Rapid preparation of a panel of polyclonal antibodies to Drosophila segmentation proteins
.
Dev. Genes Evol.
208
,
290
294
.
Kramer
S. G.
,
Kidd
T.
,
Simpson
J. H.
,
Goodman
C. S.
(
2001
).
Switching repulsion to attraction: changing responses to slit during transition in mesoderm migration
.
Science
292
,
737
740
.
Kronert
W. A.
,
O’Donnell
P. T.
,
Bernstein
S. I.
(
1994
).
A charge change in an evolutionarily-conserved region of the myosin globular head prevents myosin and thick filament accumulation in Drosophila
.
J. Mol. Biol.
236
,
697
702
.
Li
W.
,
Gao
F. B.
(
2003
).
Actin filament-stabilizing protein tropomyosin regulates the size of dendritic fields
.
J. Neurosci.
23
,
6171
6175
.
Lilly
B.
,
Zhao
B.
,
Ranganayakulu
G.
,
Paterson
B. M.
,
Schulz
R. A.
,
Olson
E. N.
(
1995
).
Requirement of MADS domain transcription factor D-MEF2 for muscle formation in Drosophila
.
Science
267
,
688
693
.
Martin-Bermudo
M. D.
,
Brown
N. H.
(
2000
).
The localized assembly of extracellular matrix integrin ligands requires cell-cell contact
.
J. Cell Sci.
113
,
3715
3723
.
Mokalled
M. H.
,
Johnson
A.
,
Kim
Y.
,
Oh
J.
,
Olson
E. N.
(
2010
).
Myocardin-related transcription factors regulate the Cdk5/Pctaire1 kinase cascade to control neurite outgrowth, neuronal migration and brain development
.
Development
137
,
2365
2374
.
Nagaraj
R.
,
Adler
P. N.
(
2012
).
Dusky-like functions as a Rab11 effector for the deposition of cuticle during Drosophila bristle development
.
Development
139
,
906
916
.
Nose
A.
,
Isshiki
T.
,
Takeichi
M.
(
1998
).
Regional specification of muscle progenitors in Drosophila: the role of the msh homeobox gene
.
Development
125
,
215
223
.
Nottrott
S.
,
Hartmuth
K.
,
Fabrizio
P.
,
Urlaub
H.
,
Vidovic
I.
,
Ficner
R.
,
Lührmann
R.
(
1999
).
Functional interaction of a novel 15.5kD [U4/U6.U5] tri-snRNP protein with the 5′ stem-loop of U4 snRNA
.
EMBO J.
18
,
6119
6133
.
Prokopenko
S. N.
,
He
Y.
,
Lu
Y.
,
Bellen
H. J.
(
2000
).
Mutations affecting the development of the peripheral nervous system in Drosophila: a molecular screen for novel proteins
.
Genetics
156
,
1691
1715
.
Reim
I.
,
Mohler
J. P.
,
Frasch
M.
(
2005
).
Tbx20-related genes, mid and H15, are required for tinman expression, proper patterning, and normal differentiation of cardioblasts in Drosophila
.
Mech. Dev.
122
,
1056
1069
.
Robinson
J. T.
,
Thorvaldsdóttir
H.
,
Winckler
W.
,
Guttman
M.
,
Lander
E. S.
,
Getz
G.
,
Mesirov
J. P.
(
2011
).
Integrative genomics viewer
.
Nat. Biotechnol.
29
,
24
26
.
Rosenberg-Hasson
Y.
,
Renert-Pasca
M.
,
Volk
T.
(
1996
).
A Drosophila dystrophin-related protein, MSP-300, is required for embryonic muscle morphogenesis
.
Mech. Dev.
60
,
83
94
.
Rui
Y.
,
Bai
J.
,
Perrimon
N.
(
2010
).
Sarcomere formation occurs by the assembly of multiple latent protein complexes
.
PLoS Genet.
6
,
e1001208
.
Schejter
E. D.
,
Baylies
M. K.
(
2010
).
Born to run: creating the muscle fiber
.
Curr. Opin. Cell Biol.
22
,
566
574
.
Schnorrer
F.
,
Dickson
B. J.
(
2004
).
Muscle building; mechanisms of myotube guidance and attachment site selection
.
Dev. Cell
7
,
9
20
.
Schnorrer
F.
,
Kalchhauser
I.
,
Dickson
B. J.
(
2007
).
The transmembrane protein Kon-tiki couples to Dgrip to mediate myotube targeting in Drosophila
.
Dev. Cell
12
,
751
766
.
Schottenfeld-Roames
J.
,
Ghabrial
A. S.
(
2012
).
Whacked and Rab35 polarize dynein-motor-complex-dependent seamless tube growth
.
Nat. Cell Biol.
14
,
386
393
.
Schultz
A.
,
Nottrott
S.
,
Watkins
N. J.
,
Lührmann
R.
(
2006
).
Protein-protein and protein-RNA contacts both contribute to the 15.5K-mediated assembly of the U4/U6 snRNP and the box C/D snoRNPs
.
Mol. Cell. Biol.
26
,
5146
5154
.
Small
E. M.
,
Warkman
A. S.
,
Wang
D. Z.
,
Sutherland
L. B.
,
Olson
E. N.
,
Krieg
P. A.
(
2005
).
Myocardin is sufficient and necessary for cardiac gene expression in Xenopus
.
Development
132
,
987
997
.
Steigemann
P.
,
Molitor
A.
,
Fellert
S.
,
Jäckle
H.
,
Vorbrüggen
G.
(
2004
).
Heparan sulfate proteoglycan syndecan promotes axonal and myotube guidance by slit/robo signaling
.
Curr. Biol.
14
,
225
230
.
Subramanian
A.
,
Wayburn
B.
,
Bunch
T.
,
Volk
T.
(
2007
).
Thrombospondin-mediated adhesion is essential for the formation of the myotendinous junction in Drosophila
.
Development
134
,
1269
1278
.
Swan
L. E.
,
Wichmann
C.
,
Prange
U.
,
Schmid
A.
,
Schmidt
M.
,
Schwarz
T.
,
Ponimaskin
E.
,
Madeo
F.
,
Vorbrüggen
G.
,
Sigrist
S. J.
(
2004
).
A glutamate receptor-interacting protein homolog organizes muscle guidance in Drosophila
.
Genes Dev.
18
,
223
237
.
Swan
L. E.
,
Schmidt
M.
,
Schwarz
T.
,
Ponimaskin
E.
,
Prange
U.
,
Boeckers
T.
,
Thomas
U.
,
Sigrist
S. J.
(
2006
).
Complex interaction of Drosophila GRIP PDZ domains and Echinoid during muscle morphogenesis
.
EMBO J.
25
,
3640
3651
.
Thisse
B.
,
Thisse
C.
(
2001
).
Fast Release Clones: A High Throughput Expression Analysis. ZFIN Direct Data Submission
. http://zfin.org
Toledano-Katchalski
H.
,
Nir
R.
,
Volohonsky
G.
,
Volk
T.
(
2007
).
Post-transcriptional repression of the Drosophila midkine and pleiotrophin homolog miple by HOW is essential for correct mesoderm spreading
.
Development
134
,
3473
3481
.
Trapnell
C.
,
Williams
B. A.
,
Pertea
G.
,
Mortazavi
A.
,
Kwan
G.
,
van Baren
M. J.
,
Salzberg
S. L.
,
Wold
B. J.
,
Pachter
L.
(
2010
).
Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation
.
Nat. Biotechnol.
28
,
511
515
.
Venkatesh
T. V.
,
Park
M.
,
Ocorr
K.
,
Nemaceck
J.
,
Golden
K.
,
Wemple
M.
,
Bodmer
R.
(
2000
).
Cardiac enhancer activity of the homeobox gene tinman depends on CREB consensus binding sites in Drosophila
.
Genesis
26
,
55
66
.
Vidovic
I.
,
Nottrott
S.
,
Hartmuth
K.
,
Lührmann
R.
,
Ficner
R.
(
2000
).
Crystal structure of the spliceosomal 15.5kD protein bound to a U4 snRNA fragment
.
Mol. Cell
6
,
1331
1342
.
Watkins
N. J.
,
Dickmanns
A.
,
Lührmann
R.
(
2002
).
Conserved stem II of the box C/D motif is essential for nucleolar localization and is required, along with the 15.5K protein, for the hierarchical assembly of the box C/D snoRNP
.
Mol. Cell. Biol.
22
,
8342
8352
.
Wayburn
B.
,
Volk
T.
(
2009
).
LRT, a tendon-specific leucine-rich repeat protein, promotes muscle-tendon targeting through its interaction with Robo
.
Development
136
,
3607
3615
.
Wei
Q.
,
Rong
Y.
,
Paterson
B. M.
(
2007
).
Stereotypic founder cell patterning and embryonic muscle formation in Drosophila require nautilus (MyoD) gene function
.
Proc. Natl. Acad. Sci. USA
104
,
5461
5466
.
Wells
L.
,
Edwards
K. A.
,
Bernstein
S. I.
(
1996
).
Myosin heavy chain isoforms regulate muscle function but not myofibril assembly
.
EMBO J.
15
,
4454
4459
.
Yarnitzky
T.
,
Min
L.
,
Volk
T.
(
1998
).
An interplay between two EGF-receptor ligands, Vein and Spitz, is required for the formation of a subset of muscle precursors in Drosophila
.
Mech. Dev.
79
,
73
82
.
Zhai
R. G.
,
Hiesinger
P. R.
,
Koh
T. W.
,
Verstreken
P.
,
Schulze
K. L.
,
Cao
Y.
,
Jafar-Nejad
H.
,
Norga
K. K.
,
Pan
H.
,
Bayat
V.
, et al. 
. (
2003
).
Mapping Drosophila mutations with molecularly defined P element insertions
.
Proc. Natl. Acad. Sci. USA
100
,
10860
10865
.
Zhang
S.
,
Bernstein
S. I.
(
2001
).
Spatially and temporally regulated expression of myosin heavy chain alternative exons during Drosophila embryogenesis
.
Mech. Dev.
101
,
35
45
.
Zimyanin
V. L.
,
Belaya
K.
,
Pecreaux
J.
,
Gilchrist
M. J.
,
Clark
A.
,
Davis
I.
,
St Johnston
D.
(
2008
).
In vivo imaging of oskar mRNA transport reveals the mechanism of posterior localization
.
Cell
134
,
843
853
.

Competing interests statement

The authors declare no competing financial interests.

Supplementary information