The differentiation of the blood-brain barrier (BBB) is an essential process in the development of a complex nervous system and depends on alternative splicing. In the fly BBB, glial cells establish intensive septate junctions that require the cell-adhesion molecule Neurexin IV. Alternative splicing generates two different Neurexin IV isoforms: Neurexin IVexon3, which is found in cells that form septate junctions, and Neurexin IVexon4, which is found in neurons that form no septate junctions. Here, we show that the formation of the BBB depends on the RNA-binding protein HOW (Held out wings), which triggers glial specific splicing of Neurexin IVexon3. Using a set of splice reporters, we show that one HOW-binding site is needed to include one of the two mutually exclusive exons 3 and 4, whereas binding at the three further motifs is needed to exclude exon 4. The differential splicing is controlled by nuclear access of HOW and can be induced in neurons following expression of nuclear HOW. Using a novel in vivo two-color splicing detector, we then screened for genes required for full HOW activity. This approach identified Cyclin-dependent kinase 12 (Cdk12) and the splicesosomal component Prp40 as major determinants in regulating HOW-dependent splicing of Neurexin IV. Thus, in addition to the control of nuclear localization of HOW, the phosphorylation of the C-terminal domain of the RNA polymerase II by Cdk12 provides an elegant mechanism in regulating timed splicing of newly synthesized mRNA molecules.

INTRODUCTION

The regulation of gene expression is central to all aspects of development. This is particularly obvious when we consider that the number of genes present in the genome of C. elegans, Drosophila or human is surprisingly similar. The complexity of gene expression, however, dramatically increases due to differential splicing (Black, 2003; Keren et al., 2010; Li et al., 2007; Matlin et al., 2005). About 95% of all human pre-mRNAs are subject to alternative splicing, of which 4.3% carry mutually exclusive spliced exons (Koscielny et al., 2009; Pan et al., 2008; Wang et al., 2008). In Drosophila, roughly 88% of all genes are subject to splicing and 60.7% of these genes are subject to alternative splicing (Graveley et al., 2011).

Differential splicing is not only required for neuronal lineages but is also needed for the development of glial cells (Edenfeld et al., 2006; Wu et al., 2002). Drosophila glia arise during embryogenesis through the activity of the master regulatory gene glial cells missing (Jones, 2005; Soustelle and Giangrande, 2007). Once specified, two glial cell types can be recognized at the lateral boundary of the nervous system (Awasaki et al., 2008; Edwards and Meinertzhagen, 2010; Hartenstein, 2011; Pereanu et al., 2005; Stork et al., 2008). The outermost layer of the nervous system is formed by the perineurial glial cells, which participate in the formation of the blood-brain barrier (BBB) but interestingly lack any contact with neurons. Abutting the perineurial glia basally are the subperineurial glial cells. They establish the physical barrier that prevents paracellular leakage of small solutes into the nervous system. To perform this task, the subperineurial glia establish specialized cell-cell junctions called pleated septate junctions (pSJ) (Schwabe et al., 2005; Stork et al., 2008; Tepass and Hartenstein, 1994). In recent years a surprisingly high number of membrane proteins have been found to be expressed in pSJ (Laprise et al., 2009; Laprise et al., 2010; Wu and Beitel, 2004). In most cases, the deletion of one of these proteins results in the breakdown of the entire pSJ structure and, thus, in a defective BBB (Banerjee et al., 2006; Baumgartner et al., 1996; Faivre-Sarrailh et al., 2004; Stork et al., 2008; Syed et al., 2011). The first protein identified as being required for the integrity of the BBB is Neurexin IV (Nrx-IV) (Baumgartner et al., 1996).

Nrx-IV is an evolutionary conserved protein that is also found in the vertebrate nervous system, where it is called Caspr (contactin-associated protein) (Peles et al., 1997a; Peles et al., 1997b). Caspr localizes to the paranodes that morphologically resemble the pSJ of Drosophila (Einheber et al., 1997; Rios et al., 2003). However, Drosophila pSJ are established between glial cells, whereas in the vertebrate nervous system septate-like junctions are formed between axons and the myelin-forming glial cells (Banerjee and Bhat, 2007).

We have previously identified mutations in the gene crooked neck (crn), which severely affects expression of Nrx-IV (Edenfeld et al., 2006). Crn is a well-conserved splicing factor that mediates spliceosome assembly by binding to the U1 snRNP protein Prp40 and the U2 snRNP auxiliary factor 65 (U2AF65) (Chung et al., 1999; Raisin-Tani and Leopold, 2002; Wang et al., 2003). Drosophila Crn interacts with one of the isoforms encoded by the held out wings (how) gene (Edenfeld et al., 2006). Three different HOW isoforms are generated that all share a KH RNA-binding domain and differ in their C-terminal tails. The short isoform, HOW(S), binds Crn in the cytoplasm and is able to shuttle to the nucleus. The long isoform, HOW(L), is only found in the nucleus and cannot bind Crn (Edenfeld et al., 2006; Volk et al., 2008). The middle form is predicted by FlyBase and is currently not further analyzed. Drosophila how mutants have altered glial differentiation and the HOW protein is able to bind Nrx-IV mRNA (Edenfeld et al., 2006). Mice that are mutant for the how homologue called quaking (Qk – Mouse Genome Informatics) develop severe demyelinization phenotypes resembling the Drosophila glial differentiation phenotypes shown by crn and how mutants (Ebersole et al., 1996; Edenfeld et al., 2006; Sidman et al., 1964; Wu et al., 2002; Zhao et al., 2010).

Quaking/HOW proteins are members of the STAR (signal transduction and activation of RNA) family of RNA-binding proteins implicated in the control of pre-mRNA splicing, mRNA stability and mRNA transport (Artzt and Wu, 2010; Edenfeld et al., 2006; Larocque et al., 2002; Vernet and Artzt, 1997; Volk, 2010; Zhao et al., 2010). STAR proteins, which are often regulated by post-translational mechanisms, bind to a short sequence motif in pre-mRNA molecules, which is similar to the recognition site for splice factor 1 (Artzt and Wu, 2010; Galarneau and Richard, 2005; Israeli et al., 2007; Matter et al., 2002; Ryder et al., 2004; Vernet and Artzt, 1997). In a microarray study, such a potential STAR protein-binding site was found enriched near the 5′ splice site of tissue specifically expressed exons (Sugnet et al., 2006).

In Drosophila, the Nrx-IV gene encodes two equally sized mutually exclusively spliced exons, of which one is flanked by HOW-binding sites. These exons encode two related Discoidin domains and their mutually exclusive splicing results in cell adhesion proteins with altered binding capabilities involved in different aspects of neuron-glia interaction (Edenfeld et al., 2006; Stork et al., 2009). The exon 4-containing Nrx-IV mRNA is expressed mainly in neurons. It generates a protein that interacts with the Ig-domain protein Wrapper, which is expressed by the midline glial cells. By contrast, we show here that the exon 3-containing Nrx-IV mRNA is expressed by cells that form pSJ.

Here, we have analyzed the role of HOW and its influence on differential splicing during glial maturation. We show that HOW is required for the establishment of the BBB and directly affects the splicing of Nrx-IV pre-mRNA. To further dissect the function of HOW, we generated several splicing reporters and assayed the relevance of individual HOW response elements. During mutually exclusive splicing, HOW is required for inclusion of exon3 and, thus, the presence of HOW is associated with the formation of the pleated septate junctions in glial cells. To link the activity of HOW to the general control of glial maturation, we performed a genetic screen and identified Raf kinase, Cyclin-dependent kinase 12 (Cdk12) and Prp40 as important regulators required for full activity of HOW.

MATERIALS AND METHODS

Fly work

All crosses were performed on standard food. The following genotypes were used: Nrx-IV4304 (Baumgartner et al., 1996), howstru (Nabel-Rosen et al., 1999), how(L)f06788 (Exelixis), repoGal4(II) (Lee and Jones, 2005), repoGal4(III) (Sepp and Auld, 1999), elavc155Gal4, elavGal4(III) (Lin et al., 1995), how24BGal4 (Brand and Perrimon, 1993), UAS-EGFRDN (B.-Z. Shilo, Weizmann Institute of Science, Rehovot, Israel), UAS-howRNAi, UAS-crnRNAi, UAS-Cdk12RNAi (VDRC), UAS-hPABPFlag, UAS-rafDN, UAS::lamEGFP, GFP-balancers (Bloomington) and UAS-prp40TriP-RNAi (Ni et al., 2011). Germ line transformation was carried out as described previously (Bischof et al., 2007).

Dextran injections

Stage 17 embryos were injected as described previously (Stork et al., 2008).

Tissue fixation and histological analysis

Immunohistochemical methods were performed as described before (Stork et al., 2009). All fluorescent samples were recorded on a LSM 710 confocal microscope (Zeiss). Fluorescent measurements were carried out using ImageJ (http://imagej.nih.gov/ij/index.html).

Antibodies

The following antibodies were used: anti-EGFP (Invitrogen); anti-mCherry (Clontech); anti-repo (DSHB, B. Altenhein, University of Mainz, Germany); anti-dCdk12 (A. Greenleaf, Duke University, Durham, NC, USA); and anti-HRP-Cy5 (Molecular Probes). Alexa Fluor dyes 488, 568 and 633 were used (Molecular Probes).

Isolation of RNA

Total RNA was isolated using TRIzol (Invitrogen) according to the manufacturer’s instructions. Tissue-specific mRNA was isolated from embryos expressing human poly(A)binding protein in either glial cells or neurons (Yang et al., 2005).

RT-PCR

Total RNA (1 μg) or 100 ng of tissue-specific mRNA extracts were used for reverse-transcribed PCR using SUPERscript II polymerase with Oligo(dT)12-18 primers (Invitrogen) following the manufacturer’s protocol.

PCR and restrictions

The used primer combinations were partially designed with Primer3 (Untergasser et al., 2007) and standard PCR was performed using Taq DNA polymerase (NEB). Restrictions were carried out according to the manufacturer’s instructions (Roche).

Neurexin IV detection

NrxIVSplice2for::CGCCTTCACGGACTATTTCT

NrxIVSplice7rev::CCTTAAGCTGCAGGGCATAG

Reporter cloning

nrxIV_2-5_for::caccCGCCTTCAtgGACTATTTCT

nrxIV_2-5_rev::GTAATCGCAGCCGTAGAGCTCCAC

mCherry_3.0_Nco_for::catgccatgggaGGAGGAGGAATGGTGAGCAAGGGCGAGGAGGATAAC

mCherry_3.0_Nco_rev::catgccatggcCTACTTGTACAGCTCGTCCATGC

EGFP_3.0_xba_for::ctagTctagacGGAGGAGGAATGGTGAGCAAGGGCGAGGAGCTGT

EGFP_3.0_spe_rev::ggactagtCTACTTGTACAGCTCGTCCATGC

Reporter detection

GFPrev2::AACTTGTGGCCGTTTACGT

Generation of constructs

UAS-HOW(S)-3HA and UAS-HOW(L)-3HA were generated using Gateway cloning in a custom-made pUASTattB_rfA_3HA vector. Wild-type DNA spanning Nrx-IV exons 2-5 was amplified with proofreading Phusion polymerase (Finnzymes). An artificial engineered ATG was included to ensure translation and the fragment was inserted into the expression vector pUASTattB_rfA_EGFP (R. Stephan, unpublished), containing a C-terminal EGFP-tag resulting in the reporter nrxIV_2.0.

Site-directed mutagenesis was carried out to eliminate a NcoI restriction site located in the intron 5′ of exon 3. For nrxIV_3.0, EGFP was inserted into the XbaI restriction site of exon3 and mCherry was inserted into the NcoI restriction site of exon 4. All constructs were integrated into the landing sites zh-68E and zh-86FbRFP- (Bischof et al., 2007).

Site-directed mutagenesis (SDM)

To generate base pair changes, QuikChange II XL Site-Directed Mutagenesis Kit was used according to the manufacturer’s instructions (Agilent Technologies/Stratagene). The primers for SDM were partially designed using QuikChange Primer Design Program (Agilent Technologies/Stratagene).

Δ3 HRE

Δ3HRE_Alw44I_for::GCGAGCCGCAGGTACTGTGCaCGGCTTAAAGGATGGCGATG Δ3HRE_Alw44I_rev::CATCGCCATCCTTTAAGCCGtGCACAGTACCTGCGGCTCGC

Mutation HRE1

sh_HRE1_for::ccacactctgacactgcgTAAACctagattggtaaatgcaccttgtgc

sh_HRE1_rev::gcacaaggtgcatttaccaatctagGTTTAcgcagtgtcagagtgtgg

Mutation HRE2

sh_HRE2_for::GCCGCAGGTACTGTGtaaacTCCTAGAACTAAGACTAC

sh_HRE2_rev::GTAGTCTTAGTTCTAGGAgtttaCACAGTACCTGCGGC

Mutation HRE3

sh_HRE3_for::CGCAGGTACTGTGACTAATCCTAGAtaaacGACTACACTTAAAAC

sh_HRE3_rev::GTTTTAAGTGTAGTCgtttaTCTAGGATTAGTCACAGTACCTGCG

Mutation HRE2+3

sh_HRE2+3_for::GGTACTGTGtaaacTCCTAGAtaaacGACTACACTTAAAACAC

sh_HRE2+3_rev::GTGTTTTAAGTGTAGTCgtttaTCTAGGAgtttaCACAGTACC

Mutation HRE4

sh_HRE4_for::CTACACTTAAAACACAtaaacTCCCGGCTTAAAGGATGGC

sh_HRE4_rev::GCCATCCTTTAAGCCGGGAgtttaTGTGTTTTAAGTGTAG

Elimination NcoI in intron2 of nrxIV_2.0

nrxIV_2.0c1930a2_for::cgttgccacgaccaacAcatggacaattggcat

nrxIV_2.0c1930a2_rev::atgccaattgtccatgTgttggtcgtggcaacg

S2 cell culture

Drosophila S2 cells were grown and transfected as published previously (Bogdan et al., 2005). Generally, transfection efficiencies of ∼30% were obtained. Cells were co-transfected with UAS-based constructs and act::Gal4 DNA, and kept for 2 days at 25°C.

RESULTS

HOW and Nrx-IV are essential for BBB function

Loss of Nrx-IV, which encodes a central component of pleated septate junctions, results in a leaky BBB (Fig. 1A,B). Nrx-IV encodes two mRNAs with mutually exclusive use of either exon 3 or exon 4 (Nrx-IVexon3 and Nrx-IVexon4) (Fig. 2A). The differentially spliced exons encode distinct N-terminal Discodin domains that provide differential adhesive properties (Stork et al., 2009). In glia, expression of Nrx-IVexon3 predominates, whereas in neurons expression of Nrx-IVexon4 is enriched. Restriction of Nrx-IVexon3-containing cDNA products with XbaI generates 359 and 271 bp fragments,whereas restriction of Nrx-IVexon4-containing cDNA products with NcoI generates 423 and 207 bp fragments (Fig. 2A,C).

Fig. 1.

how mutants exhibit a blood-brain barrier (BBB) defect. Analysis of BBB defects by injection of fluorescently labeled 10 kDa dextran into the hemolymph of stage 17 embryos. (A-D) Single confocal sections through the CNS of injected embryos (CNS indicated by white dotted line). Pictures were taken 15 minutes after injection with identical laser settings. (A) Wild-type (w1118) embryos show no penetration of the dye into the CNS. (B) nrx4304 mutants lack a functional BBB. The dye penetrates into the CNS. (C,D) howstru mutants show penetration of dye into the CNS (C), whereas, in how(L)f06788 mutants, no dye penetrates into the CNS (D). (E) Isoform-specific rescue of the howstru BBB phenotype. The uptake of labeled 10 kDa dextran into the CNS of individual embryos was monitored over 60 minutes. The mean fluorescence was determined in confocal z-stacks through the entire CNS. All experiments were performed on the same day, using identical conditions. The color coding indicates the different genotypes. In w1118 embryos (purple), no uptake of the dye can be seen. In mutant howstru repoGal4 embryos, (blue) the BBB is disrupted. Panglial expression of HOW(S) (green) results in slightly better rescue of the BBB integrity when compared with HOW(L) expression (brown).

Fig. 1.

how mutants exhibit a blood-brain barrier (BBB) defect. Analysis of BBB defects by injection of fluorescently labeled 10 kDa dextran into the hemolymph of stage 17 embryos. (A-D) Single confocal sections through the CNS of injected embryos (CNS indicated by white dotted line). Pictures were taken 15 minutes after injection with identical laser settings. (A) Wild-type (w1118) embryos show no penetration of the dye into the CNS. (B) nrx4304 mutants lack a functional BBB. The dye penetrates into the CNS. (C,D) howstru mutants show penetration of dye into the CNS (C), whereas, in how(L)f06788 mutants, no dye penetrates into the CNS (D). (E) Isoform-specific rescue of the howstru BBB phenotype. The uptake of labeled 10 kDa dextran into the CNS of individual embryos was monitored over 60 minutes. The mean fluorescence was determined in confocal z-stacks through the entire CNS. All experiments were performed on the same day, using identical conditions. The color coding indicates the different genotypes. In w1118 embryos (purple), no uptake of the dye can be seen. In mutant howstru repoGal4 embryos, (blue) the BBB is disrupted. Panglial expression of HOW(S) (green) results in slightly better rescue of the BBB integrity when compared with HOW(L) expression (brown).

To test whether the mRNA-binding protein Held out wings (HOW) is required for the integrity of the BBB, we performed dye injection experiments. Loss of zygotic how expression (howstru) compromises BBB function and 10 kDa fluorescent dextran penetrates into the CNS (Fig. 1A,C). However, the leakage is not as pronounced as that observed in Nrx-IV mutants, which lack all septate junctions (Baumgartner et al., 1996; Stork et al., 2008) (Fig. 1B). The how locus encodes at least three different isoforms that differ in a short C-terminal domain and share an identical RNA-binding domain. In the allele howf06788, a transposon insertion occurred in the exon specific to the HOW(L) isoform (supplementary material Fig. S1). Homozygous howf06788 animals are lethal but have no open BBB phenotype (Fig. 1A,D). Thus, HOW(L) might not be required for BBB function or HOW(S) may in part compensate for HOW(L). To further test the role of the different HOW proteins in BBB formation, we performed rescue experiments. Upon pan-glial expression of HA-tagged HOW(S) or HOW(L), the BBB was partially restored (Fig. 1E). Generally, expression of HOW(S) resulted in a stronger rescue. The transgenes were integrated in the same landing site using the phiC31 technique (Bischof et al., 2007), and thus the differential effects of HOW(S) and HOW(L) are not expected to be due to different expression levels. In conclusion, both HOW isoforms appear to be required for BBB formation.

how mutants show abnormal splicing of Nrx-IV

In the next step, we characterized the Nrx-IV splicing pattern of how mutant embryos. Total mRNA from stage 16 embryos was reverse transcribed. Subsequently, PCR reactions with primers spanning the alternatively spliced region were performed (Fig. 2A, arrows). To discriminate between exon 3- and exon 4-containing isoforms, we used endogenous restriction sites (XbaI in exon3 and NcoI in exon4) (Fig. 2A). Nrx-IVexon3 containing cDNAs generate 359 and 271 bp fragments, whereas restriction of Nrx-IVexon4-containing cDNAs generates 423 and 207 bp fragments. howstru mutants show a different distribution of the Nrx-IV isoforms compared with the wild-type splicing pattern, having more Nrx-IVexon4 (Fig. 2B). To quantify the levels of the different splicing forms, we measured the intensity of the exon-specific DNA fragments (highlighted by red and green dots in Fig. 2B). In wild type, the exon4/exon3 ratio is 0.66 (±0.15 s.d.; quantification of DNA bands of five independent experiments), in howstru mutants the ratio is 0.94 (±0.02) (Fig. 2B, n=6 independent experiments). Interestingly, howf06788 mutants also show a preferential splicing of Nrx-IVexon4, although not as prominent as in the loss-of-function mutant howstru (ratio is 0.86±0.05, n=6 independent experiments; Fig. 2B). This indicates that glial cells express both HOW(S) and HOW(L). It also demonstrates that HOW(L) is needed for Nrx-IV splicing, but Nrx-IV levels are still high enough to provide a functional BBB (Fig. 1D). Moreover, as the HOW null allele howstru has a more severe splicing phenotype, we assume that HOW(S) is also involved in Nrx-IV splicing.

Fig. 2.

Detection of tissue-specific splicing with Nrx-IV splicing reporters. (A) The Nrx-IV locus encodes 13 exons (gray boxes), of which exon 3 (green framed box and lines) and exon 4 (red framed box and lines) show mutually exclusively splicing. The exons contain unique endogenous restriction sites (XbaI and NcoI). HOW response elements (HREs) are indicated by red dots. The orientation and position of primers used for splicing analysis are indicated (arrows). (B) Analysis of Nrx-IV splicing in howstru and howf06788 mutant embryos. w1118 flies are used as a wild-type control. Restriction analysis (NcoI/XbaI) of the Nrx-IV-specific PCR product shows a stereotypic splicing pattern. DNA fragments of 359 and 271 bp correspond to the Nrx-IVexon3 mRNA, fragments of 423 and 207 bp correspond to the Nrx-IVexon4 transcripts. The faint 630 bp band corresponds to traces of undigested DNA. In wild type, high levels of Nrx-IVexon3 and low levels of Nrx-IVexon4 are detectable. In howstru and howf06788 mutants, higher amounts of Nrx-IVexon4 corresponding bands can be observed. The red and green dots indicate the bands used to calculate the transcript ratio, which is given below the lanes. (C) Analysis of PCR products of glial (repoGal4) or neuronal (elavGal4) enriched cDNA pools and restriction with NcoI/XbaI. Primer positions are indicated by arrows in A. Glial-specific cDNA contain almost exclusively the Nrx-IVexon3 product. Neuronal-specific cDNA exhibits higher amounts of Nrx-IVexon4. (D) Analysis of tissue specifically expressing the nrxIV_2.0 reporter in glial cells and neurons. PCR products detecting the reporter are shown in the left two panels and the corresponding NcoI/XbaI restrictions are shown in the right two panels. The restriction of the glial sample shows almost exclusively Nrx-IVexon3, whereas neurons express higher amounts of Nrx-IVexon4. The red and green dots indicate the DNA bands of the different splicing isoforms.

Fig. 2.

Detection of tissue-specific splicing with Nrx-IV splicing reporters. (A) The Nrx-IV locus encodes 13 exons (gray boxes), of which exon 3 (green framed box and lines) and exon 4 (red framed box and lines) show mutually exclusively splicing. The exons contain unique endogenous restriction sites (XbaI and NcoI). HOW response elements (HREs) are indicated by red dots. The orientation and position of primers used for splicing analysis are indicated (arrows). (B) Analysis of Nrx-IV splicing in howstru and howf06788 mutant embryos. w1118 flies are used as a wild-type control. Restriction analysis (NcoI/XbaI) of the Nrx-IV-specific PCR product shows a stereotypic splicing pattern. DNA fragments of 359 and 271 bp correspond to the Nrx-IVexon3 mRNA, fragments of 423 and 207 bp correspond to the Nrx-IVexon4 transcripts. The faint 630 bp band corresponds to traces of undigested DNA. In wild type, high levels of Nrx-IVexon3 and low levels of Nrx-IVexon4 are detectable. In howstru and howf06788 mutants, higher amounts of Nrx-IVexon4 corresponding bands can be observed. The red and green dots indicate the bands used to calculate the transcript ratio, which is given below the lanes. (C) Analysis of PCR products of glial (repoGal4) or neuronal (elavGal4) enriched cDNA pools and restriction with NcoI/XbaI. Primer positions are indicated by arrows in A. Glial-specific cDNA contain almost exclusively the Nrx-IVexon3 product. Neuronal-specific cDNA exhibits higher amounts of Nrx-IVexon4. (D) Analysis of tissue specifically expressing the nrxIV_2.0 reporter in glial cells and neurons. PCR products detecting the reporter are shown in the left two panels and the corresponding NcoI/XbaI restrictions are shown in the right two panels. The restriction of the glial sample shows almost exclusively Nrx-IVexon3, whereas neurons express higher amounts of Nrx-IVexon4. The red and green dots indicate the DNA bands of the different splicing isoforms.

Differential expression of Nrx-IV

To demonstrate a cell type-specific expression of different Nrx-IV splicing isoforms, we isolated cell type-specific mRNA (Yang et al., 2005) (Fig. 2A,C). In embryos, glia almost exclusively express the Nrx-IVexon3 form, whereas in neurons the expression of the Nrx-IVexon4 isoform is enriched.

To further dissect glial-specific splicing, we generated a set of reporter constructs encompassing the differentially spliced region of Nrx-IV (Fig. 2D, Fig. 3A). In the construct nrxIV_2.0, exon 5 is partially replaced by a EGFP cassette to monitor expression of the transgene, and exon 2 is engineered to contain an ATG-start codon (Fig. 3A). The expression control is mediated via UAS elements, allowing expression of the reporter specifically in neurons, using elavGal4, or in glial cells, using repoGal4. In embryos, splicing of the nrxIV_2.0 reporter closely mimics that found in the endogenous Nrx-IV gene (compare Fig. 2C,D).

HOW positive glia expresses NrxIVexon3

To circumvent mRNA isolation, we generated the nrxIV_3.0 reporter. We inserted a EGFPStop sequence in exon 3, resulting in a translational stop whenever exon3 is used. In addition, we added a mCherryStop sequence in exon4, resulting in a translational stop when exon4 is used (Fig. 3B). Upon transfection of such a construct into S2 cells, 45% of the cases we noted concomitant generation of exon 3- and exon 4-containing mRNAs. In the remaining cells, either exon 3 splicing or exon 4 splicing is observed (Fig. 3C-F; in 30% of the cells only exon 3 and in 25% of the cells only exon 4 splicing is detected). This indicates that even in S2 cells a stable commitment towards a specific splicing reaction can be made.

The nrxIV_3.0 reporter can also be used to monitor splicing specificity with a single cell resolution in Drosophila embryos (Fig. 3G-N). When expressed in glia using repoGal4, we noted only green fluorescence indicating splicing of the exon 3 (Fig. 3G,H; the CNS is indicated by broken lines). By contrast, following expression in neurons using elavGal4, both nrxIV_3.0 transcripts can be detected in the CNS (Fig. 3K-N, red and green). Similar results were obtained when we analyzed splicing in the larval nervous system (supplementary material Fig. S2A-H). In summary, this analysis supports the notion that the BBB-forming glia express only the Nrx-IVexon3 transcript.

Fig. 3.

Generation of splice reporter constructs. (A) The nrxIV_2.0 reporter contains the genomic region covering exons 2-5 of Nrx-IV, fused to EGFP under the control of the UAS element. This allows cell type-specific expression of the reporters in glia using repoGal4 or in neurons using elavGal4. The exclusive reporter detection is achieved by an EGFP-reverse primer (indicated by arrows). (B) The nrxIV_3.0 reporter is a variant of nrxIV_2.0, which contains an in-frame EGFP sequence in exon 3 (green) and an in-frame mCherry sequence in exon 4 (red). Both fluorescent markers contain a stop codon, allowing the detection of alternative splicing of exon 3 or exon 4 by fluorescence detection. (C-E) Detection of endogenous fluorescence of S2 cells transfected with the nrxIV_3.0 reporter and actinGal4. (C) EGFP fluorescence. (D) mCherry fluorescence. (E) Merge of EGFP and mCherry fluorescence. (F) Statistical analysis of the fluorescence distribution in S2 cells expressing the nrxIV_3.0 reporter (n=70). Forty-five percent express both EGFP (exon 3) and mCherry (exon 4), 25% express mCherry and 30% express EGFP. (G-R) Projections of confocal sections through the CNS of stage 16 embryos. The outline of the CNS is indicated by a white dotted line. (G-J) Expression of nrxIV_3.0 reporter in glia using repoGal4 and (K-N) in neurons using elavGal4. (G,H) Glial expression of nrxIV_3.0 shows the detection of EGFP (exon 3) (G), but not of mCherry (exon 4) (H). (K,L) Neuronal expression of nrxIV_3.0 shows some EGFP (exon 3) (K) and mCherry (exon 4) (L). (I,M) Merge. (J,N) Additionally, neuronal membranes are stained with anti-HRP (gray). (O-Q) The HOW-specific Gal4-driver how24BGal4 expresses nuclear localized lamin-EGFP to visualize the cells expressing HOW. In the CNS, HOW expression is found exclusively in Repo-positive glial cells (arrows). In addition, HOW expression is noted in the mesoderm (mes). (R) Cdk12 is expressed in the nuclei of all cells.

Fig. 3.

Generation of splice reporter constructs. (A) The nrxIV_2.0 reporter contains the genomic region covering exons 2-5 of Nrx-IV, fused to EGFP under the control of the UAS element. This allows cell type-specific expression of the reporters in glia using repoGal4 or in neurons using elavGal4. The exclusive reporter detection is achieved by an EGFP-reverse primer (indicated by arrows). (B) The nrxIV_3.0 reporter is a variant of nrxIV_2.0, which contains an in-frame EGFP sequence in exon 3 (green) and an in-frame mCherry sequence in exon 4 (red). Both fluorescent markers contain a stop codon, allowing the detection of alternative splicing of exon 3 or exon 4 by fluorescence detection. (C-E) Detection of endogenous fluorescence of S2 cells transfected with the nrxIV_3.0 reporter and actinGal4. (C) EGFP fluorescence. (D) mCherry fluorescence. (E) Merge of EGFP and mCherry fluorescence. (F) Statistical analysis of the fluorescence distribution in S2 cells expressing the nrxIV_3.0 reporter (n=70). Forty-five percent express both EGFP (exon 3) and mCherry (exon 4), 25% express mCherry and 30% express EGFP. (G-R) Projections of confocal sections through the CNS of stage 16 embryos. The outline of the CNS is indicated by a white dotted line. (G-J) Expression of nrxIV_3.0 reporter in glia using repoGal4 and (K-N) in neurons using elavGal4. (G,H) Glial expression of nrxIV_3.0 shows the detection of EGFP (exon 3) (G), but not of mCherry (exon 4) (H). (K,L) Neuronal expression of nrxIV_3.0 shows some EGFP (exon 3) (K) and mCherry (exon 4) (L). (I,M) Merge. (J,N) Additionally, neuronal membranes are stained with anti-HRP (gray). (O-Q) The HOW-specific Gal4-driver how24BGal4 expresses nuclear localized lamin-EGFP to visualize the cells expressing HOW. In the CNS, HOW expression is found exclusively in Repo-positive glial cells (arrows). In addition, HOW expression is noted in the mesoderm (mes). (R) Cdk12 is expressed in the nuclei of all cells.

To determine the HOW expression domain, we used the 24BGal4 insertion into the how locus (how24BGal4), which faithfully recapitulates how expression (Brand and Perrimon, 1993; Fyrberg et al., 1997) (Fig. 3, supplementary material Fig. S3). Prominent how expression is noted in some CNS glia, which, based on their position, correspond to the subperineurial glia that constitute the BBB (Fig. 3O-Q). No how expression is noted in neurons. In addition, when we expressed the nrxIV_3.0 reporter using the how24BGal4 driver in embryos, all cells express the green exon 3 cassette, indicating that, in embryos, the presence of HOW is associated with the selection of exon 3 (supplementary material Fig. S2M-P). When we expressed the nrxIV_3.0 reporter in larvae using the how24BGal4 driver, most cells appear green, but we noted a few cells in the nervous system that express only the red exon 4 cassette (supplementary material Fig. S2I-L, arrow).

Nrx-IV splicing requires HOW response elements

We had previously shown that HOW is able to bind the Nrx-IV pre-mRNA (Edenfeld et al., 2006). Four potential HOW-binding sites (HOW response elements, HREs) are evolutionary conserved (Fig. 4). HRE1 is situated 5′ of exon 3, and three binding sites, HRE2 to HRE4, are clustered within 40 bp just 3′ of exon 3. Within the splicing reporter nrxIV_2.0, we mutated all individual HREs, as well as several combinations, and tested the consequences for glial cell-specific splicing (Fig. 5, supplementary material Fig. S4).

Fig. 4.

Evolutionary conserved HRE in Nrx-IV pre-mRNA. (A) In the intronic sequence of the pre-mRNA of Nrx-IV, several HOW response elements (HREs) are found in close proximity to the alternatively spliced exon 3 (indicated by red dots). A magnification of the genomic region around exon 3 is shown. HRE1 is located 5′ of exon 3 and HRE2, HRE3 and HRE4 are found 3′ of it. (B,C) Alignment of the genomic regions of the Nrx-IV drosophilid orthologs containing the HREs (pink). HRE1 is conserved in all drosophilidae with exception of D. grimshawi, D. mojavensis and D. virilis. HRE2 is highly conserved in all drosophilidae. D. ananassae and D. erecta have two HREs in this region. All other drosophilidae have three HREs; D. mojavensis has four.

Fig. 4.

Evolutionary conserved HRE in Nrx-IV pre-mRNA. (A) In the intronic sequence of the pre-mRNA of Nrx-IV, several HOW response elements (HREs) are found in close proximity to the alternatively spliced exon 3 (indicated by red dots). A magnification of the genomic region around exon 3 is shown. HRE1 is located 5′ of exon 3 and HRE2, HRE3 and HRE4 are found 3′ of it. (B,C) Alignment of the genomic regions of the Nrx-IV drosophilid orthologs containing the HREs (pink). HRE1 is conserved in all drosophilidae with exception of D. grimshawi, D. mojavensis and D. virilis. HRE2 is highly conserved in all drosophilidae. D. ananassae and D. erecta have two HREs in this region. All other drosophilidae have three HREs; D. mojavensis has four.

In wild-type glia, the nrxIV_2.0wt construct is almost exclusively spliced towards the exon 3-containing mRNA (Fig. 5C,D, green dots). Upon mutation of the three 3′ HREs, an aberrant splicing pattern is noted with mRNA molecules containing both, exon 3 and exon 4 (Fig. 5C, white dotted boxes, supplementary material Fig. S5). The different HREs appear to act in a redundant fashion and stronger effects are noted in the triple mutant (Fig. 5C, sh2+3+4). The deletion of all 3′ HREs (Δ3) has an even stronger impact on splicing.

The removal of the 5′ HRE increases the number of transcripts lacking both exon 3 and exon 4 (Fig. 5C, red dotted boxes). This phenotype is in particularly prominent in quadruple mutants, where all HREs are mutated (Fig. 5C, sh1+2+3+4 or sh1+Δ3). The restriction analysis of the PCR products shown in Fig. 5C indicated no shift of the glial splicing pattern (Fig. 5D). In conclusion, these data suggest that binding of HOW at the three 3′ HREs is needed to suppress inclusion of exon 4 and the 5′-binding site is required for general inclusion of one of the two exons in the final mRNA.

Reconstitution of glial splicing in neurons

To further demonstrate the instructive role of HOW in regulating Nrx-IV splicing, we switched to neuronal cells that endogenously express the exon 4 variant of Nrx-IV but no HOW protein (Stork et al., 2009) (Figs 2, 3, 6). To simplify RNA isolation, we used brains from third instar larvae, in which the nrxIV_2.0 reporter shows a preferential expression of Nrx-IVexon3 in glia and an exclusive expression of Nrx-IVexon4 in neurons (Fig. 6A). Upon co-expression of nrxIV_2.0 and HOW(S) in neurons using the elavGal4 driver, no change in splicing pattern was detected. This was expected, as HOW(S) is predominantly found in the cytoplasm (Fig. 7B,D,F). By contrast, HOW(L) almost exclusively localizes to nuclei where it is differentially stabilized – similar to cytosplasmic HOW(S) (Fig. 7A,C,E,F, compare asterisk and arrow). Moreover, neuronal expression of HOW(L) was able to induce a glial-specific splicing pattern of the nrxIV_2.0 splice reporter (Fig. 6, bands indicated by green dots). Thus, the presence of nuclear HOW seems to determine the alternative use of exons 3 and 4.

Identification of additional factors regulating HOW function

The above data are compatible with the following model underlying HOW function. HOW(L) acts as a constitutive factor promoting the selection of nrxIVexon3 in glia and also functions, when ectopically expressed, in neurons. However, in wild-type glia the formation of septate junctions occurs significantly later, after HOW expression is initiated. Thus, HOW is likely to be regulated post-translationally to instruct Nrx-IVexon3 splicing in glia. As HOW can be phosphorylated (Nir et al., 2012), we tested the influence of several kinases on the splicing activity following an RNAi-based (or expression of dominant-negative isoforms) screening approach (supplementary material Table S1). We determined the effects of gene silencing on the splicing of the nrxIV_2.0 reporter specifically in larval glial cells. Fifteen kinases were tested and silencing of two of them, Raf and Cdk12, resulted in a clear shift of Nrx-IVexon3 to Nrx-IVexon4 splicing (Fig. 6B, supplementary material Table S1).

Fig. 5.

Functional analysis of the HRE. (A) All HREs (red filled circles) in the splicing reporter nrxIV_2.0 were mutated individually and in different combinations [ACTAA was mutated to TAAAC and named as ‘shuffle’ (sh); see supplementary material Fig. S4]. (B) The different splicing products of the nrxIV_2.0 reporter are depicted and the fragment length is shown. (C) Splice patterns of wild-type (wt) and the different mutant nrxIV_2.0 reporter constructs upon glial expression. Undigested PCR fragments are shown. All mutant nrxIV_2.0 reporter constructs, which carry a HRE1 mutation (sh1), lose the basal inclusion of exon 3 and exon 4, compared with wild type. Instead, HRE1 mutants show increased exon skipping (red dotted lines), except the mutants for HRE 1+4 and HRE 1+3+4. The mutation of HRE 2+3 and the complete deletion of HRE2, 3 and 4 (Δ3) also show increased exon skipping. Mutants for HRE 2 or 3 or 4 alone and combinations of HRE 2+4, 3+4 and 2+3+4 show an increase of the splice variant containing exon 3 and exon 4 (white dotted lines). (D) Restriction analysis of the PCR products shown in C. All PCR products were subject to a NcoI/XbaI double restriction. No shift of the glial splicing pattern is observed in the HRE mutants. All changes in the pattern of the restriction bands correspond to the splicing patterns found in C. See supplementary material Fig. S5 for a better view of 133 bp band corresponding to a fragment generated by concomitant inclusion of exons 3 and 4. The gray lines indicate the corresponding molecular marker. The red and green dots indicate the DNA bands of the different splicing isoforms.

Fig. 5.

Functional analysis of the HRE. (A) All HREs (red filled circles) in the splicing reporter nrxIV_2.0 were mutated individually and in different combinations [ACTAA was mutated to TAAAC and named as ‘shuffle’ (sh); see supplementary material Fig. S4]. (B) The different splicing products of the nrxIV_2.0 reporter are depicted and the fragment length is shown. (C) Splice patterns of wild-type (wt) and the different mutant nrxIV_2.0 reporter constructs upon glial expression. Undigested PCR fragments are shown. All mutant nrxIV_2.0 reporter constructs, which carry a HRE1 mutation (sh1), lose the basal inclusion of exon 3 and exon 4, compared with wild type. Instead, HRE1 mutants show increased exon skipping (red dotted lines), except the mutants for HRE 1+4 and HRE 1+3+4. The mutation of HRE 2+3 and the complete deletion of HRE2, 3 and 4 (Δ3) also show increased exon skipping. Mutants for HRE 2 or 3 or 4 alone and combinations of HRE 2+4, 3+4 and 2+3+4 show an increase of the splice variant containing exon 3 and exon 4 (white dotted lines). (D) Restriction analysis of the PCR products shown in C. All PCR products were subject to a NcoI/XbaI double restriction. No shift of the glial splicing pattern is observed in the HRE mutants. All changes in the pattern of the restriction bands correspond to the splicing patterns found in C. See supplementary material Fig. S5 for a better view of 133 bp band corresponding to a fragment generated by concomitant inclusion of exons 3 and 4. The gray lines indicate the corresponding molecular marker. The red and green dots indicate the DNA bands of the different splicing isoforms.

Cdk12 protein is a nuclear localized kinase that phosphorylates the C-terminal domain (CTD) of the RNA polymerase II during transcriptional elongation (Bartkowiak et al., 2010) (Fig. 9). The phosphorylated CTD is bound by Prp40, a subunit of the U1 snRNP (Morris and Greenleaf, 2000; Neubauer et al., 1997). Prp40, in turn, has been shown to interact with the HOW-binding protein Crn/Clf1 (Chung et al., 1999; Edenfeld et al., 2006). Thus, Cdk12 is in a position to facilitate splicing of pre-mRNAs that have bound the HOW protein (Fig. 9).

Provided that phosphorylation of the CTD by Cdk12 favors the recruitment of the U1 snRNP subunit Prp40 and thus the recruitment of Crn/HOW, one would postulate that knockdown of prp40 gene function affects alternative splicing of Nrx-IV. To assay a cell-type specific reaction, we monitored the splicing of the nrxIV_2.0 splice reporter following pan-glial co-expression of prp40RNAi. Wild-type neurons predominantly express exon 4-containing Nrx-IV transcripts, whereas glia express both exon 3- and exon 4-containing Nrx-IV transcripts. Upon silencing of prp40 function, we noted a significant increase in the level of the neuronal splicing form (Fig. 6L), indicating that Prp40 acts in the same pathway as Cdk12 and HOW.

Cdk12 is required for HOW-dependent splicing of Nrx-IV

To test the model that Cdk12 regulates HOW function, we first determined the relationship of the two genes in epistasis experiments. In a gain-of-function approach, we asked whether the ability of HOW(L) to induce glial-specific splicing in larval neurons requires Cdk12 activity. Cdk12 is expressed ubiquitously and localizes to the nucleus (Fig. 3R, supplementary material Fig. S3D) (Bartkowiak et al., 2010). We used the fluorescent-based nrxIV_3.0 reporter, which, in contrast to the nrxIV_2.0 reporter, shows some expression of the Nrx-IVexon3 isoform in neurons. Expression of ectopic HOW(L) in neurons results in late larval lethality. The surviving larvae show reduced brain size and reduced amounts of the neuronal splicing isoform (Fig. 8B-C′). To determine the ratio of transcripts, we determined the quotient of the mean fluorescence intensity of the EGFP and mCherry signals in the brain lobes using ImageJ (Fig. 8B,F). Expression of HOW(L) resulted in a significant shift of the isoform quotient from 0.63 to 1.67, reflecting the decreased expression of exon4 mRNAs (P<10–7; Fig. 8C,F). Upon expression of HOW(L) and concomitant silencing of Cdk12, the larval lethality is rescued, demonstrating that HOW(L) acts at least in part through Cdk12. The splicing pattern of the nrxIV_3.0 reporter is now shifted to a ratio of 1.19, suggesting that the presence of Cdk12 is needed for full HOW(L) activation (P<10–7; Fig. 8D,F). Knock down of only Cdk12 does not alter the splicing pattern of the nrxIV_3.0 reporter (ratio is 0.67; Fig. 8E,F). These data indicate that HOW(L) requires Cdk12 activity for its function in promoting the presence of a glial-specific spliced Nrx-IVexon3 mRNA.

Fig. 6.

HOW(L) and Cdk12 control glial splicing of Nrx-IV. (A) The expression of the nrxIV_2.0 reporter in the central nervous system of third instar larvae has a stereotypic splice pattern. Expression in glial cells (left most panel) predominantly generates exon 3-containing transcripts. Expression in neurons leads to exon 4 inclusion (second panel). No change is visible upon the additional expression of HOW(S) (third panel). The co-expression of HOW(L) and the nrxIV_2.0 reporter in neurons leads to an induction of the exon 3-containing isoform (green dots, fourth panel). (B) Analysis of the nrxIV_2.0 reporter splicing in third instar larval brains. Splicing is shifted to nrxIVexon4 isoform upon glial expression of a dominant-negative raf, howRNAi, crnRNAi and Cdk12RNAi, compared with control (elav>nrxIV_2.0 and repo>nrxIV_2.0). (C) Analysis of the nrxIV_2.0 reporter splicing in third instar larval brains. Splicing is shifted to nrxIVexon4 isoform upon glial expression of a prp40RNAi construct compared with control. The red and green dots indicate the bands that were used to calculate the transcript ratio, which is given below.

Fig. 6.

HOW(L) and Cdk12 control glial splicing of Nrx-IV. (A) The expression of the nrxIV_2.0 reporter in the central nervous system of third instar larvae has a stereotypic splice pattern. Expression in glial cells (left most panel) predominantly generates exon 3-containing transcripts. Expression in neurons leads to exon 4 inclusion (second panel). No change is visible upon the additional expression of HOW(S) (third panel). The co-expression of HOW(L) and the nrxIV_2.0 reporter in neurons leads to an induction of the exon 3-containing isoform (green dots, fourth panel). (B) Analysis of the nrxIV_2.0 reporter splicing in third instar larval brains. Splicing is shifted to nrxIVexon4 isoform upon glial expression of a dominant-negative raf, howRNAi, crnRNAi and Cdk12RNAi, compared with control (elav>nrxIV_2.0 and repo>nrxIV_2.0). (C) Analysis of the nrxIV_2.0 reporter splicing in third instar larval brains. Splicing is shifted to nrxIVexon4 isoform upon glial expression of a prp40RNAi construct compared with control. The red and green dots indicate the bands that were used to calculate the transcript ratio, which is given below.

Fig. 7.

Subcellular localization of HOW(S) and HOW(L). We expressed C-terminal HA-tagged HOW variants (green) during embryonic stages in neurons using elavGal4 or in glia using repoGal4. Repo staining labels all glial nuclei for orientation (red). (A) In neurons, HOW(L) is found in the nucleus. (B) In neurons HOW(S) is predominantly found in the cytoplasm. The boxed area is shown at higher magnification in the bottom right. Some nuclear expression can be detected (arrow). (C) In glia, HOW(L) is stabilized in a subset of glial nuclei (compare asterisk and arrow). (E,E′) Single channels. (D) Expression of HOW(S) in glial cells. Expression mostly localizes to the cytoplasm. HOW(S) is differentially stabilized in glial cells (compare arrow and asterisks). The boxed area is shown at higher magnification in the bottom right. Some nuclear expression of the HOW(S) protein can be detected (arrow). (F,F′) Single channels.

Fig. 7.

Subcellular localization of HOW(S) and HOW(L). We expressed C-terminal HA-tagged HOW variants (green) during embryonic stages in neurons using elavGal4 or in glia using repoGal4. Repo staining labels all glial nuclei for orientation (red). (A) In neurons, HOW(L) is found in the nucleus. (B) In neurons HOW(S) is predominantly found in the cytoplasm. The boxed area is shown at higher magnification in the bottom right. Some nuclear expression can be detected (arrow). (C) In glia, HOW(L) is stabilized in a subset of glial nuclei (compare asterisk and arrow). (E,E′) Single channels. (D) Expression of HOW(S) in glial cells. Expression mostly localizes to the cytoplasm. HOW(S) is differentially stabilized in glial cells (compare arrow and asterisks). The boxed area is shown at higher magnification in the bottom right. Some nuclear expression of the HOW(S) protein can be detected (arrow). (F,F′) Single channels.

DISCUSSION

Differential splicing is a key element in generating the amazing complexity of higher nervous systems. Through relatively few regulatory elements, a single gene can generate several different isoforms with potential distinct cellular functions. In Drosophila, differential splicing is required for the correct glial development. Here, we have dissected the role of the STAR-family member HOW in controlling such a differential splicing event at the Nrx-IV locus, which is pivotal for the generation of the BBB.

Nrx-IV exons 3 and 4 are spliced in a mutually exclusive manner. They share DNA sequence identity of 60% and encode related Discoidin domains, which provide distinct adhesive properties (Stork et al., 2009; Vogel et al., 2006). Within glial cells, expression of Nrx-IVexon3 predominates and participates in the formation of septate junctions. Interestingly, the binding partner of Nrx-IV at the Drosophila septate junctions, Neuroglian, or the Caspr-binding partner at the septate-like junctions in vertebrates, Neurofascin, are also subject to cell-type specific, differential splicing (Basak et al., 2007; Genova and Fehon, 2003; Hassel et al., 1997; Hortsch et al., 1990; Volkmer et al., 1996).

Fig. 8.

Cdk12RNAi changes the effect of HOW(L) on nrxIV_3.0 splicing. Fluorescence intensity analysis upon neuronal expression of the nrxIV_3.0 reporter in third instar larval brains. Staining with anti-EGFP and anti-mCherry were performed under the same conditions. Z-stacks of confocal images were taken using the same settings. False color-coded pictures are shown. (A) The fluorescence intensity code: dark blue (no fluorescence) to red (maximum fluorescence). Fluorescence intensity of the brain lobes (indicated by dotted lines) was measured using ImageJ. (B,B′) Neuronal expression of nrxIV_3.0 reporter (control). The dimension of the brain lobes is indicated. The ratio of fluorescence EGFP/mCherry was measured and is given in F. The ventral nerve cord (vnc) was not analyzed. (C,C′) Neuronal expression of the nrxIV_3.0 reporter with HOW(L). The fluorescence intensity of mCherry is reduced compared with the control. (D,D′) Neuronal expression of the nrxIV_3.0 reporter upon co-expression of HOW(L) and Cdk12RNAi. The fluorescence intensity of mCherry is not as reduced as upon expression of HOW(L) (C′). (E,E′) Neuronal expression of the nrxIV_3.0 reporter and a Cdk12RNAi construct. The ratio of EGFP and mCherry fluorescence intensity is unchanged. (F) Statistical analysis of the fluorescence ratio EGFP/mCherry. The different genotypes are indicated. The number of brain lobes used for the analysis are: w1118, n=8; HOW(L), n=14; HOW(L) Cdk12RNAi, n=14; HOW(L) Cdk12RNAi, n=12. The changes were significant (***) [P<10–7 comparing w1118- and HOW(L)-expressing animals or HOW(L)- and HOW(L) Cdk12RNAi-expressing animals; P<10–4 comparing w1118- and HOW(L) Cdk12RNAi-expressing animals. n.s., non significant.

Fig. 8.

Cdk12RNAi changes the effect of HOW(L) on nrxIV_3.0 splicing. Fluorescence intensity analysis upon neuronal expression of the nrxIV_3.0 reporter in third instar larval brains. Staining with anti-EGFP and anti-mCherry were performed under the same conditions. Z-stacks of confocal images were taken using the same settings. False color-coded pictures are shown. (A) The fluorescence intensity code: dark blue (no fluorescence) to red (maximum fluorescence). Fluorescence intensity of the brain lobes (indicated by dotted lines) was measured using ImageJ. (B,B′) Neuronal expression of nrxIV_3.0 reporter (control). The dimension of the brain lobes is indicated. The ratio of fluorescence EGFP/mCherry was measured and is given in F. The ventral nerve cord (vnc) was not analyzed. (C,C′) Neuronal expression of the nrxIV_3.0 reporter with HOW(L). The fluorescence intensity of mCherry is reduced compared with the control. (D,D′) Neuronal expression of the nrxIV_3.0 reporter upon co-expression of HOW(L) and Cdk12RNAi. The fluorescence intensity of mCherry is not as reduced as upon expression of HOW(L) (C′). (E,E′) Neuronal expression of the nrxIV_3.0 reporter and a Cdk12RNAi construct. The ratio of EGFP and mCherry fluorescence intensity is unchanged. (F) Statistical analysis of the fluorescence ratio EGFP/mCherry. The different genotypes are indicated. The number of brain lobes used for the analysis are: w1118, n=8; HOW(L), n=14; HOW(L) Cdk12RNAi, n=14; HOW(L) Cdk12RNAi, n=12. The changes were significant (***) [P<10–7 comparing w1118- and HOW(L)-expressing animals or HOW(L)- and HOW(L) Cdk12RNAi-expressing animals; P<10–4 comparing w1118- and HOW(L) Cdk12RNAi-expressing animals. n.s., non significant.

Differential splicing appears to be of more general relevance during the formation of septate junctions. The fly homologue of the membrane-skeleton protein 4.1, Coracle, binds to Nrx-IV and mediates the linkage of the septate junctions to the cytoskeleton (Fehon et al., 1994; Lamb et al., 1998; Ward et al., 1998). Differential splicing of coracle generates at least four different splice variants that encode four distinct proteins (Drysdale and Crosby, 2005). RT-PCR experiments indicate that the Coracle-PB isoform is generated in a HOW-dependent manner (F.R. and C.K., unpublished).

STAR proteins, like HOW, bind sequence motifs in the pre-mRNA of their targets (Galarneau and Richard, 2005; Israeli et al., 2007; Ryder et al., 2004; Ryder and Williamson, 2004). Following site-specific mutation of all HREs, we could show that HRE1 may be needed for general exon definition. The mutation of this sequence motif leads to increased exon skipping of both exon 3 and exon 4, suggesting a crucial role for HRE1 in general splicing, possibly affecting the branch point of this intron (Arning et al., 1996; Berglund et al., 2008; Kramer and Utans, 1991). The HRE2, HRE3 and HRE4 elements influence mutually exclusive splicing. Upon mutation of these motifs, both exons are left in the mRNA more frequently, which suggests their function in exon selection. Such an effect was not observed in neurons (data not shown). Thus, these HREs seem to play a role in exon selection.

The HOW isoforms share an identical KH RNA-binding domain (Volk, 2010; Volk et al., 2008). HOW(S) predominantly localizes to the cytoplasm and HOW(L) is found mostly in the nucleus of glial cells. Here, we showed that nuclear HOW is sufficient for the induction of glial-specific splicing in neurons. Interestingly, both HOW isoforms can partially rescue the how mutant phenotype. HOW(S) appears to have higher rescuing abilities. As both transgenes are inserted in the same chromosomal landing site (Bischof et al., 2007), resulting in identical expression levels, we assume that HOW(S) must be efficiently transported into the nucleus to promote Nrx-IV splicing. Because, following overexpression of the HOW(S), most of the protein stays in the cytoplasm, the shuttle mechanism(s) directing HOW(S) into the nucleus must be very tightly regulated. Possibly, HOW(S) has better rescuing abilities as HOW(S), but not HOW(L), can facilitate the nuclear import of the splice factor Crn (Edenfeld et al., 2006).

Fig. 9.

Cdk12 primes HOW/Crn-dependent splicing in glial cells. The Cyclin-dependent kinase 12 (Cdk12) binds the CTD of RNAPII and leads to hyperphosphorylation (Bartkowiak et al., 2010). Prp40 binds the CTD (Morris and Greenleaf, 2000) and to Crn/Clf1 (Chung et al., 1999), which also binds to U2AF65 and HOW (Chung et al., 1999; Edenfeld et al., 2006). HOW is binding to specific target sites in the pre-mRNA (Israeli et al., 2007). For further details, see text.

Fig. 9.

Cdk12 primes HOW/Crn-dependent splicing in glial cells. The Cyclin-dependent kinase 12 (Cdk12) binds the CTD of RNAPII and leads to hyperphosphorylation (Bartkowiak et al., 2010). Prp40 binds the CTD (Morris and Greenleaf, 2000) and to Crn/Clf1 (Chung et al., 1999), which also binds to U2AF65 and HOW (Chung et al., 1999; Edenfeld et al., 2006). HOW is binding to specific target sites in the pre-mRNA (Israeli et al., 2007). For further details, see text.

STAR family proteins are phosphorylated on several residues (Matter et al., 2002; Stoss et al., 2004; Nir et al., 2012). In the past, it has been established that the HOW homolog Sam68 is phosphorylated by MAPK the regulation of which is controlled by Raf (Matter et al., 2002). Indeed, expression of a dominant-negative Raf protein in glia shifted the splicing pattern towards the neuronal form, suggesting a role for receptor tyrosine kinase signaling for glial differentiation as it has been demonstrated at several other instances (Franzdottir et al., 2009; Michailov et al., 2004).

In addition, we noted that silencing of Cdk12 resulted in a shift of the splicing pattern towards the neuronal form. Cdk12 is a broadly expressed serine/threonine kinase that also contains stretches of arginine- and serine-rich sequences (SR domains) known to be present in RNA-processing proteins, which regulate splicing, nuclear export and stability of the mRNA (Chen et al., 2006; Huang and Steitz, 2005). Drosophila Cdk12 is associated with the C-terminal domain (CTD) of the RNA polymerase II (RNAPII) and phosphorylates Ser2 (Bartkowiak et al., 2010) (Fig. 9). The CTD of RNAPII acts as an assembly platform that controls transcription and pre-mRNA processing (Egloff and Murphy, 2008). Phosphorylated CTD in turn is recognized by Prp40 (Morris and Greenleaf, 2000), which belongs to the U1 snRNP. Moreover, a direct interaction between PrP40 and Crocked neck like factor 1 (Clf1), which binds HOW, has been demonstrated (Chung et al., 1999; Edenfeld et al., 2006). Thus, phosphorylation of CTD by Cdk12 (Bartkowiak et al., 2010) recruits the assembly of the spliceosome at specific pre-mRNA targets defined by binding of HOW (Fig. 9). In line with this model, we noted that silencing of Prp40 also alters Nrx-IV splicing.

In Drosophila, Cdk12 associates with Cyclin K (Bartkowiak et al., 2010), which is required for its catalytic activity. The activity of cyclins can be regulated by RTK signaling and thus might present a link that connects the Raf/MAPK pathway with a direct control of splicing activity (Jorissen et al., 2003; Loyer et al., 2005; Yarden and Sliwkowski, 2001). Additionally, CTD phosphorylation could be linked to MAPK activity in former studies (Bellier et al., 1997; Bensaude et al., 1999; Dubois et al., 1994; Trigon et al., 1998; Venetianer et al., 1995). Cdk12 is expressed in the nucleus of almost all cells (Fig. 3R; supplementary material Fig. S3D). To further decipher the role of Cdk12 during splicing, we have used a loss-of-function allele. Homozygous mutant animals are lethal at the beginning of larval development. However, these mutants show no splicing defects, most probably owing to strong maternal contributions (data not shown).

The formation of the BBB implies the maturation of septate junctions only in fully differentiated subperineurial glial cells. Thus, the timing of splicing of pre-mRNAs encoding septate junction proteins is crucial and most likely regulated by two independent signaling cascades. We propose that the mRNA-binding protein HOW integrates these signaling events and is key in determining cellular differentiation.

Acknowledgements

We are thankful to T. Volk for open discussions, sharing unpublished results and fly stocks; to J. Bischof and K. Basler for fly stocks; to A. Greenleaf and B. Altenhein for antibodies; and to R. Stephan for cloning vectors. We are grateful to an anonymous reviewer for pointing out the involvement of Prp40 in the control of Nrx-IV splicing. We thank E. Naffin, I. Bunse and K. Plamper for technical assistance; H. Neuert, J. Hartwig and T. Matzat for help during different phases of the project; and S. Thomas and I. Schmidt for critically reading the manuscript.

Funding

This work was funded through grants of the Deutsche Forschungsgemeinschaft (DFG) and the German Israeli Foundation [GIF, 921-159.3/2006] to C.K.

References

Arning
S.
,
Gruter
P.
,
Bilbe
G.
,
Kramer
A.
(
1996
).
Mammalian splicing factor SF1 is encoded by variant cDNAs and binds to RNA
.
RNA
2
,
794
810
.
Artzt
K.
,
Wu
J. I.
(
2010
).
STAR trek: An introduction to STAR family proteins and review of quaking (QKI)
.
Adv. Exp. Med. Biol.
693
,
1
24
.
Awasaki
T.
,
Lai
S.-L.
,
Ito
K.
,
Lee
T.
(
2008
).
Organization and postembryonic development of glial cells in the adult central brain of Drosophila
.
J. Neurosci.
28
,
13742
13753
.
Banerjee
S.
,
Bhat
M. A.
(
2007
).
Neuron-glial interactions in blood-brain barrier formation
.
Annu. Rev. Neurosci.
30
,
235
258
.
Banerjee
S.
,
Pillai
A. M.
,
Paik
R.
,
Li
J.
,
Bhat
M. A.
(
2006
).
Axonal ensheathment and septate junction formation in the peripheral nervous system of Drosophila
.
J. Neurosci.
26
,
3319
3329
.
Bartkowiak
B.
,
Liu
P.
,
Phatnani
H. P.
,
Fuda
N. J.
,
Cooper
J. J.
,
Price
D. H.
,
Adelman
K.
,
Lis
J. T.
,
Greenleaf
A. L.
(
2010
).
CDK12 is a transcription elongation-associated CTD kinase, the metazoan ortholog of yeast Ctk1
.
Genes Dev.
24
,
2303
2316
.
Basak
S.
,
Raju
K.
,
Babiarz
J.
,
Kane-Goldsmith
N.
,
Koticha
D.
,
Grumet
M.
(
2007
).
Differential expression and functions of neuronal and glial neurofascin isoforms and splice variants during PNS development
.
Dev. Biol.
311
,
408
422
.
Baumgartner
S.
,
Littleton
J. T.
,
Broadie
K.
,
Bhat
M. A.
,
Harbecke
R.
,
Lengyel
J. A.
,
Chiquet-Ehrismann
R.
,
Prokop
A.
,
Bellen
H. J.
(
1996
).
A Drosophila neurexin is required for septate junction and blood-nerve barrier formation and function
.
Cell
87
,
1059
1068
.
Bellier
S.
,
Chastant
S.
,
Adenot
P.
,
Vincent
M.
,
Renard
J. P.
,
Bensaude
O.
(
1997
).
Nuclear translocation and carboxyl-terminal domain phosphorylation of RNA polymerase II delineate the two phases of zygotic gene activation in mammalian embryos
.
EMBO J.
16
,
6250
6262
.
Bensaude
O.
,
Bonnet
F.
,
Casse
C.
,
Dubois
M. F.
,
Nguyen
V. T.
,
Palancade
B.
(
1999
).
Regulated phosphorylation of the RNA polymerase II C-terminal domain (CTD)
.
Biochem. Cell Biol.
77
,
249
255
.
Berglund
A. C.
,
Sjolund
E.
,
Ostlund
G.
,
Sonnhammer
E. L.
(
2008
).
InParanoid 6, eukaryotic ortholog clusters with inparalogs
.
Nucleic Acids Res.
36
,
D263
D266
.
Bischof
J.
,
Maeda
R. K.
,
Hediger
M.
,
Karch
F.
,
Basler
K.
(
2007
).
An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases
.
Proc. Natl. Acad. Sci. USA
104
,
3312
3317
.
Black
D. L.
(
2003
).
Mechanisms of alternative pre-messenger RNA splicing
.
Annu. Rev. Biochem.
72
,
291
336
.
Bogdan
S.
,
Stephan
R.
,
Lobke
C.
,
Mertens
A.
,
Klambt
C.
(
2005
).
Abi activates WASP to promote sensory organ development
.
Nat. Cell Biol.
7
,
977
984
.
Brand
A. H.
,
Perrimon
N.
(
1993
).
Targeted gene expression as a means of altering cell fates and generating dominant phenotypes
.
Development
118
,
401
415
.
Chen
H. H.
,
Wang
Y. C.
,
Fann
M. J.
(
2006
).
Identification and characterization of the CDK12/cyclin L1 complex involved in alternative splicing regulation
.
Mol. Cell. Biol.
26
,
2736
2745
.
Chung
S.
,
McLean
M. R.
,
Rymond
B. C.
(
1999
).
Yeast ortholog of the Drosophila crooked neck protein promotes spliceosome assembly through stable U4/U6.U5 snRNP addition
.
RNA
5
,
1042
1054
.
Drysdale
R. A.
,
Crosby
M. A.
(
2005
).
FlyBase: genes and gene models
.
Nucleic Acids Res.
33
,
D390
D395
.
Dubois
M. F.
,
Nguyen
V. T.
,
Dahmus
M. E.
,
Pages
G.
,
Pouyssegur
J.
,
Bensaude
O.
(
1994
).
Enhanced phosphorylation of the C-terminal domain of RNA polymerase II upon serum stimulation of quiescent cells: possible involvement of MAP kinases
.
EMBO J.
13
,
4787
4797
.
Ebersole
T. A.
,
Chen
Q.
,
Justice
M. J.
,
Artzt
K.
(
1996
).
The quaking gene product necessary in embryogenesis and myelination combines features of RNA binding and signal transduction proteins
.
Nat. Genet.
12
,
260
265
.
Edenfeld
G.
,
Volohonsky
G.
,
Krukkert
K.
,
Naffin
E.
,
Lammel
U.
,
Grimm
A.
,
Engelen
D.
,
Reuveny
A.
,
Volk
T.
,
Klambt
C.
(
2006
).
The splicing factor Crooked Neck associates with the RNA-binding protein HOW to control glial cell maturation in Drosophila
.
Neuron
52
,
969
980
.
Edwards
T. N.
,
Meinertzhagen
I. A.
(
2010
).
The functional organisation of glia in the adult brain of Drosophila and other insects
.
Prog. Neurobiol.
90
,
471
497
.
Egloff
S.
,
Murphy
S.
(
2008
).
Cracking the RNA polymerase II CTD code
.
Trends Genet.
24
,
280
288
.
Einheber
S.
,
Zanazzi
G.
,
Ching
W.
,
Scherer
S.
,
Milner
T. A.
,
Peles
E.
,
Salzer
J. L.
(
1997
).
The axonal membrane protein Caspr, a homologue of neurexin IV, is a component of the septate-like paranodal junctions that assemble during myelination
.
J. Cell Biol.
139
,
1495
1506
.
Faivre-Sarrailh
C.
,
Banerjee
S.
,
Li
J.
,
Hortsch
M.
,
Laval
M.
,
Bhat
M. A.
(
2004
).
Drosophila contactin, a homolog of vertebrate contactin, is required for septate junction organization and paracellular barrier function
.
Development
131
,
4931
4942
.
Fehon
R. G.
,
Dawson
I. A.
,
Artavanis-Tsakonas
S.
(
1994
).
A Drosophila homologue of membrane-skeleton protein 4.1 is associated with septate junctions and is encoded by the coracle gene
.
Development
120
,
545
557
.
Franzdottir
S. R.
,
Engelen
D.
,
Yuva-Aydemir
Y.
,
Schmidt
I.
,
Aho
A.
,
Klambt
C.
(
2009
).
Switch in FGF signalling initiates glial differentiation in the Drosophila eye
.
Nature
460
,
758
761
.
Fyrberg
C.
,
Becker
J.
,
Barthmaier
P.
,
Mahaffey
J.
,
Fyrberg
E.
(
1997
).
A Drosophila muscle-specific gene related to the mouse quaking locus
.
Gene
197
,
315
323
.
Galarneau
A.
,
Richard
S.
(
2005
).
Target RNA motif and target mRNAs of the Quaking STAR protein
.
Nat. Struct. Mol. Biol.
12
,
691
698
.
Genova
J. L.
,
Fehon
R. G.
(
2003
).
Neuroglian, Gliotactin, and the Na+/K+ ATPase are essential for septate junction function in Drosophila
.
J. Cell Biol.
161
,
979
989
.
Graveley
B. R.
,
Brooks
A. N.
,
Carlson
J. W.
,
Duff
M. O.
,
Landolin
J. M.
,
Yang
L.
,
Artieri
C. G.
,
van Baren
M. J.
,
Boley
N.
,
Booth
B. W.
, et al. 
. (
2011
).
The developmental transcriptome of Drosophila melanogaster
.
Nature
471
,
473
479
.
Hartenstein
V.
(
2011
).
Morphological diversity and development of glia in Drosophila
.
Glia
59
,
1237
1252
.
Hassel
B.
,
Rathjen
F. G.
,
Volkmer
H.
(
1997
).
Organization of the neurofascin gene and analysis of developmentally regulated alternative splicing
.
J. Biol. Chem.
272
,
28742
28749
.
Hortsch
M.
,
Bieber
A. J.
,
Patel
N. H.
,
Goodman
C. S.
(
1990
).
Differential splicing generates a nervous system-specific form of Drosophila neuroglian
.
Neuron
4
,
697
709
.
Huang
Y.
,
Steitz
J. A.
(
2005
).
SRprises along a messenger’s journey
.
Mol. Cell
17
,
613
615
.
Israeli
D.
,
Nir
R.
,
Volk
T.
(
2007
).
Dissection of the target specificity of the RNA-binding protein HOW reveals dpp mRNA as a novel HOW target
.
Development
134
,
2107
2114
.
Jones
B. W.
(
2005
).
Transcriptional control of glial cell development in Drosophila
.
Dev. Biol.
278
,
265
273
.
Jorissen
R. N.
,
Walker
F.
,
Pouliot
N.
,
Garrett
T. P.
,
Ward
C. W.
,
Burgess
A. W.
(
2003
).
Epidermal growth factor receptor: mechanisms of activation and signalling
.
Exp. Cell Res.
284
,
31
53
.
Keren
H.
,
Lev-Maor
G.
,
Ast
G.
(
2010
).
Alternative splicing and evolution: diversification, exon definition and function
.
Nat. Rev. Genet.
11
,
345
355
.
Koscielny
G.
,
Le Texier
V.
,
Gopalakrishnan
C.
,
Kumanduri
V.
,
Riethoven
J. J.
,
Nardone
F.
,
Stanley
E.
,
Fallsehr
C.
,
Hofmann
O.
,
Kull
M.
, et al. 
. (
2009
).
ASTD: The Alternative Splicing and Transcript Diversity database
.
Genomics
93
,
213
220
.
Kramer
A.
,
Utans
U.
(
1991
).
Three protein factors (SF1, SF3 and U2AF) function in pre-splicing complex formation in addition to snRNPs
.
EMBO J.
10
,
1503
1509
.
Lamb
R. S.
,
Ward
R. E.
,
Schweizer
L.
,
Fehon
R. G.
(
1998
).
Drosophila coracle, a member of the protein 4.1 superfamily, has essential structural functions in the septate junctions and developmental functions in embryonic and adult epithelial cells
.
Mol. Biol. Cell
9
,
3505
3519
.
Laprise
P.
,
Lau
K. M.
,
Harris
K. P.
,
Silva-Gagliardi
N. F.
,
Paul
S. M.
,
Beronja
S.
,
Beitel
G. J.
,
McGlade
C. J.
,
Tepass
U.
(
2009
).
Yurt, Coracle, Neurexin IV and the Na(+),K(+)-ATPase form a novel group of epithelial polarity proteins
.
Nature
459
,
1141
1145
.
Laprise
P.
,
Paul
S. M.
,
Boulanger
J.
,
Robbins
R. M.
,
Beitel
G. J.
,
Tepass
U.
(
2010
).
Epithelial polarity proteins regulate Drosophila tracheal tube size in parallel to the luminal matrix pathway
.
Curr. Biol.
20
,
55
61
.
Larocque
D.
,
Pilotte
J.
,
Chen
T.
,
Cloutier
F.
,
Massie
B.
,
Pedraza
L.
,
Couture
R.
,
Lasko
P.
,
Almazan
G.
,
Richard
S.
(
2002
).
Nuclear retention of MBP mRNAs in the quaking viable mice
.
Neuron
36
,
815
829
.
Lee
B. P.
,
Jones
B. W.
(
2005
).
Transcriptional regulation of the Drosophila glial gene repo
.
Mech. Dev.
122
,
849
862
.
Li
Q.
,
Lee
J.-A.
,
Black
D. L.
(
2007
).
Neuronal regulation of alternative pre-mRNA splicing
.
Nat. Rev. Neurosci.
8
,
819
831
.
Lin
D. M.
,
Auld
V. J.
,
Goodman
C. S.
(
1995
).
Targeted neuronal cell ablation in the Drosophila embryo: pathfinding by follower growth cones in the absence of pioneers
.
Neuron
14
,
707
715
.
Loyer
P.
,
Trembley
J. H.
,
Katona
R.
,
Kidd
V. J.
,
Lahti
J. M.
(
2005
).
Role of CDK/cyclin complexes in transcription and RNA splicing
.
Cell Signal.
17
,
1033
1051
.
Matlin
A. J.
,
Clark
F.
,
Smith
C. W.
(
2005
).
Understanding alternative splicing: towards a cellular code
.
Nat. Rev. Mol. Cell Biol.
6
,
386
398
.
Matter
N.
,
Herrlich
P.
,
Konig
H.
(
2002
).
Signal-dependent regulation of splicing via phosphorylation of Sam68
.
Nature
420
,
691
695
.
Michailov
G. V.
,
Sereda
M. W.
,
Brinkmann
B. G.
,
Fischer
T. M.
,
Haug
B.
,
Birchmeier
C.
,
Role
L.
,
Lai
C.
,
Schwab
M. H.
,
Nave
K. A.
(
2004
).
Axonal neuregulin-1 regulates myelin sheath thickness
.
Science
304
,
700
703
.
Morris
D. P.
,
Greenleaf
A. L.
(
2000
).
The splicing factor, Prp40, binds the phosphorylated carboxyl-terminal domain of RNA polymerase II
.
J. Biol. Chem.
275
,
39935
39943
.
Nabel-Rosen
H.
,
Dorevitch
N.
,
Reuveny
A.
,
Volk
T.
(
1999
).
The balance between two isoforms of the Drosophila RNA-binding protein how controls tendon cell differentiation
.
Mol. Cell
4
,
573
584
.
Neubauer
G.
,
Gottschalk
A.
,
Fabrizio
P.
,
Seraphin
B.
,
Luhrmann
R.
,
Mann
M.
(
1997
).
Identification of the proteins of the yeast U1 small nuclear ribonucleoprotein complex by mass spectrometry
.
Proc. Natl. Acad. Sci. USA
94
,
385
390
.
Ni
J. Q.
,
Zhou
R.
,
Czech
B.
,
Liu
L. P.
,
Holderbaum
L.
,
Yang-Zhou
D.
,
Shim
H. S.
,
Tao
R.
,
Handler
D.
,
Karpowicz
P.
, et al. 
. (
2011
).
A genome-scale shRNA resource for transgenic RNAi in Drosophila
.
Nat. Methods
8
,
405
407
.
Nir
R.
,
Grossman
R.
,
Paroush
Z.
,
Volk
T.
(
2012
).
Phosphorylation of the Drosophila melanogaster RNA binding protein HOW by MAPK/ERK enhances its dimerization and activity
.
PLoS Genet.
DOI: 0.1371/journal.pgen.1002632 (in press)
.
Pan
Q.
,
Shai
O.
,
Lee
L. J.
,
Frey
B. J.
,
Blencowe
B. J.
(
2008
).
Deep surveying of alternative splicing complexity in the human transcriptome by high-throughput sequencing
.
Nat. Genet.
40
,
1413
1415
.
Peles
E.
,
Joho
K.
,
Plowman
G. D.
,
Schlessinger
J.
(
1997a
).
Close similarity between Drosophila neurexin IV and mammalian Caspr protein suggests a conserved mechanism for cellular interactions
.
Cell
88
,
745
746
.
Peles
E.
,
Nativ
M.
,
Lustig
M.
,
Grumet
M.
,
Schilling
J.
,
Martinez
R.
,
Plowman
G. D.
,
Schlessinger
J.
(
1997b
).
Identification of a novel contactin-associated transmembrane receptor with multiple domains implicated in protein-protein interactions
.
EMBO J.
16
,
978
988
.
Pereanu
W.
,
Shy
D.
,
Hartenstein
V.
(
2005
).
Morphogenesis and proliferation of the larval brain glia in Drosophila
.
Dev. Biol.
283
,
191
203
.
Raisin-Tani
S.
,
Leopold
P.
(
2002
).
Drosophila crooked-neck protein co-fractionates in a multiprotein complex with splicing factors
.
Biochem. Biophys. Res. Commun.
296
,
288
292
.
Rios
J. C.
,
Rubin
M.
,
St Martin
M.
,
Downey
R. T.
,
Einheber
S.
,
Rosenbluth
J.
,
Levinson
S. R.
,
Bhat
M.
,
Salzer
J. L.
(
2003
).
Paranodal interactions regulate expression of sodium channel subtypes and provide a diffusion barrier for the node of Ranvier
.
J. Neurosci.
23
,
7001
7011
.
Ryder
S. P.
,
Williamson
J. R.
(
2004
).
Specificity of the STAR/GSG domain protein Qk1: implications for the regulation of myelination
.
RNA
10
,
1449
1458
.
Ryder
S. P.
,
Frater
L. A.
,
Abramovitz
D. L.
,
Goodwin
E. B.
,
Williamson
J. R.
(
2004
).
RNA target specificity of the STAR/GSG domain post-transcriptional regulatory protein GLD-1
.
Nat. Struct. Mol. Biol.
11
,
20
28
.
Schwabe
T.
,
Bainton
R. J.
,
Fetter
R. D.
,
Heberlein
U.
,
Gaul
U.
(
2005
).
GPCR signaling is required for blood-brain barrier formation in Drosophila
.
Cell
123
,
133
144
.
Sepp
K. J.
,
Auld
V. J.
(
1999
).
Conversion of lacZ enhancer trap lines to GAL4 lines using targeted transposition in Drosophila melanogaster
.
Genetics
151
,
1093
1101
.
Sidman
R. L.
,
Dickie
M. M.
,
Appel
S. H.
(
1964
).
Mutant mice (quaking and jimpy) with deficient myelination in the central nervous system
.
Science
144
,
309
311
.
Soustelle
L.
,
Giangrande
A.
(
2007
).
Glial differentiation and the Gcm pathway
.
Neuron Glia Biol.
3
,
5
16
.
Stork
T.
,
Engelen
D.
,
Krudewig
A.
,
Silies
M.
,
Bainton
R. J.
,
Klambt
C.
(
2008
).
Organization and function of the blood-brain barrier in Drosophila
.
J. Neurosci.
28
,
587
597
.
Stork
T.
,
Thomas
S.
,
Rodrigues
F.
,
Silies
M.
,
Naffin
E.
,
Wenderdel
S.
,
Klambt
C.
(
2009
).
Drosophila Neurexin IV stabilizes neuron-glia interactions at the CNS midline by binding to Wrapper
.
Development
136
,
1251
1261
.
Stoss
O.
,
Novoyatleva
T.
,
Gencheva
M.
,
Olbrich
M.
,
Benderska
N.
,
Stamm
S.
(
2004
).
p59(fyn)-mediated phosphorylation regulates the activity of the tissue-specific splicing factor rSLM-1
.
Mol. Cell Neurosci.
27
,
8
21
.
Sugnet
C. W.
,
Srinivasan
K.
,
Clark
T. A.
,
O’Brien
G.
,
Cline
M. S.
,
Wang
H.
,
Williams
A.
,
Kulp
D.
,
Blume
J. E.
,
Haussler
D.
, et al. 
. (
2006
).
Unusual intron conservation near tissue-regulated exons found by splicing microarrays
.
PLoS Comput. Biol.
2
,
e4
.
Syed
M. H.
,
Krudewig
A.
,
Engelen
D.
,
Stork
T.
,
Klambt
C.
(
2011
).
The CD59 family member Leaky/Coiled is required for the establishment of the blood-brain barrier in Drosophila
.
J. Neurosci.
31
,
7876
7885
.
Tepass
U.
,
Hartenstein
V.
(
1994
).
The development of cellular junctions in the Drosophila embryo
.
Dev. Biol.
161
,
563
596
.
Trigon
S.
,
Serizawa
H.
,
Conaway
J. W.
,
Conaway
R. C.
,
Jackson
S. P.
,
Morange
M.
(
1998
).
Characterization of the residues phosphorylated in vitro by different C-terminal domain kinases
.
J. Biol. Chem.
273
,
6769
6775
.
Untergasser
A.
,
Nijveen
H.
,
Rao
X.
,
Bisseling
T.
,
Geurts
R.
,
Leunissen
J. A.
(
2007
).
Primer3Plus, an enhanced web interface to Primer3
.
Nucleic Acids Res.
35
,
W71
W74
.
Venetianer
A.
,
Dubois
M. F.
,
Nguyen
V. T.
,
Bellier
S.
,
Seo
S. J.
,
Bensaude
O.
(
1995
).
Phosphorylation state of the RNA polymerase II C-terminal domain (CTD) in heat-shocked cells. Possible involvement of the stress-activated mitogen-activated protein (MAP) kinases
.
Eur. J. Biochem.
233
,
83
92
.
Vernet
C.
,
Artzt
K.
(
1997
).
STAR, a gene family involved in signal transduction and activation of RNA
.
Trends Genet.
13
,
479
484
.
Vogel
W. F.
,
Abdulhussein
R.
,
Ford
C. E.
(
2006
).
Sensing extracellular matrix: an update on discoidin domain receptor function
.
Cell Signal.
18
,
1108
1116
.
Volk
T.
(
2010
).
Drosophila star proteins: what can be learned from flies?
Adv. Exp. Med. Biol.
693
,
93
105
.
Volk
T.
,
Israeli
D.
,
Nir
R.
,
Toledano-Katchalski
H.
(
2008
).
Tissue development and RNA control: ‘HOW’ is it coordinated?
Trends Genet.
24
,
94
101
.
Volkmer
H.
,
Leuschner
R.
,
Zacharias
U.
,
Rathjen
F. G.
(
1996
).
Neurofascin induces neurites by heterophilic interactions with axonal NrCAM while NrCAM requires F11 on the axonal surface to extend neurites
.
J. Cell Biol.
135
,
1059
1069
.
Wang
Q.
,
Hobbs
K.
,
Lynn
B.
,
Rymond
B. C.
(
2003
).
The Clf1p splicing factor promotes spliceosome assembly through N-terminal tetratricopeptide repeat contacts
.
J. Biol. Chem.
278
,
7875
7883
.
Wang
E. T.
,
Sandberg
R.
,
Luo
S.
,
Khrebtukova
I.
,
Zhang
L.
,
Mayr
C.
,
Kingsmore
S. F.
,
Schroth
G. P.
,
Burge
C. B.
(
2008
).
Alternative isoform regulation in human tissue transcriptomes
.
Nature
456
,
470
476
.
Ward
R. E.
IV
,
Lamb
R. S.
,
Fehon
R. G.
(
1998
).
A conserved functional domain of Drosophila coracle is required for localization at the septate junction and has membrane-organizing activity
.
J. Cell Biol.
140
,
1463
1473
.
Wu
J. I.
,
Reed
R. B.
,
Grabowski
P. J.
,
Artzt
K.
(
2002
).
Function of quaking in myelination: regulation of alternative splicing
.
Proc. Natl. Acad. Sci. USA
99
,
4233
4238
.
Wu
V. M.
,
Beitel
G. J.
(
2004
).
A junctional problem of apical proportions: epithelial tube-size control by septate junctions in the Drosophila tracheal system
.
Curr. Opin. Cell Biol.
16
,
493
499
.
Yang
Z.
,
Edenberg
H. J.
,
Davis
R. L.
(
2005
).
Isolation of mRNA from specific tissues of Drosophila by mRNA tagging
.
Nucleic Acids Res.
33
,
e148
.
Yarden
Y.
,
Sliwkowski
M. X.
(
2001
).
Untangling the ErbB signalling network
.
Nat. Rev. Mol. Cell Biol.
2
,
127
137
.
Zhao
L.
,
Mandler
M. D.
,
Yi
H.
,
Feng
Y.
(
2010
).
Quaking I controls a unique cytoplasmic pathway that regulates alternative splicing of myelin-associated glycoprotein
.
Proc. Natl. Acad. Sci. USA
107
,
19061
19066
.

Competing interests statement

The authors declare no competing financial interests.

Supplementary information