The precise delivery of male to female gametes during reproduction in eukaryotes requires complex signal exchanges and a flawless communication between male and female tissues. In angiosperms, molecular mechanisms have recently been revealed that are crucial for the dialog between male (pollen tube) and female gametophytes required for successful sperm delivery. When pollen tubes reach the female gametophyte, they arrest growth, burst and discharge their sperm cells. These processes are under the control of the female gametophyte via the receptor-like serine-threonine kinase (RLK) FERONIA(FER). However, the male signaling components that control the sperm delivery remain elusive. Here, we show that ANXUR1 and ANXUR2(ANX1, ANX2), which encode the closest homologs of the FER-RLK in Arabidopsis, are preferentially expressed in pollen. Moreover,ANX1-YFP and ANX2-YFP fusion proteins display polar localization to the plasma membrane at the tip of the pollen tube. Finally, genetic analyses demonstrate that ANX1 and ANX2 function redundantly to control the timing of pollen tube discharge as anx1 anx2 double-mutant pollen tubes cease their growth and burst in vitro and fail to reach the female gametophytes in vivo. We propose that ANX-RLKs constitutively inhibit pollen tube rupture and sperm discharge at the tip of growing pollen tubes to sustain their growth within maternal tissues until they reach the female gametophytes. Upon arrival, the female FER-dependent signaling cascade is activated to mediate pollen tube reception and fertilization, while male ANX-dependent signaling is deactivated, enabling the pollen tube to rupture and deliver its sperm cells to effect fertilization.

INTRODUCTION

In eukaryotes, complex and specialized mechanisms have evolved to achieve the union of male and female gametes at fertilization by regulating attraction, signal exchange and recognition between the gametes(Boavida et al., 2005; Dresselhaus, 2006; Hirohashi et al., 2008; Hiscock and Allen, 2008; Kothe, 2008; Lord and Russell, 2002). In plants, the gametes are not produced directly from the meiotic products as in animals, but rather from multicellular, haploid gametophytes. Sperm cells of flowering plants are non-motile and need to be delivered via the haploid male gametophyte (pollen) (McCormick,2004) to the female gametophytes (embryo sacs). The latter are enclosed by the diploid tissues of the ovules that are themselves deeply embedded in maternal tissues of the pistil. In compatible interactions, the pollen grain germinates on the stigma of the pistil producing a pollen tube(PT) that grows through the style into the transmitting tissue, from where it emerges and is guided to the micropylar opening of the ovule(Crawford and Yanofsky, 2008; Dumas and Rogowsky, 2008). In the plant model Arabidopsis, typically a single PT is guided to each ovule, enters the micropyle and penetrates the female gametophyte. In Arabidopsis, the female gametophyte is a seven-celled haploid structure that contains an egg cell flanked by two synergid cells, a central cell and three antipodals (Kägi and Gross-Hardt, 2007; Yadegari and Drews, 2004). The PT penetrates one of the two synergid cells,where it terminates its growth and ruptures to deliver the two sperm cells -processes collectively referred to as PT reception(Weterings and Russell, 2004). Subsequently, double fertilization initiates seed development: one of the sperm cells is transported to, and fuses with, the egg cell to form the zygote, whereas the second sperm fertilizes the central cell, thereby initiating endosperm development (Berger et al., 2008).

The precise guidance of the PT from the stigma to the female gametophyte and successful PT reception followed by gamete fusions require several complex interactions between the pollen and the female tissues(Johnson and Lord, 2006). The identification of a few sporophytic factors that provide guidance cues at early stages of PT growth has been reported (e.g. Dong et al., 2005; Palanivelu et al., 2003; Wolters-Arts et al., 1998). However, the signals produced by the female gametophyte itself, which controls the late stages of PT guidance, were unknown(Chen et al., 2007; Higashiyama et al., 2001; Marton et al., 2005) until the recent identification of the defensin-like LURE polypeptides, which serve as the synergid-secreted PT attractants in Torenia fournieri(Okuda et al., 2009).

As the PT reaches the micropyle, several interactions between the PT and the female gametophyte ensue. However, our knowledge about the molecular and genetic mechanisms that mediate the interactions between the gametophytes is very limited. In the female gametophytic Arabidopsis mutants feronia (fer) and sirène (srn), PTs reach the micropyle but do not arrest their growth and are unable to rupture(PT overgrowth phenotype), demonstrating that the female gametophyte controls PT reception (Huck et al.,2003; Rotman et al.,2003). This indicates that successful PT reception requires that female and male partners recognize each other(Huck et al., 2003; Rotman et al., 2003). Interestingly, FER, which is allelic to SRN, encodes a plasma membrane-localized, synergid-expressed receptor-like kinase(Escobar-Restrepo et al.,2007). Receptor-like serine-threonine kinases (RLKs) are transmembrane proteins that typically receive signals through their extracellular domain and subsequently activate signaling cascades via their intracellular kinase domain (Morillo and Tax, 2006). RLKs are one of the biggest gene families in plants,with more than 600 members in Arabidopsis(Shiu et al., 2004). FER belongs to the previously uncharacterized CrRLK1L subfamily, with 17 members in Arabidopsis (Hematy and Höfte, 2008). Another CrRLK1L subfamily member, THESEUS1(THE1), has been reported to work as a putative cell wall integrity sensor,inhibiting cell elongation in hypocotyls lacking cellulose synthase(Hematy et al., 2007). More recently, FER, THE1 and the new CrRLK1L subfamily member HERCULES1 (HERK1)have all been shown to promote cell elongation in leaves and leaf petioles(Guo et al., 2009). In light of these new findings, a model for the male-female gametophyte dialog at PT reception has emerged: in the female gametophyte, FER is able to sense either a ligand produced by the PT or a ligand resulting from the modification of the cell wall of either the synergid or PT upon contact, thus triggering a signaling cascade enabling the female gametophyte to prepare itself for fertilization; in return, the female gametophyte is thought to signal back to the PT to arrest its growth, rupture and deliver the sperm cells(Escobar-Restrepo et al.,2007; McCormick,2007).

Since the first report of the fer/srn mutants, two other female gametophytic Arabidopsis mutants that specifically disrupt PT reception have been characterized, namely lorelei, which affects a putative glucosylphosphatidylinositol-anchored protein (GAP)(Capron et al., 2008), and scylla, for which the corresponding gene has not yet been identified(Rotman et al., 2008). Besides these three strictly female gametophytic mutants, the peroxin loss-of-function mutant abstinence by mutual consent (amc) displays a similar PT overgrowth phenotype, but only when a mutant PT interacts with a mutant female gametophyte, suggesting that the male-female communication required for PT reception relies on some components of identical nature in both gametophytes (Boisson-Dernier et al.,2008). Although a male signaling pathway controlling PT reception is expected to exist, to date no component acting strictly in the male gametophyte has been identified.

Here, we report that ANXUR1 and ANXUR2, the pollen-expressed homologs most closely related to FER, display a polar localization at the plasma membrane of the PT tip, and function redundantly to maintain PT integrity during growth,most likely by regulating the timing of PT discharge. Thus, our study provides the first genetic evidence of a male counterpart to FER, as a signaling process that functions in the male gametophyte to potentially control sperm cell discharge and delivery.

MATERIALS AND METHODS

Plant material, growth conditions and mutant genotyping

Primers used in this study are listed in Table 1. The binary vectors constructed and described below were introduced into Agrobacterium tumefaciens strain GV3101 by electroporation, which was then used to transform the wild type by floral dipping(Clough and Bent, 1998).

Table 1.

Oligonucleotides used in this study

NameSequence (5′-3′)
ACT7-F GGCCGATGGTGAGGATATTCAGCCACTTG 
ACT7-R TCGATGGACCTGACTCATCGTACTCACTC 
FER-RTF ATCGCTTAGGGTTTCTTCCC 
FER-RTR GACATCGGAGATCCATATACGG 
1F1 CATCAATAACAGAACAGCGCAGGC 
1R1 GCTCACGGAGTGTTCCAAATGCCATG 
1F2 CACAAAACTTCGATGATTCCAACGTC 
1R2 TTCGTTTGCAATTCATTGCCC 
2F1 TTCTTAGTTTAGATTCTTGACCCCC 
2R1 GGGATCTCATACGTTGCTGGAGC 
2F2 AAACGTAATCGGAGTAGGAGGG 
2R2 CACAACGGTTGTGACATGACCACC 
1-BPs GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGAGCGGGAAAACTCGG 
1-BPas GGGGACCACTTTGTACAAGAAAGCTGGGTATCGTCCTTTGGGATTTAC 
2-BPs GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGAACGAGAAACTCCGG 
2-BPas GGGGACCACTTTGTACAAGAAAGCTGGGTATCGTCCTTTAGGGTTTAC 
1-Sall GTCGACATGAGCGGGAAAACTCGGAT 
1-Spel TGCGAAAACTAGTCCTCGTCCTTTGGG 
2-Sall GTCGACATGAACGAGAAACTCCGGA 
2-Spel TACGAAAACTAGTCCTCGTCCTTTAGGG 
NameSequence (5′-3′)
ACT7-F GGCCGATGGTGAGGATATTCAGCCACTTG 
ACT7-R TCGATGGACCTGACTCATCGTACTCACTC 
FER-RTF ATCGCTTAGGGTTTCTTCCC 
FER-RTR GACATCGGAGATCCATATACGG 
1F1 CATCAATAACAGAACAGCGCAGGC 
1R1 GCTCACGGAGTGTTCCAAATGCCATG 
1F2 CACAAAACTTCGATGATTCCAACGTC 
1R2 TTCGTTTGCAATTCATTGCCC 
2F1 TTCTTAGTTTAGATTCTTGACCCCC 
2R1 GGGATCTCATACGTTGCTGGAGC 
2F2 AAACGTAATCGGAGTAGGAGGG 
2R2 CACAACGGTTGTGACATGACCACC 
1-BPs GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGAGCGGGAAAACTCGG 
1-BPas GGGGACCACTTTGTACAAGAAAGCTGGGTATCGTCCTTTGGGATTTAC 
2-BPs GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGAACGAGAAACTCCGG 
2-BPas GGGGACCACTTTGTACAAGAAAGCTGGGTATCGTCCTTTAGGGTTTAC 
1-Sall GTCGACATGAGCGGGAAAACTCGGAT 
1-Spel TGCGAAAACTAGTCCTCGTCCTTTGGG 
2-Sall GTCGACATGAACGAGAAACTCCGGA 
2-Spel TACGAAAACTAGTCCTCGTCCTTTAGGG 

Arabidopsis thaliana plants (accession Columbia-0) were grown in a Conviron growth chamber (Controlled Environments, Winnipeg, Canada) or in a growth room in plastic pots filled with ready-to-use soil (Professional Blend,Sunshine, Canada, or ED73 Universal Erde, Germany). After sowing, pots were kept at 4°C for 2-3 days. Growing conditions were 22°C, 60% humidity with a 16-hour light/8-hour dark photoperiod regime at ∼75 μmol m-2 s-1.

anx1-1 and anx1-2 mutants of the ANX1 gene(At3g04690), as well as anx2-1 and anx2-2 mutants of the ANX2 gene (At5g28680), were obtained from the Arabidopsis Biological Resource Center (ABRC) and correspond to the SALK_016179 (1398 bp downstream of ATG), SALK_045687 (2145 bp downstream of ATG), SALK_127359 (570 bp upstream of ATG) and SALK_133057 (1833 downstream of ATG) lines, respectively. Genotyping PCR reactions for anx1-1 and anx1-2 were performed with primer pairs 1F1/1R1, 1F1/LBa1, 1F2/1R2 and 1F2/LBa1. For anx2-1 and anx2-2 genotyping, primer pairs 2F1/2R1, 2F1/LBa1, 2F2/2R2 and 2F2/LBa1 were used.

In vitro pollen growth assays and Aniline Blue staining

All in vitro pollen growth assays were performed as described(Boavida and McCormick, 2007). Flowers were incubated at 22°C for 30 minutes in moisture incubation boxes, then brushed onto slides containing germination medium [0.01% boric acid (w/v), 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4, 10%sucrose, pH 7.5, 1.5% low-melting point agarose]. Slides in moisture incubation boxes were pre-incubated for 30-45 minutes at 30°C before returning them to 22°C for 30 minutes to several hours. Plasmolysis was induced by incubating growing pollen tubes with 40% sucrose-containing liquid germination medium for 20 minutes prior to observation. Pollen grains and tubes were imaged with a Leica DM6000 digital microscope using Leica Application Suite Advanced Fluorescence software (Leica Microsystems,Mannheim, Germany). Pollen germination counts and tube length measurements were performed manually using ImageJ 1.40g software(http://rsb.info.nih.gov/ij).

Aniline Blue staining was performed as described(Huck et al., 2003). Minimal pollination experiments were performed using an eyelash to deposit 4-16 pollen grains on the stigma of receiving pistils.

RT-PCR analyses

RT-PCR analyses were performed as described(Boisson-Dernier et al., 2008). Primer pairs used for ACTIN7 (At5g09810), ANX1(At3g04690), ANX2 (At5g28680) and FER(At3g51550) were ACT7-F/ACT7-R, 1F1/1R1, 2F2/2R2 and FER-RTF/FER-RTR.

Transient fusion protein expression in Nicotiana benthamiana

To generate the p35S-ANX1-YFP and p35S-ANX2-YFP constructs, full-length ANX1 and ANX2 DNA sequences were amplified from BACs F7O18 and F4I4 (ABRC) with the primer pairs 1-BPs/1-BPas and 2-BPs/2-BPas,respectively. These fragments were cloned into pDNR221 (Invitrogen), sequenced and then recombined into the binary pXCSG-YFP(Feys et al., 2005). The pXCSG-YFP vector containing the plasma membrane-targeted FLS2-YFP fusion(Robatzek et al., 2006), and the pH35YG vector (Kubo et al.,2005) containing the 35S-YFP, were used as positive controls for membrane localization and cytosol-nuclear localizations, respectively. Tobacco leaf infiltration was performed as described(Walter et al., 2004). Fluorescence images were acquired by spinning-disc confocal microscopy as described (Boisson-Dernier et al.,2008)

Fig. 1.

ANXUR1 and ANXUR2 are preferentially expressed in Arabidopsis pollen. (A) Microarray data for ANXUR1 (At3g04690, ANX1) and ANXUR2 (At5g28680, ANX2) in different organs as retrieved from GENEVESTIGATOR(Zimmermann et al., 2004)(downloaded May 2009). ANX1 and ANX2 transcripts were detected in every tissue that contained pollen. The inset shows microarray data retrieved from Honys and Twell (Honys and Twell, 2004) that illustrates a steady increase in ANX1 and ANX2 transcript levels during the course of pollen development. UNM, uninucleate microspores; BCP, bicellular pollen; TCP,immature tricellular pollen; MPG, mature pollen grain; AU, arbitrary units.(B) RT-PCR analysis of ANX1, ANX2 and FER transcripts from cDNAs of different Arabidopsis tissues indicates that ANX1 and ANX2 are strongly and preferentially expressed in the male gametophyte, whereas FER exhibits the opposite expression pattern. ACTIN7 (ACT7) was used as a control. Amplification was performed for 26 cycles for both ACT7 and FER and for 32 cycles for ANX1 and ANX2.

Fig. 1.

ANXUR1 and ANXUR2 are preferentially expressed in Arabidopsis pollen. (A) Microarray data for ANXUR1 (At3g04690, ANX1) and ANXUR2 (At5g28680, ANX2) in different organs as retrieved from GENEVESTIGATOR(Zimmermann et al., 2004)(downloaded May 2009). ANX1 and ANX2 transcripts were detected in every tissue that contained pollen. The inset shows microarray data retrieved from Honys and Twell (Honys and Twell, 2004) that illustrates a steady increase in ANX1 and ANX2 transcript levels during the course of pollen development. UNM, uninucleate microspores; BCP, bicellular pollen; TCP,immature tricellular pollen; MPG, mature pollen grain; AU, arbitrary units.(B) RT-PCR analysis of ANX1, ANX2 and FER transcripts from cDNAs of different Arabidopsis tissues indicates that ANX1 and ANX2 are strongly and preferentially expressed in the male gametophyte, whereas FER exhibits the opposite expression pattern. ACTIN7 (ACT7) was used as a control. Amplification was performed for 26 cycles for both ACT7 and FER and for 32 cycles for ANX1 and ANX2.

Stable fusion protein expression in Arabidopsis pollen tubes

To generate the pACA9-ANX1-YFP and pACA9-ANX2-YFP constructs, full-length ANX1 and ANX2 DNA sequences were amplified with the primer pairs 1-SalI/1-SpeI and 2-SalI/2-SpeI, respectively. Fragments were ligated into pGEM-T Easy (Promega, Madison, WI, USA), sequenced and then cloned into the SalI/SpeI-cut binary ps779 [ACA9-promoter-TAP2(YFP)](Myers et al., 2009) vector that confers hygromycin resistance. Fourteen (pACA9-ANX1-YFP) and six(pACA9-ANX2-YFP) independent T1 transgenic lines were selected for their strong expression, and all exhibited a similar expression pattern. After 5 hours of growth in vitro, growing pollen tubes were imaged as described above.

RESULTS

ANXUR1 and ANXUR2 display an expression pattern complementary to that of FERONIA

FER is highly expressed in the synergids of the female gametophyte and in a variety of vegetative tissues, but not in the male gametophyte(Escobar-Restrepo et al.,2007; Guo et al.,2009). According to publicly available ATH1 microarray data from various organs (Zimmermann et al.,2004) and pollen transcriptome studies(Becker et al., 2003; Honys and Twell, 2004; Pina et al., 2005), the two closest homologs of FER in Arabidopsis, At3g04690 and At5g28680 (Hematy and Höfte,2008) (see Fig. S1A in the supplementary material), appear to be predominantly expressed in the male gametophyte(Fig. 1A), but not in the sperm cells (Borges et al., 2008). The strong and preferential expression of these two FER homologs in pollen was confirmed by RT-PCR analysis(Fig. 1B). Based on their complementary expression pattern, At3g04690 and At5g28680were renamed ANXUR1 (ANX1) and ANXUR2(ANX2), respectively, after the male consort of the goddess Feronia in ancient Italy (Funke,1801). Consistent with this, ANX1 and ANX2 proteins were both identified in the pollen proteome (Grobei et al., 2009).

ANXUR1 and ANXUR2 display polar localization at the plasma membrane of the pollen tube tip

All the CrRLK1L members are predicted to have transmembrane domains(Hematy and Höfte, 2008). THE1 and HERK1 are localized uniformly to the plasma membrane of hypocotyl epidermal cells (Hematy et al.,2007; Guo et al.,2009), whereas FER displays a uniform plasma membrane localization pattern in leaf epidermis, but a polar localization within the synergids towards the filiform apparatus(Escobar-Restrepo et al.,2007). We first transiently expressed the ANX1-YFP (yellow fluorescent protein) and ANX2-YFP fusion proteins in tobacco epidermal cells under the control of the constitutive 35S promoter. Consistent with plasma membrane localization, ANX1-YFP and ANX2-YFP displayed the same fluorescence pattern at the cell periphery, similar to that of a membrane-bound flagellin receptor FLS2-YFP fusion protein (Robatzek et al., 2006) (see Fig. S1B in the supplementary material).

Next, we investigated the subcellular localization of ANX-RLKs in pollen,in which they are expected to function, by stably transforming Arabidopsis with ANX1-YFP and ANX2-YFP driven by the strong pollen-specific ACA9 promoter(Schiott et al., 2004). The ANX1-YFP and ANX2-YFP expression patterns were analyzed in the growing PTs (as evidenced by time-lapse imaging) of fourteen and six T1 transgenic lines with good expression, respectively. These lines did not exhibit any obvious fertilization-related phenotypes that might otherwise confound our analyses. As controls, we used transgenic Arabidopsis lines expressing ACA9-YFP and GFP-CNGC18 in PTs. ACA9-YFP and GFP-CNGC18 have been reported to display a uniform and a polar plasma membrane localization at the tip of growing PTs,respectively (Frietsch et al.,2007; Schiott et al.,2004). In contrast to the uniform plasma membrane expression pattern of the ACA9-YFP fusion protein, but similar to GFP-CNGC18 expression,PTs expressing ANX1-YFP and ANX2-YFP exhibited the most intense fluorescence signal at the cell periphery of the tips(Fig. 2). The enrichment in the membrane at the tip, but not in the shank, of PTs for ANX1-YFP, ANX2-YFP and GFP-CNGC18 was also evidenced by analysis of fluorescence intensity across the growing PT shanks and tips (Fig. 2). Moreover, PT plasmolysis confirmed localization of ACA9-YFP,ANX1-YFP and ANX2-YFP at the plasma membrane (see Fig. S2A in the supplementary material). After plasmolysis, a weak residual fluorescence signal was consistently observed close to the cell wall for PTs expressing ANX1-YFP and ANX2-YFP but not ACA9-YFP (see Fig. S2A in the supplementary material). In germinating pollen grains, polar localization of the ANX1-YFP and ANX2-YFP fusion proteins was also observed in the freshly emerged tip, but did not appear to precede the appearance of the first bulge (see Fig. S2B in the supplementary material). Moreover, fluorescence of ANX-YFP fusion proteins was associated with very dynamic small vesicles (see Movies 1 and 2 in the supplementary material), consistent with possible exocytosis at the tip subapical region and endocytosis at the apex(Zonia and Munnik, 2009). In dead PTs, in which growth and cytoplasmic streaming had stopped, the polar distribution of ANX-YFP fusion proteins towards the tip was completely abolished (see Fig. S2C in the supplementary material). In conclusion,ANX1-YFP and ANX2-YFP fusion proteins display an active polar localization at the plasma membrane of the growing PT tip.

Fig. 2.

ANX1-YFP and ANX2-YFP fusion proteins localize polarly to the plasma membrane of growing pollen tube tips. Fluorescence micrographs of actively growing pollen tubes (PTs) of Arabidopsis transgenic lines expressing YFP, ACA9-YFP, GFP-CNGC18, ANX1-YFP and ANX2-YFP constructs under the control of the pollen-specific ACA9 promoter. Unlike the uniform plasma membrane localization of ACA9-YFP along the PT, ANX1-YFP and ANX2-YFP fusions display polar plasma membrane localization at the tip of growing PTs, similar to GFP-CNGC18. Arrowheads point to fluorescence enrichment at the plasma membrane. Fluorescence intensity in arbitrary units (AU) across the PT shank(10 μm-long blue lines) or across the PT tip (10 μm-long purple lines),as provided below each PT, shows a similar fluorescence distribution for GFP-CNGC18, ANX1-YFP and ANX2-YFP. Scale bar: 5 μm.

Fig. 2.

ANX1-YFP and ANX2-YFP fusion proteins localize polarly to the plasma membrane of growing pollen tube tips. Fluorescence micrographs of actively growing pollen tubes (PTs) of Arabidopsis transgenic lines expressing YFP, ACA9-YFP, GFP-CNGC18, ANX1-YFP and ANX2-YFP constructs under the control of the pollen-specific ACA9 promoter. Unlike the uniform plasma membrane localization of ACA9-YFP along the PT, ANX1-YFP and ANX2-YFP fusions display polar plasma membrane localization at the tip of growing PTs, similar to GFP-CNGC18. Arrowheads point to fluorescence enrichment at the plasma membrane. Fluorescence intensity in arbitrary units (AU) across the PT shank(10 μm-long blue lines) or across the PT tip (10 μm-long purple lines),as provided below each PT, shows a similar fluorescence distribution for GFP-CNGC18, ANX1-YFP and ANX2-YFP. Scale bar: 5 μm.

Single T-DNA insertional mutants of ANXUR1 and ANXUR2 do not exhibit any phenotype

To further elucidate the role of the ANX-RLKs, we isolated two single T-DNA insertional mutants for each of the ANX-RLKs, namely anx1-1 and anx1-2 for ANX1 and anx2-1 and anx2-2 for ANX2 (Fig. 3A), from the Salk Institute Genomic Analysis Laboratory Database (SIGnAL; La Jolla, CA,USA) (Alonso et al., 2003). RT-PCR analysis from open-flower cDNAs indicated that for each of the anx1 and anx2 alleles, the T-DNA insertions disrupted ANX-RLK gene expression (Fig. 3B). We anticipated that ANX1 and ANX2 would function redundantly in pollen because (1) ANX1 and ANX2 share 85.6% identity at the amino acid level and define a subgroup of the CrRLK1L subfamily(Hematy and Höfte, 2008);(2) the ANX1-YFP and ANX2-YFP fusion proteins show overlapping localization patterns; and (3) the ANX-RLK genes are highly and preferentially expressed in pollen. Indeed, despite the lack of ANX-RLK gene expression, none of the four single T-DNA insertion mutants displayed any obvious phenotype in vegetative or reproductive tissues, seed set, or in PT growth assays in vitro and in vivo(see below).

anx1 anx2 double mutants exhibit segregation ratio distortion and are male gametophyte specific

By crossing the single anx1 and anx2 mutants, we attempted to generate two independent anx1-1 anx2-1 and anx1-2 anx2-2 double mutants, as well as the semi-independent anx1-1 anx2-2 double mutant. However, after genotyping 175 progeny of the F1 crosses, no double-homozygous mutants could be identified. Therefore, we decided to first isolate plants homozygous for one anx mutation and heterozygous for the second. Interestingly, all these plants, namely anx1-1/anx1-1 anx2-1/ANX2, anx1-1/ANX1 anx2-2/anx2-2 and anx1-2/anx1-2 anx2-2/ANX2, exhibited a moderately reduced seed set compared with the wild type (see Table S1 in the supplementary material). Furthermore, upon self-fertilization, these plants displayed a segregation ratio of the anx1 anx2 mutants to wild type of ∼1:1(Table 2)(χ2=1.073, 0.3>P>0.2), indicative of a gametophytic defect (Howden et al.,1998; Moore et al.,1997). To determine the transmission efficiency (TE) of the anx1 anx2 mutations, we performed reciprocal crosses of the independent anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 mutants to the wild type. Although transmission through the female gametophyte was not significantly affected(Table 3) (TEF=78%for anx1-1 anx2-1, χ2=1.11, 0.3>P>0.2;TEF=86% for anx1-2 anx2-2, χ2=0.45,0.7>P>0.5), we did not observe transmission of the anx1-1 anx2-1 (n=99) and anx1-2 anx2-2 (n=90)mutations through the male gametophyte(Table 3), demonstrating that anx1 anx2 double mutants are specific to the male gametophyte.

Table 2.

Segregation analysis of anx mutations by PCR-based genotyping of the progeny derived from self-fertilization

Genotypeanx1/anx1 ANX2/ANX2 or ANX1/ANX1 anx2/anx2anx1/anx1 anx2/ANX2 or anx1/ANX1 anx2/anx2anx1/anx1 anx2/anx2Ratio of anx1 anx2:WT
anx1-1/anx1-1 anx2-1/ANX2 60 39 0.65:1 
anx1-1/ANX1 anx2-2/anx2-2 39 33 0.85:1 
anx1-2/anx1-2 anx2-2/ANX2 62 70 1.13:1 
Genotypeanx1/anx1 ANX2/ANX2 or ANX1/ANX1 anx2/anx2anx1/anx1 anx2/ANX2 or anx1/ANX1 anx2/anx2anx1/anx1 anx2/anx2Ratio of anx1 anx2:WT
anx1-1/anx1-1 anx2-1/ANX2 60 39 0.65:1 
anx1-1/ANX1 anx2-2/anx2-2 39 33 0.85:1 
anx1-2/anx1-2 anx2-2/ANX2 62 70 1.13:1 

WT, wild type.

nd, not determined.

Table 3.

Segregation analysis of anx mutations by PCR-based genotyping of the progeny resulting from reciprocal crosses with the wild type(Col-0)

Female × maleanx1/ANX1 ANX2/ANX2 (a)anx1/ANX1 anx2/ANX2 (b)TE (%)
anx1-1/anx1-1 anx2-1/ANX2 × Col-0 41 32 78 
anx1-2/anx1-2 anx2-2/ANX2 × Col-0 43 37 86 
Col-0 × anx1-1/anx1-1 anx2-1/ANX2 99 
Col-0 × anx1-2/anx1-2 anx2-2/ANX2 90 
Female × maleanx1/ANX1 ANX2/ANX2 (a)anx1/ANX1 anx2/ANX2 (b)TE (%)
anx1-1/anx1-1 anx2-1/ANX2 × Col-0 41 32 78 
anx1-2/anx1-2 anx2-2/ANX2 × Col-0 43 37 86 
Col-0 × anx1-1/anx1-1 anx2-1/ANX2 99 
Col-0 × anx1-2/anx1-2 anx2-2/ANX2 90 

TE, transmission efficiency: TE=(b/a)×100%.

As shown in Table 2, one double-homozygous anx1-2 anx2-2 mutant plant was recovered from the progeny of a self-fertilized anx1-2/anx1-2 anx2-2/ANX2 plant. Although no difference was observed in the vegetative tissues of anx1-2 anx2-2 compared with the wild type, anx1-2 anx2-2 was almost completely sterile, producing only 11 seeds from 277 siliques(Fig. 3C). However, unlike male-sterile dde2-2 mutant flowers, which display a defect in filament elongation and anther dehiscence(von Malek et al., 2002), anx1-2 anx2-2 flowers were normal, with obvious signs of dehiscence and self-pollination (Fig. 3D). When wild-type pollen was deposited on anx1-2 anx2-2 pistils,siliques elongated (Fig. 3C,arrows) (n=14 crosses) and were filled normally (see Table S1 in the supplementary material), consistent with anx1 anx2 mutations not affecting the female gametophyte. Conversely, deposition of anx1-2 anx2-2 pollen on dde2-2 pistils did not produce any seeds,whereas pollen from anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 plants led to silique elongation and a normal seed set (see Fig. S3 and Table S1 in the supplementary material) (n=12 crosses for each genotype). When anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 plants were manually self-pollinated or used either as male donor or female receiver in crosses with the wild type, the resulting siliques were always filled normally (see Table S1 in the supplementary material). This suggests that during natural self-pollination of these plants (∼80% seed set), single anx mutant pollen can only partially compensate for the inability of anx double-mutant pollen to reach female gametophytes(see below), whereas the large excess of pollen present during manual pollination leads to full compensation (∼92% seed set).

In conclusion, our data provide compelling genetic evidence that the anx1 anx2 double mutant is male sterile, with very rare transmission of the anx1 anx2 mutation through the male gametophyte. Thus, ANX1 and ANX2 function redundantly in the male gametophyte.

Spontaneous discharge of anx1 anx2 pollen tubes in vitro

To investigate the reason for the transmission failure of anx1 anx2 mutations through the male gametophyte, we first carried out in vitro PT growth assays for the different single and double anxmutants and visualized pollen growth 5 hours after incubation. Surprisingly,unlike the wild type and single anx mutants, approximately half of the germinated pollen from anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 plants had burst in vitro after forming a bulge, whereas the other half formed normally growing PTs(Fig. 4A; Table 4). Germinated pollen from the two independent anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 mutant alleles was either able to produce normal PTs or to burst in the 1:1 ratio expected for segregation of the anx1 anx2 mutations (Table 4) (for anx1-1/anx1-1 anx2-1/ANX22=0.03, 0.9>P>0.8; for anx1-2/anx1-2 anx2-2/ANX2, χ2=0.018, 0.95>P>0.9). Consistently, all the germinated pollen from the double-homozygous anx1-2 anx2-2 plants burst to leave traces of cytoplasmic and membrane contents outside the pollen (Fig. 4A; Table 4). Time-lapse imaging of pollen grown in vitro indicated that discharge of the anx1 anx2mutant pollen started after 1 hour of incubation on germination medium and occurred within 1 second (Fig. 4B; see Movie 3 and Fig. S4A in the supplementary material). The frequency of pollen discharge gradually increased from 0% initially(n=198) to 39.1% at 2 hours (n=289), 59.9% at 3 hours(n=142), 73% at 4 hours (n=100), and eventually reached 93.2% at 8 hours of in vitro incubation (n=192). Closer examination of the anx1 anx2 mutant pollen 3 hours after incubation indicated that 59.8% of the grains that had burst had formed a bulge (between 2 and 5μm in length), 13.8% an emerging tip (between 5 and 10 μm) and 3.4% a clear PT longer than 10 μm (see Fig. S4B in the supplementary material)before discharging (n=174). We could not discriminate between the absence of a bulge and bulge formation behind the grain (and therefore not visible) in the remaining 23% of the pollen grains that had burst. When an emerging tip or PT was formed, first the tube ceased its growth, then the discharge occurred in the subapical region of the tip, rather than at the apex itself (Fig. 4B; see Movie 3 in the supplementary material). Astonishingly, pollen discharge did not always result in immediate death of the pollen, as evidenced by residual cytoplasmic streaming that could last for several hours and, occasionally, pollen could discharge several times (see Fig. S4A and Movie 4 in the supplementary material). These results provide strong evidence that disruption of ANX1 and ANX2 triggers spontaneous discharge of the germinating pollen in vitro.

Table 4.

Segregation analysis of spontaneous pollen tube discharge after 5 hours of growth in vitro

GenotypeIntact PTsPT dischargeTotal pollen germinatedNon-germinated pollen% Pollen germination% PT discharge
Col-0 583 591 248 70.8 1.4 
anx1-1/anx1-1 249 253 61 80.6 1.6 
anx2-1/anx2-1 221 227 81 73.7 2.6 
anx1-1/anx1-1 anx2-1/ANX2 243 246 489 174 73.8 50.3 
anx1-2/anx1-2 anx2-2/ANX2 245 249 494 186 72.6 50.4 
anx1-2/anx1-2 anx2-2/anx2-2 561 561 106 84.1 100 
GenotypeIntact PTsPT dischargeTotal pollen germinatedNon-germinated pollen% Pollen germination% PT discharge
Col-0 583 591 248 70.8 1.4 
anx1-1/anx1-1 249 253 61 80.6 1.6 
anx2-1/anx2-1 221 227 81 73.7 2.6 
anx1-1/anx1-1 anx2-1/ANX2 243 246 489 174 73.8 50.3 
anx1-2/anx1-2 anx2-2/ANX2 245 249 494 186 72.6 50.4 
anx1-2/anx1-2 anx2-2/anx2-2 561 561 106 84.1 100 

anx1 anx2 pollen germinates normally in vivo on stigmas but fails to reach the female gametophytes

To corroborate the in vitro defect of anx1 anx2 pollen, an in vivo analysis of PT growth was carried out using Aniline Blue staining. First,pollination experiments with a limited amount of pollen were performed, with∼4-16 anx1-1/anx1-1, anx2-1/anx2-1, anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 mutant pollen grains deposited on wild-type pistils. Eighteen hours after pollination, pistils were stained with Aniline Blue to reveal callose deposition in the PTs. First, no difference was observed for the pollen germination rate on the stigma between single and double segregating anx mutants(Table 5; Fig. 5A), indicating that anx1 anx2 pollen grains are able to germinate and produce PTs in vivo. Secondly, we attempted to visually locate the tip of each PT in order to assign it to either of two classes: (1) wandering in the transmitting tract or(2) targeting an ovule. When pollen grains from single anx mutants were used, tips could be clearly identified for ∼86% of the growing PTs(Table 5; Fig. 5A, left panel). By contrast, tips could be located for only ∼47% of anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 mutant PTs(Table 5; Fig. 5A, right panel). These results suggest that anx1 anx2 mutant PTs are unable to reach the locules of the ovary.

Table 5.

Location of pollen tube tips after pollination of wild-type pistils with a small number of pollen grains

Pollen genotypeTotal PGPG germinated% Pollen germinationTip in micropyleTip in ovary locules% Tip not located
anx1-1/anx1-1 109 91 83.5 58 21 13.2 
anx2-1/anx2-1 93 70 75.4 39 20 15.7 
anx1-1/anx1-1 anx2-1/ANX2 112 86 76.8 27 15 51.2 
anx1-2/anx1-2 anx2-2/ANX2 124 98 79 31 12 56.1 
Pollen genotypeTotal PGPG germinated% Pollen germinationTip in micropyleTip in ovary locules% Tip not located
anx1-1/anx1-1 109 91 83.5 58 21 13.2 
anx2-1/anx2-1 93 70 75.4 39 20 15.7 
anx1-1/anx1-1 anx2-1/ANX2 112 86 76.8 27 15 51.2 
anx1-2/anx1-2 anx2-2/ANX2 124 98 79 31 12 56.1 

PG, pollen grain.

Fig. 3.

Double-homozygous anx1-2 anx2-2 mutant plants are male sterile. (A) The genomic organization of the intron-less ANX1 and ANX2 genes and positions of the anx1-1, anx1-2,anx2-1 and anx2-2 T-DNA insertions. The orientation of the left border sequence of the respective T-DNAs is represented by black arrows. The positions of the primers used to genotype the mutants are indicated.(B) RT-PCR analysis from open-flower cDNAs shows no ANX1transcripts in the ANX1 T-DNA disruption lines anx1-1 and anx1-2 and no ANX2 transcripts in the ANX2 T-DNA disruption lines anx2-1 and anx2-2. ACT7 was used as a control. Amplification was performed for 28 cycles for ACT7 and for 34 cycles for ANX1 and ANX2. (C) The double-homozygous anx1-2 anx2-2 mutant plant shows normal vegetative development, but only short pistils were observed that never developed further into siliques. This phenotype was completely reversible when wild-type pollen was used to pollinate anx1-2 anx2-2 pistils (white arrows). Conversely, when pollen from anx1-2 anx2-2 plants was deposited on dde2-2 pistils, no siliques or seeds developed (see Fig. S3 in the supplementary material). (D) Unlike male-sterile dde2-2 mutant flowers, the filaments and anthers of which fail to elongate and release pollen, anx1-2 anx2-2 flowers were normal, anthers dehisced, and pistils were efficiently self-pollinated (black arrow). Scale bar: 1 mm.

Fig. 3.

Double-homozygous anx1-2 anx2-2 mutant plants are male sterile. (A) The genomic organization of the intron-less ANX1 and ANX2 genes and positions of the anx1-1, anx1-2,anx2-1 and anx2-2 T-DNA insertions. The orientation of the left border sequence of the respective T-DNAs is represented by black arrows. The positions of the primers used to genotype the mutants are indicated.(B) RT-PCR analysis from open-flower cDNAs shows no ANX1transcripts in the ANX1 T-DNA disruption lines anx1-1 and anx1-2 and no ANX2 transcripts in the ANX2 T-DNA disruption lines anx2-1 and anx2-2. ACT7 was used as a control. Amplification was performed for 28 cycles for ACT7 and for 34 cycles for ANX1 and ANX2. (C) The double-homozygous anx1-2 anx2-2 mutant plant shows normal vegetative development, but only short pistils were observed that never developed further into siliques. This phenotype was completely reversible when wild-type pollen was used to pollinate anx1-2 anx2-2 pistils (white arrows). Conversely, when pollen from anx1-2 anx2-2 plants was deposited on dde2-2 pistils, no siliques or seeds developed (see Fig. S3 in the supplementary material). (D) Unlike male-sterile dde2-2 mutant flowers, the filaments and anthers of which fail to elongate and release pollen, anx1-2 anx2-2 flowers were normal, anthers dehisced, and pistils were efficiently self-pollinated (black arrow). Scale bar: 1 mm.

Fig. 4.

In vitro pollen growth assays reveal that anx1 anx2 mutant pollen tubes discharge spontaneously. (A) (Top row) Five hours after incubation in vitro, wild-type pollen germinated very well and produced actively growing PTs. By contrast, anx1-2/anx1-2 anx2-2/anx2-2 mutant pollen grew very poorly, and segregating anx1-1/anx1-1 anx2-1/ANX2and anx1-2/anx1-2 anx2-2/ANX2 mutant pollen exhibited an intermediate pollen growth phenotype. (Bottom row) Higher magnification reveals that all the germinated anx1-2/anx1-2 anx2-2/anx2-2 mutant pollen had burst. Germinated pollen from independent anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 mutant alleles either produced actively growing PTs or burst, phenotypes that were observed in a 1:1 ratio as expected for segregation of anx1 anx2 pollen grains. Pollen donor genotype is indicated at the top. (B) Time-lapse imaging of anx1-2 anx2-2mutant pollen in vitro showed that pollen discharge is an explosive phenomenon that occurs in less than 1 second after formation of either bulges or an emerging tip, or more rarely a real PT (see also Fig. S4 and Movie 3 in the supplementary material). Note that the PT stopped elongating. White arrows indicate the location of the discharge at the subapical region of the PT tip,rather than at the tip itself. Time is indicated in minutes:seconds. Scale bars: 50 μm in top row in A; 25 μm in bottom row in A; 5 μm in B.

Fig. 4.

In vitro pollen growth assays reveal that anx1 anx2 mutant pollen tubes discharge spontaneously. (A) (Top row) Five hours after incubation in vitro, wild-type pollen germinated very well and produced actively growing PTs. By contrast, anx1-2/anx1-2 anx2-2/anx2-2 mutant pollen grew very poorly, and segregating anx1-1/anx1-1 anx2-1/ANX2and anx1-2/anx1-2 anx2-2/ANX2 mutant pollen exhibited an intermediate pollen growth phenotype. (Bottom row) Higher magnification reveals that all the germinated anx1-2/anx1-2 anx2-2/anx2-2 mutant pollen had burst. Germinated pollen from independent anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 mutant alleles either produced actively growing PTs or burst, phenotypes that were observed in a 1:1 ratio as expected for segregation of anx1 anx2 pollen grains. Pollen donor genotype is indicated at the top. (B) Time-lapse imaging of anx1-2 anx2-2mutant pollen in vitro showed that pollen discharge is an explosive phenomenon that occurs in less than 1 second after formation of either bulges or an emerging tip, or more rarely a real PT (see also Fig. S4 and Movie 3 in the supplementary material). Note that the PT stopped elongating. White arrows indicate the location of the discharge at the subapical region of the PT tip,rather than at the tip itself. Time is indicated in minutes:seconds. Scale bars: 50 μm in top row in A; 25 μm in bottom row in A; 5 μm in B.

To confirm this, normal pollination of wild-type pistils by pollen of either wild-type (n=12 pistils) or double-homozygous anx1-2 anx2-2 (n=12 pistils) plants was performed. Eighteen hours after pollination, wild-type PTs had grown through the entire style and transmitting tract of all pistils and were targeting the ovules normally(Fig. 5B, left panel). By contrast, the majority of anx1-2 anx2-2 PTs were arrested between the stigma and the style or in the style itself, with a few exceptional PTs(n=12 out of more than 500) that reached the top of the ovary locule(Fig. 5B, right panel). However, within the twelve pollinated pistils, not a single female gametophyte was targeted by anx1-2 anx2-2 PTs, consistent with the fact that the anx1-2 anx2-2 plant produced only 11 seeds. In conclusion, our results strongly suggest that anx1 anx2 mutant pollen grains are able to germinate and produce PTs that will eventually burst in the style, long before reaching and fertilizing the female gametophytes.

Fig. 5.

anx1 anx2 pollen germinate normally on stigma but produce pollen tubes that fail to reach the female gametophytes. (A)Aniline Blue staining of wild-type pistils pollinated with a few anx2-1 single-mutant (left) or anx1-1/anx1-1 anx2-1/ANX2double-mutant (right) pollen grains. Eighteen hours after pollination, most of the tips of anx2-1 PTs (left) were observed in the ovary locules(rectangle). By contrast, only about half of the tips of germinated (arrows) anx1-1/anx1-1 anx2-1/ANX2 PTs (arrowheads) were found in the ovary locules. (B) Aniline Blue staining of wild-type pistils pollinated with numerous wild-type (left) or anx1-2 anx2-2 double-homozygous mutant(right) pollen grains. Eighteen hours after manual pollination, wild-type PTs(left) had grown through the entire pistil to reach the micropyles of the ovules (asterisks). Although they germinated on the stigma, most of the anx1-2 anx2-2 mutant PTs (right) were arrested in the style, with only very few having reached the top end of the ovary (arrows). The boxed regions are shown at high magnification below and reveal the very low density of anx1-2 anx2-2 PTs (right) in the transition zone between the style and the ovary locules in comparison to wild-type PTs (left). Scale bars: 100μm in A and in top row in B; 25 μm in bottom row in B.

Fig. 5.

anx1 anx2 pollen germinate normally on stigma but produce pollen tubes that fail to reach the female gametophytes. (A)Aniline Blue staining of wild-type pistils pollinated with a few anx2-1 single-mutant (left) or anx1-1/anx1-1 anx2-1/ANX2double-mutant (right) pollen grains. Eighteen hours after pollination, most of the tips of anx2-1 PTs (left) were observed in the ovary locules(rectangle). By contrast, only about half of the tips of germinated (arrows) anx1-1/anx1-1 anx2-1/ANX2 PTs (arrowheads) were found in the ovary locules. (B) Aniline Blue staining of wild-type pistils pollinated with numerous wild-type (left) or anx1-2 anx2-2 double-homozygous mutant(right) pollen grains. Eighteen hours after manual pollination, wild-type PTs(left) had grown through the entire pistil to reach the micropyles of the ovules (asterisks). Although they germinated on the stigma, most of the anx1-2 anx2-2 mutant PTs (right) were arrested in the style, with only very few having reached the top end of the ovary (arrows). The boxed regions are shown at high magnification below and reveal the very low density of anx1-2 anx2-2 PTs (right) in the transition zone between the style and the ovary locules in comparison to wild-type PTs (left). Scale bars: 100μm in A and in top row in B; 25 μm in bottom row in B.

DISCUSSION

ANX1 and ANX2 receptor-like kinases are required for maintenance of pollen tube growth

Our analyses have shown that ANX1 and ANX2 play a role in PT discharge, but they are not required for pollen germination, as in vitro no fewer than 77% of the anx1 anx2 double-mutant pollen at least formed a bulge prior to bursting. Consistent with this, anx1 anx2double-mutant pollen grains germinate normally on the stigmatic cells in vivo. However, in vitro, as soon as they have established polar tip growth, the pollen bulges, tips or tubes rapidly and systematically explode, such that PTs longer than 10 μm are an exception. These results indicate that ANX-RLKs are required for the maintenance of PT growth in vitro. In vivo, anx1 anx2 PTs can grow over a longer distance (>60 μm), as they generally grow through the entire stigma, arresting in the style. This observation illustrates the beneficial effect of the female sporophytic tissues on PT growth during compatible interactions(Crawford and Yanofsky, 2008; Higashiyama et al., 1998; Johnson and Lord, 2006; Palanivelu and Preuss, 2006). However, in the in vivo analyses, anx1 anx2 PTs very rarely reached the locules of the ovary (n=12 out of more than 500) and none of these PTs targeted a female gametophyte. Consistent with this, the double-homozygous anx1-2 anx2-2 mutant plant produced only 11 seeds out of 277 siliques analyzed. In segregating anx double mutant plants, single anx mutant PTs can compensate for the inability of double anx mutant PTs to reach the female gametophytes (see Table S1 in the supplementary material).

To date, only the Arabidopsis vanguard1 (vgd1) mutant has been reported to exhibit a phenotype similar to that triggered by the disruption of the ANX-RLKs, although the defects appear milder(Jiang et al., 2005). In vivo, vgd1 mutant PTs germinate normally and arrest only in the transmitting tract. However, vgd1 PTs more easily and frequently reach the ovary locules and female gametophytes than anx1 anx2 PTs. Consequently, each silique of homozygous vgd1 mutant plants produces a few seeds (Jiang et al.,2005). Although less well documented, vgd1 mutant pollen has also been reported to germinate and burst in vitro(Jiang et al., 2005). Interestingly, VGD1 is strongly expressed in pollen and encodes a wall-localized pectin methylesterase (PME; E.C. 3.1.1.11)(Jiang et al., 2005). PMEs catalyze the specific demethylesterification of the linear homopolymer(1,4)-linked-α-d-galacturonic acid homogalaturonan (HGA), a major pectic constituent of the cell wall(Micheli, 2001; Pelloux et al., 2007; Willats et al., 2001). HGA is deposited in a highly methyl-esterified form in the cell wall and is subsequently demethylesterified in muro by PMEs, the activities of which are regulated by PME inhibitor (PMEI) proteins(Juge, 2006). The degree of esterification of pectins is essential for cell wall mechanics, as unesterified pectins are able to bind Ca2+ and induce pectin gelation, which rigidifies the cell wall(Willats et al., 2001). Consistent with this, the PME multigene family functions in a wide range of organs, tissues and processes related to plant defense and cell elongation(Pelloux et al., 2007). Besides VGD1, the involvement of PMEs and PMEIs in PT growth is well documented (for reviews, see Chebli and Geitmann, 2007; Cheung and Wu,2008; Krichevsky et al.,2007; Zonia and Munnik,2009). Indeed, pectins are the major, polarly distributed constituent of the PT cell wall (Li et al., 1994). At the tip of the PT, where expansibility is required for polarized tip growth and where pectins are secreted, the methyl-esterified pectic `loose' forms are predominant, whereas in the lateral regions of the tube wall that need to be more resistant, esterified 'rigid' pectins are prevalent (Bosch and Hepler,2005; Bosh et al., 2005; Li et al., 1994; Parre and Geitmann,2005). Interestingly, this polar distribution could well be the consequence of the interactions between PMEs and PMEIs at the PT tip, whereas in the lateral region of the PT wall only PMEs appear to be present(Röckel et al.,2008).

Upon in vitro germination, anx1 anx2 PT growth prematurely terminates, followed by tip rupture. Despite bursting, cytoplasmic streaming remained active and new bulges were often produced, which subsequently burst. This suggests that ANX-RLKs are not driving PT growth per se, but are rather required to sustain PT growth and prevent discharge. With the identification of more than 50 mutations that affect pollen germination, PT growth and shape(Cheung and Wu, 2008), it is surprising that only vgd1 and anx1 anx2 mutations systematically lead to PT bursting. Although unlikely, the in vitro and in vivo phenotypic similarities of anx and vgd1 PTs could be circumstantial. However, given the importance of the balance between esterified and de-esterified pectins for PT growth, how the ANX-RLKs and PME/PMEIs are interrelated is of interest. One among many possible models is that once polar tip growth has been established, ANX-RLKs are secreted to the plasma membrane at the PT tip to monitor the cell wall status or sense external stimuli. This information is relayed to the interior by the ANX-RLKs to control the synthesis of specific cell wall material via regulation of cell wall modifying enzymes such as PMEs and PMEIs. Therefore, it would be interesting to analyze the cell wall composition and mechanical properties of anx and vgd1 mutant PTs.

FERONIA and ANXUR-RLKs, the perfect match to control pollen tube reception?

Our results show that anx1 anx2 mutant PTs burst in vitro and are most likely to do so in vivo as well. Time-lapse imaging indicates that this process is explosive and rapid, as the expulsed intracellular content can regularly be found as far as 40 μm from the rupture site and occurs within 1 second. Moreover, when PTs were formed in vitro, they first ceased to grow then burst at the subapical region of the PT tip. Interestingly, these characteristics are reminiscent of the explosive discharge of PTs in the synergid cells of the female gametophyte during PT reception(Higashiyama et al., 2000; Palanivelu and Preuss, 2006; Rotman et al., 2003; Sandaklie-Nikolova et al.,2007).

ANX1 and ANX2 are the closest homologs of FER in Arabidopsis,displaying an overall 55.1% identity at the amino acid level to FER, which increases up to 77.5% for the kinase domain (see Fig. S1A in the supplementary material). FER is strongly expressed in the synergids of the female gametophyte and encodes a RLK that is polarly localized towards the filiform apparatus, which is the entry point of the PT into the synergid(Escobar-Restrepo et al.,2007). Moreover, fer mutant female gametophytes are unable to be fertilized, as PTs approaching them do not arrest their growth and fail to rupture, showing that FER inhibits PT growth and positively regulates PT discharge (Huck et al., 2003; Rotman et al.,2003). Besides its strong expression in synergids, FER is also widely expressed in vegetative tissues but not in pollen(Escobar-Restrepo et al.,2007; Guo et al.,2009). Conversely, ANX1 and ANX2 are strongly expressed in the male gametophyte and ANX-YFP fusion proteins are polarly localized in the plasma membrane of the growing PT tip, the contact point with the filiform apparatus during PT reception. Therefore, one might expect that ANX1 and ANX2 play a similar role in the PT as FER does in the female gametophyte, i.e. to negatively regulate PT growth. Surprisingly, we provide compelling evidence that ANX1 and ANX2 function in exactly the opposite way,as disruption of ANX1 and ANX2 leads to PT growth arrest and discharge. Therefore, we propose a new model for PT reception based on the phenotypes of the1, herk1, fer (see below) and anx mutants, as well as on live imaging of PT reception in Arabidopsis(Escobar-Restrepo et al.,2007; Huck et al.,2003; Palanivelu and Preuss,2006; Rotman et al.,2003; Sandaklie-Nikolova et al., 2007). Once the polar tip growth is established, we propose that ANX-RLKs are secreted to the PT tip to monitor the status of the cell wall and sustain growth within the female tissues until PTs reach the female gametophytes. Upon contact at the filiform apparatus, first, the female FER-dependent signaling cascade is activated allowing the female gametophyte to prepare itself for fertilization. Subsequently, the male ANX-dependent signaling process is deactivated, enabling the PT to arrest growth, to rupture and deliver the sperm cells to effect fertilization. Alternatively, ANX-RLKs could also function to maintain PT integrity during growth within the female tissues without playing any specific role during PT reception.

The CrRLK1L family appears to be specialized in the control of cell elongation in diverse contexts

ANX1 and ANX2 define a subgroup of the receptor-like serine-threonine kinase CrRLK1 subfamily in Arabidopsis(Hematy and Höfte, 2008)and have close homologs in various dicotyledonous and monocotyledonous species(see Fig. S5 in the supplementary material). Out of the 17 Arabidopsis CrRLK1 subfamily members, five (ANX1, ANX2, FER,HERK1 and THE1) have been characterized and all are proposed to function in the control of cell elongation during various processes. HERK1, THE1 and FER have been reported to be required for optimum cell elongation in hypocotyls and petioles, as herk1 the1double-mutant and FER knockdown transgenic lines all exhibit dwarf phenotypes (Guo et al., 2009). However, disruption of THE1 in several cellulose synthase-deficient backgrounds promotes cell elongation(Hematy et al., 2007),demonstrating that THE1 can regulate cell elongation both positively and negatively. Unlike HERK1, THE1 and FER, ANX1 and ANX2 appear to function specifically in the male gametophyte but not in vegetative tissues. An anx1 anx2 double-mutant plant was neither stunted nor did it exhibit any vegetative phenotypes, consistent with the preferential expression of ANX1 and ANX2 in pollen. However,we cannot exclude the possibility that anx1 anx2 mutants exhibit discrete vegetative phenotypes or that the role of ANX1 and ANX2 during vegetative growth can only be revealed in some cell wall-damaged mutant backgrounds, as has been shown for THE1(Hematy et al., 2007). Interestingly, in addition to the similar phenotypes of anx1 anx2 and PME-deficient vgd1 mutant PTs, THE1 and HERK1 have been reported to influence the expression of some cell wall-modifying enzymes,including expansins and PMEs (Guo et al.,2009; Hematy et al.,2007).

The extracellular domains of the CrRLK1L subfamily members do not exhibit any homology with domains of known function and no ligands have yet been identified for any of its members. Therefore, the nature of the ligand(s) for the extracellular domains of CrRLK1L subfamily RLKs cannot be predicted. The identification of the first ligand, as well as the intracellular interacting partners, for any CrRLK1L subfamily member will undoubtedly shed light on the very important mechanisms that tightly control the relationship between cell wall composition, cell elongation and cell-cell communication during plant growth.

Note added in proof

Saori Miyazaki and colleagues have recently reported similar findings on ANXUR1 and ANXUR2(Miyazaki et al., 2009).

We thank Tae-Houn Kim, Maik Bohmer, Noriyuki Nishimura (University of California, San Diego, CA, USA), Sharon Kessler, Christian Draeger, Celia Baroux, Quy Ngo, Valeria Gagliardini, Christoph Ringli and Christof Eichenberger (University of Zürich, Switzerland) for enriching discussions or technical support; Jeffrey Harper (University of Nevada, Reno,NV, USA) for providing ps779, pACA9-ACA9-YFP and pACA9-GFP-CNGC18 transgenic lines; Mayank Pururawa (UZH) for providing dde2-2 plants; and Mitsuyasu Hasebe and Saori Miyazaki for exchanging information prior to publication. This work was supported by the Research Priority Program in Functional Genomics/Systems Biology of the University of Zürich, and grants from the National Institutes of Health (R01 GM060396) and the National Science Foundation USA (MCB 0417118) to J.I.S., and from the Swiss National Science Foundation(31003A-112489) and SystemsX.ch (Plant Growth) to U.G. Deposited in PMC for release after 12 months.

References

Alonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J.,Chen, H., Shinn, P., Stevenson, D. K., Zimmerman, J., Barajas, P., Cheuk, R. et al. (
2003
). Genome-wide insertional mutagenesis of Arabidopsis thaliana.
Science
301
,
653
-657.
Becker, J. D., Boavida, L. C., Carneiro, J., Haury, M. and Feijo, J. A. (
2003
). Transcriptional profiling of Arabidopsis tissues reveals the unique characteristics of the pollen transcriptome.
Plant Physiol.
133
,
713
-725.
Berger, F., Hamamura, Y., Ingouff, M. and Higashiyama, T.(
2008
). Double fertilization-caught in the act.
Trends Plant Sci.
13
,
437
-443.
Boavida, L. C. and McCormick, S. (
2007
). Temperature as a determinant factor for increased and reproducible in vitro pollen germination in Arabidopsis thaliana.
Plant J.
52
,
570
-582.
Boavida, L. C., Vieira, A. M., Becker, J. D. and Feijo, J. A. (
2005
). Gametophyte interaction and sexual reproduction:how plants make a zygote.
Int. J. Dev. Biol.
49
,
615
-632.
Boisson-Dernier, A., Frietsch, S., Kim, T. H., Dizon, M. B. and Schroeder, J. I. (
2008
). The peroxin loss-of-function mutation abstinence by mutual consent disrupts male-female gametophyte recognition.
Curr. Biol.
18
,
63
-68.
Borges, F., Gomes, G., Gardner, R., Moreno, N., McCormick, S.,Feijo, J. A. and Becker, J. D. (
2008
). Comparative transcriptomics of Arabidopsis sperm cells.
Plant Physiol.
148
,
1168
-1181.
Bosch, M. and Hepler, P. K. (
2005
). Pectin methylesterases and pectin dynamics in pollen tubes.
Plant Cell
17
,
3219
-3226.
Bosch, M., Cheung, A. Y. and Hepler, P. K.(
2005
). Pectin methylesterase, a regulator of pollen tube growth.
Plant Physiol.
138
,
1334
-1346.
Capron, A., Gourgues, M., Neiva, L. S., Faure, J. E., Berger,F., Pagnussat, G., Krishnan, A., Alvarez-Mejia, C., Vielle-Calzada, J. P.,Lee, Y. R. et al. (
2008
). Maternal control of male-gamete delivery in Arabidopsis involves a putative GPI-anchored protein encoded by the LORELEI gene.
Plant Cell
20
,
3038
-3049.
Chebli, Y. and Geitmann, A. (
2007
). Mechanical principles governing pollen tube growth.
Funct. Plant Sci. Biotechnol.
1
,
232
-245.
Chen, Y. H., Li, H. J., Shi, D. Q., Yuan, L., Liu, J.,Sreenivasan, R., Baskar, R., Grossniklaus, U. and Yang, W. C.(
2007
). The central cell plays a critical role in pollen tube guidance in Arabidopsis.
Plant Cell
19
,
3563
-3577.
Cheung, A. Y. and Wu, H. M. (
2008
). Structural and signaling networks for the polar cell growth machinery in pollen tubes.
Annu. Rev. Plant Biol.
59
,
547
-572.
Clough, S. J. and Bent, A. F. (
1998
). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J.
16
,
735
-743.
Crawford, B. C. and Yanofsky, M. F. (
2008
). The formation and function of the female reproductive tract in flowering plants.
Curr. Biol.
18
,
R972
-R978.
Dong, J., Kim, S. T. and Lord, E. M. (
2005
). Plantacyanin plays a role in reproduction in Arabidopsis.
Plant Physiol.
138
,
778
-789.
Dresselhaus, T. (
2006
). Cell-cell communication during double fertilization.
Curr. Opin. Plant Biol.
9
,
41
-47.
Dumas, C. and Rogowsky, P. (
2008
). Fertilization and early seed formation.
C. R. Biol.
331
,
715
-725.
Escobar-Restrepo, J. M., Huck, N., Kessler, S., Gagliardini, V.,Gheyselinck, J., Yang, W. C. and Grossniklaus, U. (
2007
). The FERONIA receptor-like kinase mediates male-female interactions during pollen tube reception.
Science
317
,
656
-660.
Feys, B. J., Wiermer, M., Bhat, R. A., Moisan, L. J.,Medina-Escobar, N., Neu, C., Cabral, A. and Parker, J. E.(
2005
). Arabidopsis SENESCENCE-ASSOCIATED GENE101 stabilizes and signals within an ENHANCED DISEASE SUSCEPTIBILITY1 complex in plant innate immunity.
Plant Cell
17
,
2601
-2613.
Frietsch, S., Wang, Y. F., Sladek, C., Poulsen, L. R.,Romanowsky, S. M., Schroeder, J. I. and Harper, J. F. (
2007
). A cyclic nucleotide-gated channel is essential for polarized tip growth of pollen.
Proc. Natl. Acad. Sci. USA
104
,
14531
-14536.
Funke, C. P. (
1801
).
Neues Real-Schullexicon enthaltend die zur Erklärung der alten Klassiker nothwendigen Hülfswissenschaften, vernämlich Geographie, Geschichte,Philosophie, Alterthümer und Mythologie.
Zweiter Theil. Schulbuchhandlung, Braunschweig, Germany.
Grobei, M. A., Qeli, E., Brunner, E., Rehrauer, H., Zhang, R.,Roschitzki, B., Basler, K., Ahrens, C. H. and Grossniklaus, U.(
2009
). Deterministic protein inference for shotgun proteomics data provides new insights into Arabidopsis pollen development and function.
Genome Res.
(in press).
Guo, H., Li, L., Ye, H., Yu, X., Algreen, A. and Yin, Y.(
2009
). Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.
Proc. Natl. Acad. Sci. USA
106
,
7648
-7653.
Hematy, K. and Hofte, H. (
2008
). Novel receptor kinases involved in growth regulation.
Curr. Opin. Plant Biol.
11
,
321
-328.
Hematy, K., Sado, P. E., Van Tuinen, A., Rochange, S., Desnos,T., Balzergue, S., Pelletier, S., Renou, J. P. and Hofte, H.(
2007
). A receptor-like kinase mediates the response of Arabidopsis cells to the inhibition of cellulose synthesis.
Curr. Biol.
17
,
922
-931.
Higashiyama, T., Kuroiwa, H., Kawano, S. and Kuroiwa, T.(
1998
). Guidance in vitro of the pollen tube to the naked embryo sac of Torenia fournieri.
Plant Cell
10
,
2019
-2032.
Higashiyama, T., Kuroiwa, H., Kawano, S. and Kuroiwa, T.(
2000
). Explosive discharge of pollen tube contents in Torenia fournieri.
Plant Physiol.
122
,
11
-14.
Higashiyama, T., Yabe, S., Sasaki, N., Nishimura, Y.,Miyagishima, S., Kuroiwa, H. and Kuroiwa, T. (
2001
). Pollen tube attraction by the synergid cell.
Science
293
,
1480
-1483.
Hirohashi, N., Kamei, N., Kubo, H., Sawada, H., Matsumoto, M. and Hoshi, M. (
2008
). Egg and sperm recognition systems during fertilization.
Dev. Growth Differ.
50
Suppl. 1
,
S221
-S238.
Hiscock, S. J. and Allen, A. M. (
2008
). Diverse cell signalling pathways regulate pollen-stigma interactions: the search for consensus.
New Phytol.
179
,
286
-317.
Honys, D. and Twell, D. (
2004
). Transcriptome analysis of haploid male gametophyte development in Arabidopsis.
Genome Biol.
5
,
R85
.
Howden, R., Park, S. K., Moore, J. M., Orme, J., Grossniklaus,U. and Twell, D. (
1998
). Selection of T-DNA-tagged male and female gametophytic mutants by segregation distortion in Arabidopsis.
Genetics
149
,
621
-631.
Huck, N., Moore, J. M., Federer, M. and Grossniklaus, U.(
2003
). The Arabidopsis mutant feronia disrupts the female gametophytic control of pollen tube reception.
Development
130
,
2149
-2159.
Jiang, L., Yang, S. L., Xie, L. F., Puah, C. S., Zhang, X. Q.,Yang, W. C., Sundaresan, V. and Ye, D. (
2005
). VANGUARD1 encodes a pectin methylesterase that enhances pollen tube growth in the Arabidopsis style and transmitting tract.
Plant Cell
17
,
584
-596.
Johnson, M. A. and Lord, M. E. (
2006
). Extracellular guidance cues and intracellular signaling pathways that direct pollen tube growth. In
The Pollen Tube: A Cellular and Molecular Perspective
(ed. R. Malho), pp.
223
-242. Heidelberg: Springer.
Juge, N. (
2006
). Plant protein inhibitors of cell wall degrading enzymes.
Trends Plant Sci.
11
,
359
-367.
Kägi, C. and Gross-Hardt, R. (
2007
). How females become complex: cell differentiation in the gametophyte.
Curr. Opin. Plant Biol.
10
,
633
-638.
Kothe, E. (
2008
). Sexual attraction: on the role of fungal pheromone/receptor systems (A review).
Acta Microbiol. Immunol. Hung.
55
,
125
-143.
Krichevsky, A., Kozlovsky, S. V., Tian, G. W., Chen, M. H.,Zaltsman, A. and Citovsky, V. (
2007
). How pollen tubes grow.
Dev. Biol.
303
,
405
-420.
Kubo, M., Udagawa, M., Nishikubo, N., Horiguchi, G., Yamaguchi,M., Ito, J., Mimura, T., Fukuda, H. and Demura, T. (
2005
). Transcription switches for protoxylem and metaxylem vessel formation.
Genes Dev.
19
,
1855
-1860.
Li, Y. Q., Chen, F., Linskens, H. F. and Cresti, M.(
1994
). Distribution of unesterified and esterified pectins in cell walls of pollen tubes of flowering plants.
Sex. Plant Reprod.
7
,
145
-152.
Lord, E. M. and Russell, S. D. (
2002
). The mechanisms of pollination and fertilization in plants.
Annu. Rev. Cell Dev. Biol.
18
,
81
-105.
Marton, M. L., Cordts, S., Broadhvest, J. and Dresselhaus,T. (
2005
). Micropylar pollen tube guidance by Egg Apparatus 1 of maize.
Science
307
,
573
-576.
McCormick, S. (
2004
). Control of male gametophyte development.
Plant Cell
16
Suppl.
,
S142
-S153.
McCormick, S. (
2007
). Plant science:reproductive dialog.
Science
317
,
606
-607.
Micheli, F. (
2001
). Pectin methylesterases:cell wall enzymes with important roles in plant physiology.
Trends Plant Sci.
6
,
414
-419.
Miyazaki, S., Murata,T., Sakurai-Ozato, N., Kubo, M., Demura,T., Fukuda, H. and Hasebe, M. (
2009
). ANXUR1 and 2, sister genes to FERONIA/SIRENE, are male factors for coordinated fertilization.
Curr. Biol.
19
,
1327
-1331.
Moore, J. M., Vielle-Calzada, J. P., Gagliano, W. and Grossniklaus, U. (
1997
). Genetic characterization of hadad, a mutant disrupting megagametogenesis in Arabidopsis thaliana.
Cold Spring Harbor Symp. Quant. Biol.
62
,
35
-47.
Morillo, S. A. and Tax, F. E. (
2006
). Functional analysis of receptor-like kinases in monocots and dicots.
Curr. Opin. Plant Biol.
9
,
460
-469.
Myers, C., Romanowsky, S. M., Barron, Y. D., Garg, S., Azuse, C. L., Curran, A., Davis, R. M., Hatton, J., Harmon, A. C. and Harper, J. F.(
2009
). Calcium-dependent protein kinases regulate polarized tip growth in pollen tubes.
Plant J.
59
,
528
-539.
Okuda, S., Tsutsui, H., Shiina, K., Sprunck, S., Takeuchi, H.,Yui, R., Kasahara, R. D., Hamamura, Y., Mizukami, A., Susaki, D. et al.(
2009
). Defensin-like polypeptide LUREs are pollen tube attractants secreted from synergid cells.
Nature
458
,
357
-361.
Palanivelu, R. and Preuss, D. (
2006
). Distinct short-range ovule signals attract or repel Arabidopsis thalianapollen tubes in vitro.
BMC. Plant Biol.
6
,
7
.
Palanivelu, R., Brass, L., Edlund, A. F. and Preuss, D.(
2003
). Pollen tube growth and guidance is regulated by POP2, an Arabidopsis gene that controls GABA levels.
Cell
114
,
47
-59.
Parre, E. and Geitmann, A. (
2005
). Pectin and the role of the physical properties of the cell wall in pollen tube growth of Solanum chacoense.
Planta
220
,
582
-592.
Pelloux, J., Rusterucci, C. and Mellerowicz, E. J.(
2007
). New insights into pectin methylesterase structure and function.
Trends Plant Sci.
12
,
267
-277.
Pina, C., Pinto, F., Feijo, J. A. and Becker, J. D.(
2005
). Gene family analysis of the Arabidopsis pollen transcriptome reveals biological implications for cell growth, division control, and gene expression regulation.
Plant Physiol.
138
,
744
-756.
Robatzek, S., Chinchilla, D. and Boller, T.(
2006
). Ligand-induced endocytosis of the pattern recognition receptor FLS2 in Arabidopsis.
Genes Dev.
20
,
537
-542.
Röckel, N., Wolf, S., Kost, B., Rausch, T. and Greiner,S. (
2008
). Elaborate spatial patterning of cell-wall PME and PMEI at the pollen tube tip involves PMEI endocytosis, and reflects the distribution of esterified and de-esterified pectins.
Plant J.
53
,
133
-143.
Rotman, N., Rozier, F., Boavida, L., Dumas, C., Berger, F. and Faure, J. E. (
2003
). Female control of male gamete delivery during fertilization in Arabidopsis thaliana.
Curr. Biol.
13
,
432
-436.
Rotman, N., Gourgues, M., Guitton, A. E., Faure, J. E. and Berger, F. (
2008
). A dialogue between the sirène pathway in synergids and the fertilization independent seed pathway in the central cell controls male gamete release during double fertilization in Arabidopsis.
Mol. Plant
1
,
659
-666.
Sandaklie-Nikolova, L., Palanivelu, R., King, E. J., Copenhaver,G. P. and Drews, G. N. (
2007
). Synergid cell death in Arabidopsis is triggered following direct interaction with the pollen tube.
Plant Physiol.
144
,
1753
-1762.
Schiott, M., Romanowsky, S. M., Baekgaard, L., Jakobsen, M. K.,Palmgren, M. G. and Harper, J. F. (
2004
). A plant plasma membrane Ca2+ pump is required for normal pollen tube growth and fertilization.
Proc. Natl. Acad. Sci. USA
101
,
9502
-9507.
Shiu, S. H., Karlowski, W. M., Pan, R., Tzeng, Y. H., Mayer, K. F. and Li, W. H. (
2004
). Comparative analysis of the receptor-like kinase family in Arabidopsis and rice.
Plant Cell
16
,
1220
-1234.
von Malek, B., van der, G. E., Schneitz, K. and Keller, B.(
2002
). The Arabidopsis male-sterile mutant dde2-2 is defective in the ALLENE OXIDE SYNTHASE gene encoding one of the key enzymes of the jasmonic acid biosynthesis pathway.
Planta
216
,
187
-192.
Walter, M., Chaban, C., Schutze, K., Batistic, O., Weckermann,K., Nake, C., Blazevic, D., Grefen, C., Schumacher, K., Oecking, C. et al.(
2004
). Visualization of protein interactions in living plant cells using bimolecular fluorescence complementation.
Plant J.
40
,
428
-438.
Weterings, K. and Russell, S. D. (
2004
). Experimental analysis of the fertilization process.
Plant Cell
16
Suppl.
,
S107
-S118.
Willats, W. G., McCartney, L., Mackie, W. and Knox, J. P.(
2001
). Pectin: cell biology and prospects for functional analysis.
Plant Mol. Biol.
47
,
9
-27.
Wolters-Arts, M., Lush, W. M. and Mariani, C.(
1998
). Lipids are required for directional pollen-tube growth.
Nature
392
,
818
-821.
Yadegari, R. and Drews, G. N. (
2004
). Female gametophyte development.
Plant Cell
16
Suppl.
,
S133
-S141.
Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L. and Gruissem,W. (
2004
). GENEVESTIGATOR: Arabidopsis microarray database and analysis toolbox.
Plant Physiol.
136
,
2621
-2632.
Zonia, L. and Munnik, T. (
2009
). Uncovering hidden treasures in pollen tube growth mechanics.
Trends Plant Sci.
14
,
318
-327.

Supplementary information