In the developing hypothalamus, a variety of neurons are generated adjacent to each other in a highly coordinated, but poorly understood process. A critical question that remains unanswered is how coordinated development of multiple neuronal types is achieved in this relatively narrow anatomical region. We focus on dopaminergic (DA) and oxytocinergic (OT) neurons as a paradigm for development of two prominent hypothalamic cell types. We report that the development of DA and OT-like neurons in the zebrafish is orchestrated by two novel pathways that regulate the expression of the homeodomain-containing protein Orthopedia (Otp), a key determinant of hypothalamic neural differentiation. Genetic analysis showed that the G-protein-coupled receptor PAC1 and the zinc finger-containing transcription factor Fezl act upstream to Otp. In vivo and in vitro experiments demonstrated that Fezl and PAC1 regulate Otp at the transcriptional and the post-transcriptional levels, respectively. Our data reveal a new genetic network controlling the specification of hypothalamic neurons in vertebrates,and places Otp as a critical determinant underlying Fezl- and PAC1-mediated differentiation.

INTRODUCTION

The hypothalamus is a complex brain structure that regulates endocrine,behavioral and autonomic functions by means of its ability to affect both central and peripheral activities (Iversen et al., 2000). Accordingly, developmental impairments in hypothalamic differentiation are associated with defects in energy balance,and in neuroendocrine and psychiatric disorders(Swaab, 2004). For example,loss of hypocretin neurons leads to narcolepsy, and patients with Prader-Willi syndrome have a deficit in oxytocinergic (OT) neurons that is accompanied by hyperphagia and severe obesity (Peyron et al., 2000; Swaab et al.,1995). The medial area of the hypothalamus contains magnocellular and parvocellular neurons that control pituitary activities. The magnocellular neurons project to the posterior pituitary where they release oxytocin and arginine-vasopressin directly into the general circulation(Landgraf and Neumann, 2004). The parvocellular neurons affect the anterior pituitary by releasing hypophysiotropic hormones such as dopamine and somatostatin into the hypophysial-portal-vascular system(Markakis, 2002).

Hypothalamic development poses a challenging model for understanding neural patterning and specification because the hypothalamus contains multiple nuclei, each composed of several neuronal cell types that form connections with many parts of the nervous system(Markakis, 2002). Uncovering critical molecules regulating neural diversification of the hypothalamus is essential to understand how this elaborate brain region is formed. Insights into the differentiation of certain hypothalamic neurons has been contributed by targeted gene knockouts of the transcription regulators Sim1, Brn2,Arnt2, Hmx2/3 and Otp(Acampora et al., 1999; Michaud et al., 2000; Michaud et al., 1998; Schonemann et al., 1995; Wang et al., 2004; Wang and Lufkin, 2000). The homeodomain-containing protein Orthopedia (Otp) is a key determinant controlling the specification of neuroendocrine hypothalamic neurons(Acampora et al., 1999; Wang and Lufkin, 2000). However, the signaling pathway(s) that regulate Otp and eventually lead to synchronized hypothalamic differentiation have not been elucidated.

Here, we focus on studying the development of dopaminergic (DA) and OT-like neurons [termed isotocinergic (IT) neurons] representing mammalian parvocellular and magnocellular cell types, respectively. We report the mode of regulation of zebrafish Otpb during the development of these two prominent neuronal clusters. We show that regulated expression of Otpb by two novel converging pathways coordinate the development of IT and DA neurons.

MATERIALS AND METHODS

Fish stocks

Fish breeding and maintenance were performed as previously described(Levkowitz et al., 2003). Experiments were performed in accordance with the Weizmann Institute IACUC protocol number 770104-1.

Plasmids and probes

Full-length otpb (see ZFIN ID: ZDB-GENE-990708-7 for nomenclature history), pac1, and pacap1b cDNAs were amplified by PCR from RNA that was isolated from embryos at 48 hours post fertilization. Identification of the pac1 translation start site is detailed (see Fig. S8 in the supplementary material). Activated pac1*(E239Q) was generated by PCR-based site-directed mutagenesis. To construct theΔ1-5-pacap1b mutant, site-directed mutagenesis was used to delete the cDNA nucleotides encoding amino acids 121-125 of the PACAP1b precursor protein. cDNA was subsequently subcloned into either the pCS2+ plasmid or the heat-shock response element (HSE)-driven expression vector, pSGH2 (Bajoghli et al.,2004) and confirmed by nucleotide sequencing. Oligonucleotide primers that were used to amplify DNA templates for all digoxigenin(DIG)-labeled probe synthesis reactions are described in Table 1.

Table 1.

Probes and real-time PCR primers used in this study

Probe sizePrimersGenBank accession no.Gene
500 bp Forward, CTCCGCAAGCTCTCGGTGTC   
 Reverse, CTGCACTAATGTACAGTCAAGC NM_178291 isotocin (it) 
550 bp Forward, GCAAAGAGAACTTACCCGACG   
 Reverse, CAACATTCTTTCCGATGACAC NM_183070 somatostatin1 (ss1) 
450 bp Forward, AATGCGCCTCTGTCGACATTG   
 Reverse, ACTGCTCACATCCTGTGGTACCG AF025305 hypocretin (hcrt; also known as orexin) 
1325 bp Forward, GGGAGCTGCCCTGGATCCACT   
 Reverse, TCAAACCACCAGCCAGTGATGGAG AF318177 dat 
722 bp Forward, CACTACAAACCTCAAGTATTC   
 Reverse, CCCACTTAACAATCATTG NM_131100 otpb 
307 bp Forward, GACGTGCCGTTTCACCTC   
 Reverse, CGAGTGCACCTTGTTTCT XP_683186 otpa 
1260 bp Forward, ATGGCTTCCACAGTGAGAAAATGTC   
 Reverse, CTGAAAAGACCCAAGACCGAGCTC CR853299 pac1 
400 bp Forward, GAAGTCCTCCATCTCTTACGG   
 Reverse, ATCTTTAGGACTGAATGTACAC NM_214715 pacap1b (also known as adcyap1b
65 bp Forward, AATCGCGAGTGCAGGTCTG   
 Reverse, GGTGGTCTTCTTGCGCTTCTT XM_215445 Otp (rat) 
70 bp Forward, TGACCGAGCGTGGCTACA   
 Reverse, CAGCTTCTCTTTAATGTCACGCA NM_031144 Actb (rat) 
Probe sizePrimersGenBank accession no.Gene
500 bp Forward, CTCCGCAAGCTCTCGGTGTC   
 Reverse, CTGCACTAATGTACAGTCAAGC NM_178291 isotocin (it) 
550 bp Forward, GCAAAGAGAACTTACCCGACG   
 Reverse, CAACATTCTTTCCGATGACAC NM_183070 somatostatin1 (ss1) 
450 bp Forward, AATGCGCCTCTGTCGACATTG   
 Reverse, ACTGCTCACATCCTGTGGTACCG AF025305 hypocretin (hcrt; also known as orexin) 
1325 bp Forward, GGGAGCTGCCCTGGATCCACT   
 Reverse, TCAAACCACCAGCCAGTGATGGAG AF318177 dat 
722 bp Forward, CACTACAAACCTCAAGTATTC   
 Reverse, CCCACTTAACAATCATTG NM_131100 otpb 
307 bp Forward, GACGTGCCGTTTCACCTC   
 Reverse, CGAGTGCACCTTGTTTCT XP_683186 otpa 
1260 bp Forward, ATGGCTTCCACAGTGAGAAAATGTC   
 Reverse, CTGAAAAGACCCAAGACCGAGCTC CR853299 pac1 
400 bp Forward, GAAGTCCTCCATCTCTTACGG   
 Reverse, ATCTTTAGGACTGAATGTACAC NM_214715 pacap1b (also known as adcyap1b
65 bp Forward, AATCGCGAGTGCAGGTCTG   
 Reverse, GGTGGTCTTCTTGCGCTTCTT XM_215445 Otp (rat) 
70 bp Forward, TGACCGAGCGTGGCTACA   
 Reverse, CAGCTTCTCTTTAATGTCACGCA NM_031144 Actb (rat) 

Immunostaining and in situ hybridization

Whole mount immunostaining with either polyclonal or monoclonal anti-tyrosine hydroxylase (TH) antibody (Chemicon, Temecula, CA) and in situ hybridization were performed as described(Levkowitz et al., 2003). Otp antibody was raised against a C-terminal Otp peptide and purified by affinity chromatography as described (Lin et al.,1999). Following in situ hybridization, embryos were embedded into 1.5% agarose, dehydrated and embedded in paraffin. Paraffin blocks were sectioned (6 μm) on a microtome, mounted on slides and subjected to deparaffinization. Microwave-induced Otp antigen retrieval was performed in 10 mM citric acid (pH 6) for 10 minutes. Sections were blocked in PBS with 20%goat serum and 0.5% Triton X-100, and then incubated overnight at room temperature with affinity-purified rabbit Otp antisera (at 2 μg/ml). Sections were then washed with PBS and bathed with a goat anti-rabbit biotinylated antibody (at 1:200 dilution) for 1.5 hours at RT and visualized using a Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA).

Transient transfection, immunoblot and quantitative real-time PCR analysis

HEK293 cells were grown in 12-well plates and transfected (at 60%confluence) with a total amount of 1.0 μg/well of the indicated pCS2-based expression vectors using a standard calcium phosphate method. In some experiments, cells were incubated for the indicated time periods in the presence of different concentrations of a synthetic PACAP38 peptide(Sigma-Aldrich, Rehovot, Israel). Proteins were harvested 24 hours post transfection in 150 μl of hot SDS sample buffer and 15 μl of the crude protein extract was fractionated by 10% SDS-PAGE followed by immunoblotting with an affinity-purified anti-Otp antibody. Thereafter, PVDF membranes were acid stripped and reprobed with a monoclonal anti-β-actin antibody (clone AC-74, Sigma-Aldrich, Rehovot, Israel).

PC12 cell line (clone number CRL-1721, 7-10 passage) was obtained from the ATCC Bioresource Center and propagated according to ATCC instructions. Nuclear-enriched protein extraction as well as total RNA preparation were previously described (Schreiber et al.,1989). For western blot analysis of Otp from either PC12 or zebrafish proteins, 20 μg total protein from each treatment was fractionated on 8.5% SDS-PAGE and immunoblotted with anti-Otp antibody as described above. Goat antisera directed against the nuclear regulator of chromosome condensation 1 (Rcc1; Santa-Cruz Biotechnology, Santa Cruz, CA) was used as an internal reference. Protein bands were quantified using an imaging densitometer and analyzed with Multi-Analyst Software (Bio-Rad Laboratories,Rishon Le Zion, Israel). [35S]methionine incorporation and pulse-chase labeling procedures followed by anti-Otp immunoprecipitation and gel-autoradiography were performed according to published methods(Sambrook and Russell,2001).

The level of endogenous otp RNA in PACAP38-treated PC12 cells was determined by quantitative real-time PCR kit (DyNAmo HS SYBR Green qPCR Kit, Finnzymes, Finland) using 7300 Real-Time PCR system (Applied Biosystems, Foster City, CA). Two micrograms of total RNA was reverse-transcribed using Moloney murine leukemia virus reverse transcriptase(Promega, Madison, USA) in a 20 μl reaction volume. PCR was performed in a 20 μl total reaction volume according to the kit instructions using rat-specific primers (Table 1)for either otp or βactin. Serial dilutions of the standard templates were also used for parallel amplification. The threshold cycles (Ct) were calculated and standard curves were plotted with Ct versus log template quantities. The quantities of samples were determined from the standard curves. otp levels were then normalized to those ofβ -actin in each corresponding sample.

Microinjection of morpholinos and RNAs

Capped RNAs were synthesized with mMESSAGE mMACHINE kit (Ambion, Austin,TX) from linearized pCS2+ plasmids. The sequences of antisense morpholino oligonucleotides (Gene Tools, LLC, Corvallis, OR) targeted to fezl, otpb and pac1 are listed in Table 2. Splice-blocking morpholinos to fezl (Exon2-Intron2), otpa (Exon2-Intron2)and pacap1b translation start blocking morpholino were previously described (Jeong et al., 2006; Ryu et al., 2007; Wu et al., 2006). fezl otpb and pac1 RNAs were injected at the concentrations indicated in Table 3 into embryos at the two- to eight-cell stage. Injected embryos were allowed to develop at 28.5°C.

Table 2.

Antisense morpholinos used in this study

Gene/MO nameLocationSequence
fezl/sp1 Intron1-Exon2 AGACCTTTAAAAGAATAGAAACTGC 
fezl/sp3 Exon2-Intron2 TATTTTAACCTACCTGTGTGTGAAT 
otpb/sp2 Intron1-Exon2 TGCAGCATCCTTCATCCCTGTGGAC 
otpa Exon2-Intron2 ATCAGACTGCACCGCACTCACCTGC 
pac1 ATG-Start TCACTGTGGAAGCCATTTTGTCTGG 
pacap1b ATG-Start GCCATGCTATTGCAGAGTAGGTAGA 
Gene/MO nameLocationSequence
fezl/sp1 Intron1-Exon2 AGACCTTTAAAAGAATAGAAACTGC 
fezl/sp3 Exon2-Intron2 TATTTTAACCTACCTGTGTGTGAAT 
otpb/sp2 Intron1-Exon2 TGCAGCATCCTTCATCCCTGTGGAC 
otpa Exon2-Intron2 ATCAGACTGCACCGCACTCACCTGC 
pac1 ATG-Start TCACTGTGGAAGCCATTTTGTCTGG 
pacap1b ATG-Start GCCATGCTATTGCAGAGTAGGTAGA 
Table 3.

Concentration of morpholinos and RNAs used in this study

MO/RNAConcentration (per embryo)
fezl-sp1 MO 3.0 ng/1.7 nl 
fezl-sp3 MO 3.0 ng/1.7 nl 
otpb-sp2 MO 4.0 ng/1.7 nl 
otpa MO 4.0 ng/1.7 nl 
pac1 MO 4.0 ng/1.7 nl 
pacap1b MO 3.0 ng/1.7 nl 
otpb RNA 15 pg/1.7 nl 
pac1 RNA 200 pg/1.7 nl 
MO/RNAConcentration (per embryo)
fezl-sp1 MO 3.0 ng/1.7 nl 
fezl-sp3 MO 3.0 ng/1.7 nl 
otpb-sp2 MO 4.0 ng/1.7 nl 
otpa MO 4.0 ng/1.7 nl 
pac1 MO 4.0 ng/1.7 nl 
pacap1b MO 3.0 ng/1.7 nl 
otpb RNA 15 pg/1.7 nl 
pac1 RNA 200 pg/1.7 nl 

Statistical analyses

Effects of the various genetic perturbations on DA and IT neurons were analyzed by counting the number of cells in the respective neuronal cluster of a given treated population of embryos and thereafter one-way ANOVA test was performed followed by the Tukey method for comparison of means using JMP software (SAS Institute, Cary, NC). The non-treated controls of the various treatments were pooled together after we determined (Tukey analysis) that there was no significant difference between the various control samples.

Fig. 1.

Analysis of hypothalamic neurons in fezl/tofm808mutant embryos. (A-F) Heterozygous (WT; A,C,E) embryos and their too fewm808 (tofm808) mutant siblings(B,D,F) were fixed at 52 (A,B), and 48 (C-F) hours post fertilization (hpf)and subjected to whole-mount in situ hybridization with antisense RNA probes directed against either the hypothalamic neuropeptide isotocin, which is the zebrafish ortholog of oxytocin (it; A,B), hypocretin/orexin(hcrt; C,D) or somatostatin (ss; E,F). After probe color development, all specimens were subjected to immunostaining with an anti-tyrosine hydroxylase (TH) antibody to detect DA neurons. WT heterozygous and tofm808 embryos were scored by TH staining followed by sequencing-based genotyping. Black arrowheads indicate deficiencies in DA and IT neurons in too few embryos. (G,H) Schematic representations of the examined hypothalamic cell types and of fezl/tof expression domains in a 2-day-old WT embryo. All panels show lateral views of the embryo, anterior to the left. Hyp, hypothalamus; LC,locus coeruleus; NPO, neurosecretory preoptic area; PT, posterior tuberculum;Tel, telencephalon. Scale bars: 50 μm in A-D; 100 μm in E,F.

Fig. 1.

Analysis of hypothalamic neurons in fezl/tofm808mutant embryos. (A-F) Heterozygous (WT; A,C,E) embryos and their too fewm808 (tofm808) mutant siblings(B,D,F) were fixed at 52 (A,B), and 48 (C-F) hours post fertilization (hpf)and subjected to whole-mount in situ hybridization with antisense RNA probes directed against either the hypothalamic neuropeptide isotocin, which is the zebrafish ortholog of oxytocin (it; A,B), hypocretin/orexin(hcrt; C,D) or somatostatin (ss; E,F). After probe color development, all specimens were subjected to immunostaining with an anti-tyrosine hydroxylase (TH) antibody to detect DA neurons. WT heterozygous and tofm808 embryos were scored by TH staining followed by sequencing-based genotyping. Black arrowheads indicate deficiencies in DA and IT neurons in too few embryos. (G,H) Schematic representations of the examined hypothalamic cell types and of fezl/tof expression domains in a 2-day-old WT embryo. All panels show lateral views of the embryo, anterior to the left. Hyp, hypothalamus; LC,locus coeruleus; NPO, neurosecretory preoptic area; PT, posterior tuberculum;Tel, telencephalon. Scale bars: 50 μm in A-D; 100 μm in E,F.

RESULTS

A common pathway controls the development of IT and DA neurons

To address the mechanism by which coordinated generation of different hypothalamic neurons is achieved, we focused on the DA and IT neuronal populations, which play major roles in neuroendocrine modulation of the anterior and posterior pituitary, respectively. IT neurons express isotocin-neurophysin (IT-NP), which is the zebrafish ortholog of the mammalian oxytocin-neurophysin (OT-NP) precursor protein(Unger and Glasgow, 2003). In wild-type (WT) embryos, IT neurons were readily detected in the neurosecretory preoptic nucleus (NPO), which is analogous to the mammalian supraoptic nucleus(SON) (Peter and Fryer, 1983),whereas hypothalamic DA cells developed in several clusters located at the basal plate posterior tuberculum (PT), adjacent to IT neurons(Fig. 1A). These DA clusters express the previously described (Puelles and Rubenstein, 2003; Rohr et al., 2001) hypothalamic markers nk2.1a/titf1a,nk2.1b/titf1b and sim1 (N.B., H.N.-R. and G.L., unpublished material).

We have previously characterized the zebrafish mutant, too few(tofm808), in which the development of hypothalamic DA neurons is significantly impaired because of a recessive mutation in the gene encoding the Fezl zinc-finger-containing protein (fezl, also known as fezf2 - ZFIN) (Levkowitz et al.,2003). Simultaneous examination of IT and DA neurons revealed that the development of IT cells was attenuated in tofm808embryos, which also displayed a clear deficit in DA neurons(Fig. 1B). However,hypothalamic hypocretin- and somatostatin-secreting neurons differentiated properly in the tofm808 mutant(Fig. 1C-F). Thus, proper development of both IT and DA neurons requires Fezl activity.

We sought to identify the molecular events underlying fezl/tofm808 activity. As IT and DA are generated in the NPO and PT,respectively, we performed an RNA in situ hybridization screen to identify candidate hypothalamic molecules that are expressed in these two adjacent hypothalamic nuclei (J.B. and G.L., unpublished material). We identified two genes, the homeodomain-containing gene, otpb, and the G-protein-coupled receptor, pac1 (also known as adcyap1r1 -ZFIN), that displayed a discernible expression pattern in the developing zebrafish hypothalamus (Figs 2, 3 and see Fig. S1 in the supplementary material). The zebrafish otpb gene is one of the two predicted orthologs of the mammalian Otp, and PAC1 is the predominant high-affinity receptor for the pituitary adenylate cyclase activating polypeptide (PACAP) neuropeptide (Vaudry et al., 2000). We observed that both Otp and PAC1 are expressed in the developing PT and NPO adjacent to or at the Fezl-expressing domains,respectively, suggesting that these molecules may be involved in differentiation of the two hypothalamic nuclei(Fig. 2A-D and see Fig. S1 in the supplementary material). Otp protein was detected later in terminally differentiated DA and IT neurons (Fig. 2E,F). Although PAC1 was readily detected in TH+ DA neurons at 24-36 hpf, its expression in the later appearing (44-48 hpf) IT cells was nearly undetectable by the time these neurons underwent terminal differentiation (see Fig. S2 in the supplementary material and data not shown).

fezl regulates otpb, but not pac1 gene expression in the hypothalamus

As both Otp and Fezl are critical determinants of hypothalamic development we examined whether Fezl might regulate otpb by comparing its expression in WT embryos to tofm808 mutants and to fezl knockdown embryos. tofm808 embryos displayed a complete loss of otpb gene expression in the PT area, and a slight reduction in otpb+ cells of the NPO(Fig. 3B, n=70/70). The expression of otpb in the ventral diencephalon and hindbrain was unaltered in tofm808 mutants. Complete inactivation of Fezl by injecting two independent splice-blocking morpholino oligonucleotides into tofm808 (denoted tof fezlMO) resulted in a stronger effect; markedly diminished otpb expression was observed in the PT, NPO and ventral diencephalon, but not in the hindbrain(Fig. 3C, n=10/15). The latter result suggests that the tofm808 allele of fezl is a hypomorph that retains residual transcriptional activity. In agreement with the stronger effect of fezl knockdown on otpb expression, the tofm808 mutant allele displayed a delay in IT development whereas tof fezlMO embryos displayed a sustained loss of IT neurons (Fig. 3G). Finally, the expression of the G-protein-coupled receptor pac1 in the PT, NPO and pituitary was not affected by gene perturbations of fezl/tof(Fig. 3D-F, n=60). Hence, the Fezl transcription factor specifically regulated the expression of otpb at two distinct hypothalamic nuclei that produce IT and DA neurons.

Fig. 2.

Coordinated expression of pac1, fezl and Otp in the NPO and PT areas. (A-D,F) Sagittal paraffin sections (6 μm) through the NPO and PT (lateral view, anterior to the left). At the indicated stages of development, embryos were subjected to whole-mount in situ hybridization with probes directed against pac1 (A,B), fezl (C,D) or isotocin (it; F). Thereafter, specimens were sectioned and immunostained with an anti-Otp antibody. Schemes of fezl expression domain (dark purple) at the plane of the section are shown in C and D. Labeled RNA probes were detected in the cytoplasm, whereas Otp antibody exclusively labeled the nuclei. (E) Projected confocal Z-stack images of embryos (lateral view, anterior to the left) that were subjected to double immunofluorescence staining with monoclonal and polyclonal antibodies directed against tyrosine hydroxylase (TH) and Otp, respectively. The two prominent clusters of dopaminergic neurons, group 2 (Gr. 2) and groups 3-6 (Gr. 3-6),are indicated. hpf, hours post fertilization; NPO, neurosecretory preoptic area; PT, posterior tuberculum; vDien, ventral diencephalon. Scale bars: 20μm in A-D; 40 μm in E,F.

Fig. 2.

Coordinated expression of pac1, fezl and Otp in the NPO and PT areas. (A-D,F) Sagittal paraffin sections (6 μm) through the NPO and PT (lateral view, anterior to the left). At the indicated stages of development, embryos were subjected to whole-mount in situ hybridization with probes directed against pac1 (A,B), fezl (C,D) or isotocin (it; F). Thereafter, specimens were sectioned and immunostained with an anti-Otp antibody. Schemes of fezl expression domain (dark purple) at the plane of the section are shown in C and D. Labeled RNA probes were detected in the cytoplasm, whereas Otp antibody exclusively labeled the nuclei. (E) Projected confocal Z-stack images of embryos (lateral view, anterior to the left) that were subjected to double immunofluorescence staining with monoclonal and polyclonal antibodies directed against tyrosine hydroxylase (TH) and Otp, respectively. The two prominent clusters of dopaminergic neurons, group 2 (Gr. 2) and groups 3-6 (Gr. 3-6),are indicated. hpf, hours post fertilization; NPO, neurosecretory preoptic area; PT, posterior tuberculum; vDien, ventral diencephalon. Scale bars: 20μm in A-D; 40 μm in E,F.

otpb and pac1 control the differentiation of IT and DA neurons

To address the role of otpb in DA and IT development we examined the phenotype of these neurons following genetic perturbation of otpb. Consistently with the regulated expression of otpb in the NPO and PT, injection of a splice-blocking morpholino directed against otpb (denoted otpbMO) impaired the development of IT and DA neurons (Fig. 4B,C and see Fig. S3 in the supplementary material). We then analyzed the effect of otpbMO on discrete DA clusters of the PT in 2- to 3-day-old embryos. These neuronal clusters can be readily identified in the PT of 2- to 5-day-old zebrafish embryos (Rink and Wullimann,2002). Interestingly, otpbMO treatment had a stronger effect on the posterior hypothalamic DA groups 3-6, whereas group 2 was less affected (Fig. 4C and see Fig. S3 in the supplementary material).

The G-protein-coupled receptor, pac1, was detected in the zebrafish NPO and PT before and during the period of DA and IT differentiation(Figs 2 and 3 and see Fig. S2 in the supplementary material). This suggested that pac1 might be a good candidate transducer of an extracellular cue, which may be involved in DA and IT development. Indeed, knockdown of pac1 gene activity impaired the development of both IT and DA neurons (Fig. 4F and see Fig. S3 in the supplementary material). As in the case of otpbMO, inactivation of pac1 mainly affected hypothalamic DA groups 3-6, implying a common genetic pathway shared by otp and pac1 (Fig. 4B,C,F). Similarly to the reported tofm808 phenotype(Levkowitz et al., 2003; Rink and Guo, 2004), DA cell groups in the retina, telencephalon and pretectal diencephalon, as well as TH+;Otp+ noradrenergic neurons of the locus coeruleus(LC), were not affected by otpb or pac1 inactivation (data not shown). Consistently with the pac1 knockdown phenotype, the high-affinity ligand to PAC1, PACAP1b, was expressed in the NPO and PT, and was found to be necessary for IT and DA development (see Figs S1,S3 in the supplementary material). The pacap1b morphant, however, had a more pleiotropic effect including diminution of mid-hindbrain boundary and cerebellar structures, suggesting that PACAP1b may bind to additional G-protein-coupled receptors other than PAC1(Vaudry et al., 2000).

pac1, otp and fezl form a genetic network controlling hypothalamic differentiation

Our results thus far suggest that differentiation of IT neurons as well as of discrete clusters of hypothalamic DA cells is regulated by the transcription factors Fezl and Otp and by the G-protein-coupled receptor,PAC1. We next performed a genetic epistasis analysis to reveal the hierarchical interaction between fezl, otpb and pac1. For gain of function of Otpb we first determined the dose of otpb RNA(7-15pg) that could rescue the otpb morphant without affecting patterning (Fig. 4D and data not shown). In order to activate the PAC1-mediated signaling pathway, we generated a constitutively active form of the PAC1 receptor(Cao et al., 2000), denoted PAC1*. This construct had no obvious effect on patterning even at the highest dose used (Fig. 4Hand data not shown). Injection of pac1* mRNA rescued the pac1 knockdown phenotype, but could not complement otpbdeficiencies, suggesting that Otp is acting downstream of PAC1(Fig. 4E,H). Consistently, the deficiencies in DA and IT neurons that were caused by injection of pac1MO could be rescued by co-injection of mRNA encoding to the Otpb protein (Fig. 4G). Rescue of pac1 morphant by otpb mRNA was not due to upregulation of endogenous PAC1 or its ligand PACAP1b (see Fig. S5 in the supplementary material).

Although otpb expression was diminished in the DA-deficient tofm808 mutant (Fig. 3), overexpression of otpb RNA could not rescue the tof phenotype (data not shown). We hypothesized that this was due to insufficient Otpb protein expression levels in hypothalamic precursors. We thus attempted to rescue tofm808 by injection of heat-shock-inducible expression vector, which drives either Otpb or PAC1* together with a GFP tracer(Bajoghli et al., 2004),followed by selection of mosaic embryos expressing high GFP levels in the hypothalamus (see Fig. 5F). Using this system, we were able to obtain complete rescue of the tofphenotype by gain of function of Otpb (Fig. 5C; n=9/11), but not of PAC1*(Fig. 5D; n=0/12). Taken together the above epistatic analyses show that otpb acts downstream of both fezl and pac1 and that proper development of DA and IT neurons requires the activation of two signaling pathways that converge to coordinate otpb function at different hypothalamic nuclei.

Fig. 3.

Aberrant otpb expression in fezl-deficient embryos. Embryos (at 52 hpf, lateral view) were subjected to whole mount in situ hybridization with either antisense otpb (A-C) or pac1 (D-F) RNA probes followed by immunostaining with an antibody directed against tyrosine hydroxylase (TH; A-F) that detects DA neurons. (A,D) Wild type (WT). (B,E) tofm808 mutants.(C,F) tofm808 embryos were injected, at one-cell stage,with an antisense Fezl morpholino (fezlMO) that blocks proper splicing leading to retention of intron 2 and a shorter protein that lacks most of the zinc finger domain (sp3; see Fig. S6 in the supplementary material). WT heterozygous and tofm808 embryos were scored by TH staining followed by sequencing. Black arrowheads mark deficient otpb expression domains. (G) Delayed IT development in tofm808. Relative number of IT/OT neurons in too few (tofm808) embryos, toffezlMO and their WT siblings at different developmental stages. toffezlMO indicate embryos, in which fezl-directed antisense morpholino was injected into tofm808. Embryos were scored by co-staining of IT and TH followed by sequencing of the tofm808 mutation. WT embryos display 4-7 IT cells (IT>3) on each side of the brain whereas tofm808 display a deficit (IT<3) in IT cell number between 46 and 52 hours of development. The bars were normalized to 100%. The number of scored embryos is indicated on each bar. (H) A scheme depicting an overlay of TH, otpb and pac1 expression domains as they appear in WT embryos (at 52 hpf). HB, hindbrain; LC, locus coeruleus;NPO, neurosecretory preoptic area; PT, posterior tuberculum; Tel,telencephalon. Scale bar: 50 μm.

Fig. 3.

Aberrant otpb expression in fezl-deficient embryos. Embryos (at 52 hpf, lateral view) were subjected to whole mount in situ hybridization with either antisense otpb (A-C) or pac1 (D-F) RNA probes followed by immunostaining with an antibody directed against tyrosine hydroxylase (TH; A-F) that detects DA neurons. (A,D) Wild type (WT). (B,E) tofm808 mutants.(C,F) tofm808 embryos were injected, at one-cell stage,with an antisense Fezl morpholino (fezlMO) that blocks proper splicing leading to retention of intron 2 and a shorter protein that lacks most of the zinc finger domain (sp3; see Fig. S6 in the supplementary material). WT heterozygous and tofm808 embryos were scored by TH staining followed by sequencing. Black arrowheads mark deficient otpb expression domains. (G) Delayed IT development in tofm808. Relative number of IT/OT neurons in too few (tofm808) embryos, toffezlMO and their WT siblings at different developmental stages. toffezlMO indicate embryos, in which fezl-directed antisense morpholino was injected into tofm808. Embryos were scored by co-staining of IT and TH followed by sequencing of the tofm808 mutation. WT embryos display 4-7 IT cells (IT>3) on each side of the brain whereas tofm808 display a deficit (IT<3) in IT cell number between 46 and 52 hours of development. The bars were normalized to 100%. The number of scored embryos is indicated on each bar. (H) A scheme depicting an overlay of TH, otpb and pac1 expression domains as they appear in WT embryos (at 52 hpf). HB, hindbrain; LC, locus coeruleus;NPO, neurosecretory preoptic area; PT, posterior tuberculum; Tel,telencephalon. Scale bar: 50 μm.

To determine the critical period of competence, in which Otpb is able to control DA development we temporally expressed otpb in zebrafish embryos using the aforementioned heat-shock-inducible Otpb construct. Induction of ectopic expression of the Otpb protein was detected at 90 minutes after shifting the temperature from 28°C to 38°C (data not shown). Gain of function of Otpb by such temporal temperature shift resulted in a supernumerary DA phenotype (∼twofold increase) when Otpb was induced at 7 and 10 but not at 14 hpf (Fig. 5E-G). Accordingly, Otpb could rescue the tof phenotype when its expression was induced at 7 but not 14 hpf(Fig. 5C and data not shown). As the majority of DA precursors exit the cell cycle by 14-16 hpf (N. Russek-Blum and G.L., unpublished results) we conclude that Otpb is required in hypothalamic DA progenitors and not in post-mitotic neurons.

PAC1 and its ligand PACAP regulate the levels of Otp protein

Although we demonstrated that otpb is epistatic to pac1,knockdowns of pac1 and of pacap1b had no effect on otpb transcript levels (Fig. 6C and supplementary material Fig. S4). Therefore, unlike the evident effect of fezl/tof on the levels of otpb RNA(Fig. 3A-C), regulation of otpb transcription could not account for the genetic interaction between pac1 and otpb. We then monitored Otp protein in whole embryos following knockdown of either pac1 or its ligand, pacap1b (Fig. 6 and see Fig. S4 in the supplementary material). The levels of Otp protein were moderately reduced in the hypothalamus and hindbrain following injection of pac1MO (Fig. 6D; n=25/30). Western blot analysis of Otp, which allows more accurate quantification of the effects of pac1MO, resulted in a 50% decrease in total Otp protein levels (Fig. 6D). As the anti-Otp antibody we used was raised against a C-terminal epitope of Otp (see Materials and methods) it recognizes both Otpb and its paralog Otpa. These two genes have nearly complete overlapping expression domains (Ryu et al.,2007) (data not shown). To demonstrate the net effect of PAC1 on Otpb protein we compared Otp immunoreactivity in otpa morphants(Fig. 6F; n=22) versus pac1+otpa double morphants(Fig. 6H). Otp immunoreactivity was markedly reduced in the double morphant with no significant change in the levels and in expression pattern of otpb RNA, suggesting that PAC1 might modulate otpb post-transcriptionally(Fig. 6G,H; n=29/30). To further examine this possibility we expressed zebrafish PAC1, PACAP1b and Otpb in a heterologous cell culture system. In agreement with Lin et al.(Lin et al., 1999), transient expression of zebrafish Otpb in the human HEK293 cell line followed by western blot analysis detected an Otp-immunoreactive protein band with an apparent molecular mass of 50 kDa (see Fig. S4 in the supplementary material). Otpb protein levels were increased two- to threefold after coexpression of Otpb with PAC1*, the constitutively activated form of the receptor(Fig. 7A). Higher induction(sixfold) of Otpb protein was detected following coexpression of Otpb and PAC1 together with the PACAP1b precursor protein, but not with an N-terminally truncated form of PACAP1b, denoted Δ1-5-PACAP, which acts as a PAC1 antagonist (Robberecht et al.,1992) (Fig. 7A). Hence, the in vivo genetic interaction between zebrafish pac1 and otpb could be reconstituted in a mammalian system in vitro.

Fig. 4.

Genetic interactions between pac1 and otpb.(A,C-H) High-resolution micrographs of embryos (at 52 hpf,lateral view, anterior to the left) that were subjected to in situ hybridization with an isotocin (IT)-directed probe, followed by immunostaining with an anti-tyrosine hydroxylase (TH) antibody. The two prominent clusters of dopaminergic (DA) neurons (Gr. 2 and Gr. 3-6), stained in brown, as well as isotocinergic (IT) neurons, stained in purple, are indicated. (B) Bar chart showing average cell counts of isotocinergic (IT), dopaminergic Group 2(DA Gr. 2) and Groups 3-6 (DA Gr. 3-6). Error bars indicate s.d. The number of embryos (n) is shown above. In order to represent unilateral cell number (as shown in the micrographs), neurons were counted on both sides of the brain and the total number was divided by two. Statistical analysis for all treatments was done by ANOVA test. Wild-type (WT) embryos were injected with antisense morpholinos directed against either otpb(otpbMO; C,D,E and see Fig. S7 in the supplementary material) or pac1 (pac1MO; F,G,H). (C-H) Embryos were injected with in vitro synthesized capped mRNA encoding either Otpb (D,G; at 7-15 pg per embryo) or a mutant form of PAC1 (denoted pac1*)containing a single E239Q base substitution that renders it constitutively active (E,H; at 200pg per embryo). Injected pac1* and otpb RNAs were constructed without their respective morpholino-binding site, thus enabling a genuine gene-function complementation rather than competition for morpholino binding. The amount of injected mRNA in Otpb and PAC1 gain-of-function experiments was determined by titrating the minimal doses of mRNA that could rescue otpb and pac1morphant phenotype, respectively. Embryos that showed abnormal brain morphology were omitted from our analysis. Scale bar: 50 μm.

Fig. 4.

Genetic interactions between pac1 and otpb.(A,C-H) High-resolution micrographs of embryos (at 52 hpf,lateral view, anterior to the left) that were subjected to in situ hybridization with an isotocin (IT)-directed probe, followed by immunostaining with an anti-tyrosine hydroxylase (TH) antibody. The two prominent clusters of dopaminergic (DA) neurons (Gr. 2 and Gr. 3-6), stained in brown, as well as isotocinergic (IT) neurons, stained in purple, are indicated. (B) Bar chart showing average cell counts of isotocinergic (IT), dopaminergic Group 2(DA Gr. 2) and Groups 3-6 (DA Gr. 3-6). Error bars indicate s.d. The number of embryos (n) is shown above. In order to represent unilateral cell number (as shown in the micrographs), neurons were counted on both sides of the brain and the total number was divided by two. Statistical analysis for all treatments was done by ANOVA test. Wild-type (WT) embryos were injected with antisense morpholinos directed against either otpb(otpbMO; C,D,E and see Fig. S7 in the supplementary material) or pac1 (pac1MO; F,G,H). (C-H) Embryos were injected with in vitro synthesized capped mRNA encoding either Otpb (D,G; at 7-15 pg per embryo) or a mutant form of PAC1 (denoted pac1*)containing a single E239Q base substitution that renders it constitutively active (E,H; at 200pg per embryo). Injected pac1* and otpb RNAs were constructed without their respective morpholino-binding site, thus enabling a genuine gene-function complementation rather than competition for morpholino binding. The amount of injected mRNA in Otpb and PAC1 gain-of-function experiments was determined by titrating the minimal doses of mRNA that could rescue otpb and pac1morphant phenotype, respectively. Embryos that showed abnormal brain morphology were omitted from our analysis. Scale bar: 50 μm.

We next examined whether stimulation of PAC1 with a synthetic ligand could affect Otp protein levels. Treatment of otpb;pac1double-transfected cells with increasing concentrations of a synthetic PACAP38 peptide led to a four- to fivefold increase of Otpb protein(Fig. 7B). We then tested the effects of PACAP38 on otp gene products in the rat PC12 cells, which express endogenous Otp (Fig. 7C,D), and in which the PACAP-PAC1 pathway has been extensively studied (Vaudry et al., 2000). Treatment of PC12 cells for up to 120 minutes with different concentrations of a synthetic PACAP38 neuropeptide led to a fivefold increase of endogenous levels of Otp protein (Fig. 7C,E). In accordance with our in vivo results, quantitative real-time PCR analysis indicated that the level of otp RNA in PC12 cells was unaffected by PACAP stimulation, suggesting that a biochemical pathway triggered by PACAP and its receptor PAC1 regulates Otp at the post-transcriptional level (Fig. 7E). To determine the nature of this post-transcriptional control we examined the ability of PACAP to affect Otp protein stability and synthesis. Otp stability was examined by treating PC12 cells with the translation inhibitor cycloheximide (CHX) and thereafter monitoring the levels of Otp in the absence and presence of PACAP. This analysis showed that Otp protein was relatively stable throughout the time of the experiment and that PACAP-induced accumulation of Otp was blocked by CHX(Fig. 7D,E). This result was corroborated by [35S]methionine pulse-chase kinetics analysis of Otp protein (see Fig. S9 in the supplementary material). To examine Otp synthesis, we measured [35S]methionine incorporation into Otp in the presence or absence of PACAP. The rate of CHX-sensitive[35S]methionine incorporation into Otp was significantly increased upon application of PACAP to PC12 cells(Fig. 7F). Taken together the above results indicate that PACAP controls the levels of Otp by promoting Otp synthesis without affecting the stability of both protein and mRNA.

In conclusion, we identified a novel regulatory network of cell-intrinsic and cell-extrinsic cues that act together to maintain coordinated development of hypothalamic DA and OT-like neurons.

DISCUSSION

In this study, we examined the genetic and biochemical basis for the apparent coordinated fashion in which DA and IT/OT neurons are generated within the relatively small hypothalamic territory. We show that the integration of transcriptional and post-transcriptional inputs that modulate the levels of the homeodomain-containing protein Otp in distinct hypothalamic nuclei (i.e. PT and NPO) may trigger specific differentiation programs that promote DA and IT identities in time and space(Fig. 8).

Tight regulation of Otp during hypothalamic development

It has been suggested that the intersection between the secreted molecules Shh, Fgf8 and Bmp7 creates an induction site for hypothalamic DA identity(Ohyama et al., 2005; Ye et al., 1998). In spite of these reports, the regulation of cell-autonomous determinants, which presumably convert patterning signals into precise control of hypothalamic development, is poorly understood. Otp is a critical cell-intrinsic determinant, which controls the fates, migration and terminal differentiation of mammalian hypothalamic neuroendocrine cells(Acampora et al., 1999; Wang and Lufkin, 2000). We show that regulation of otp levels is important for the spatial and temporal development of IT and DA neurons. We suggest that the tight regulation of Otp is achieved by two sequential manners: first transcription of otp mRNA is induced by Fezl, then Otp protein levels are modulated by PAC1 (Fig. 8). In support of this model, we show that the transcript levels of otpb were markedly affected in the absence of fezl/tof gene function and that the levels of Otp protein were controlled by PAC1 and its ligand PACAP (Figs 3 and 6). Our in vitro analyses show that PACAP affects the rate of Otp protein synthesis, providing a mechanism for the post-transcriptional control of otp, which was observed in vivo (Fig. 7). Interestingly,PACAP exerts a persistent post-transcriptional effect on the steady-state levels of tyrosine hydroxylase in PC12 cells(Corbitt et al., 1998).

Fig. 5.

Otpb is a critical downstream effector of Fezl in DA progenitors.(A-F) Embryos were injected with either a buffer solution (A,B,E) or DNA constructs containing a heat shock element (HSE) expression cassette that drives a GFP tracer together with either otpb (C,F; at 10-20 pg per embryo) or the constitutively active pac1* (D) cDNAs and were grown at 28°C. At 7 hours post fertilization (hpf) embryos were transferred to a permissive temperature of 38°C for a period of 45 minutes and were shifted back to a 28°C incubator. Mosaic embryos expressing the GFP tracer in the ventral diencephalon were selected for further analysis and were thereafter harvested at 52 hpf. DA neurons were scored by either an RNA probe directed to dopamine transporter (dat; A-D) or an anti-tyrosine hydroxylase (TH) antibody (E,F). A-D are siblings derived from a cross between tofm808-/- and tofm808-/+ fish. Subsequent to the phenotypic analysis, embryos were separated into a multiwell dish and were genotyped by sequencing. (G) Bar chart showing the relative changes in DA cell number following conditional activation of Otpb in WT embryos that were injected with a plasmid harboring a heat shock element-driven otpb/gfp (HSE-otpb/gfp) expression cassette. At the indicated times after fertilization, embryos were subjected to a 45 minute temperature shock (38°C) and the number of dat+hypothalamic DA neurons in each embryo was scored at 52 hpf. Scale bar: 50μm.

Fig. 5.

Otpb is a critical downstream effector of Fezl in DA progenitors.(A-F) Embryos were injected with either a buffer solution (A,B,E) or DNA constructs containing a heat shock element (HSE) expression cassette that drives a GFP tracer together with either otpb (C,F; at 10-20 pg per embryo) or the constitutively active pac1* (D) cDNAs and were grown at 28°C. At 7 hours post fertilization (hpf) embryos were transferred to a permissive temperature of 38°C for a period of 45 minutes and were shifted back to a 28°C incubator. Mosaic embryos expressing the GFP tracer in the ventral diencephalon were selected for further analysis and were thereafter harvested at 52 hpf. DA neurons were scored by either an RNA probe directed to dopamine transporter (dat; A-D) or an anti-tyrosine hydroxylase (TH) antibody (E,F). A-D are siblings derived from a cross between tofm808-/- and tofm808-/+ fish. Subsequent to the phenotypic analysis, embryos were separated into a multiwell dish and were genotyped by sequencing. (G) Bar chart showing the relative changes in DA cell number following conditional activation of Otpb in WT embryos that were injected with a plasmid harboring a heat shock element-driven otpb/gfp (HSE-otpb/gfp) expression cassette. At the indicated times after fertilization, embryos were subjected to a 45 minute temperature shock (38°C) and the number of dat+hypothalamic DA neurons in each embryo was scored at 52 hpf. Scale bar: 50μm.

Fig. 6.

Regulation of the Otp protein by PACAP/PAC1 signaling pathway.(A-H) Embryos were injected with either a control pac1missense morpholino (Control, A,B), or with antisense morpholinos directed against pac1 (pac1MO, C,D), otpa(otpaMO, E,F) or combination of pac1+otpa(pac1MO+otpaMO, G,H) and were thereafter (52 hpf) subjected to either in situ hybridization with an otpb-directed probe(A,C,E,G), or to immunohistochemistry with an anti-Otp antibody (B,D,F,H). Inset in panel D shows western blot analysis of nuclear-enriched protein extracts from control and pac1MO-injected embryos using antibodies directed to either Otp or the nuclear protein Rcc1 (internal protein loading control). The activity of each morpholino was evaluated by anti-tyrosine hydroxylase (TH) immunostaining. Scale bars: 100 μm in A,C,E,F; 50 μm in B,D,F,H.

Fig. 6.

Regulation of the Otp protein by PACAP/PAC1 signaling pathway.(A-H) Embryos were injected with either a control pac1missense morpholino (Control, A,B), or with antisense morpholinos directed against pac1 (pac1MO, C,D), otpa(otpaMO, E,F) or combination of pac1+otpa(pac1MO+otpaMO, G,H) and were thereafter (52 hpf) subjected to either in situ hybridization with an otpb-directed probe(A,C,E,G), or to immunohistochemistry with an anti-Otp antibody (B,D,F,H). Inset in panel D shows western blot analysis of nuclear-enriched protein extracts from control and pac1MO-injected embryos using antibodies directed to either Otp or the nuclear protein Rcc1 (internal protein loading control). The activity of each morpholino was evaluated by anti-tyrosine hydroxylase (TH) immunostaining. Scale bars: 100 μm in A,C,E,F; 50 μm in B,D,F,H.

Intrinsic and extrinsic control of DA and IT differentiation

fezl, otp and pac1 are coordinately expressed in the developing hypothalamus (Fig. 2). We report here that all three molecules are necessary for proper development of hypothalamic DA and IT neurons (Figs 4 and 5). Our epistatic and gene expression analyses are consistent with two parallel pathways that co-regulate IT and DA development by acting upstream of otpb.

Fig. 7.

PACAP regulates Otp post-transcriptionally. (A,B)Western blot of equal amounts of protein extracts from HEK293 cells with an anti-Otp antibody followed by an anti-β-actin antibody that served as an internal reference. (A) HEK293 cells were transiently transfected with different combinations of zebrafish cDNAs as indicated and harvested 24 hours post transfection. pac1* encoded a constitutively activated form of pac1. The full-length form of zebrafish pacap1b precursor gene, gives rise to several proteolytically cleaved neuropeptides including growth hormone releasing hormone (GHRH) and PACAP1b(Wang et al., 2003).Δ 1-5pacap1b cDNA had an internal deletion of the first five amino acids of the mature PACAP peptide. (B) HEK293 cells were transfected with the indicated zebrafish cDNAs and 24 hours later monolayer cultures were treated with different concentration of a synthetic PACAP38 peptide for a period of 120 minutes. (C,D) Western blot of nuclear-enriched protein extracts from PC12 cells using either an anti-Otp or anti-Rcc1 antibody (internal control for a ubiquitous nuclear protein). Cells were treated with different concentrations of either PACAP38peptide alone (C), 50 μg/ml cycloheximide (Control+CHX) or PACAP38+CHX (D) and harvested at the indicated time points.(E) Standardized Otp protein and RNA (n=6) levels as a function of time after PACAP38 application to PC12 cells. otp RNA levels were determined by quantitative real-time PCR (RNA at 10 nM). (F) Kinetics of newly synthesized Otp protein in the absence(Control) or presence of 10nM PACAP. PC12 cells were incubated with methionine-free medium containing [35S]methionine (at 100μCi/ml). Protein extracts were made at the indicated times and equal amounts of total protein were subjected to immunoprecipitation with an anti-Otp antibody followed by gel electrophoresis and autoradiography (inset). The correct position of the Otp band was confirmed by performing immunoprecipitation and western blot on the same extracts and by Otp peptide displacement. Ab, antibody; CHX, cycloheximide; IB, immunoblot.

Fig. 7.

PACAP regulates Otp post-transcriptionally. (A,B)Western blot of equal amounts of protein extracts from HEK293 cells with an anti-Otp antibody followed by an anti-β-actin antibody that served as an internal reference. (A) HEK293 cells were transiently transfected with different combinations of zebrafish cDNAs as indicated and harvested 24 hours post transfection. pac1* encoded a constitutively activated form of pac1. The full-length form of zebrafish pacap1b precursor gene, gives rise to several proteolytically cleaved neuropeptides including growth hormone releasing hormone (GHRH) and PACAP1b(Wang et al., 2003).Δ 1-5pacap1b cDNA had an internal deletion of the first five amino acids of the mature PACAP peptide. (B) HEK293 cells were transfected with the indicated zebrafish cDNAs and 24 hours later monolayer cultures were treated with different concentration of a synthetic PACAP38 peptide for a period of 120 minutes. (C,D) Western blot of nuclear-enriched protein extracts from PC12 cells using either an anti-Otp or anti-Rcc1 antibody (internal control for a ubiquitous nuclear protein). Cells were treated with different concentrations of either PACAP38peptide alone (C), 50 μg/ml cycloheximide (Control+CHX) or PACAP38+CHX (D) and harvested at the indicated time points.(E) Standardized Otp protein and RNA (n=6) levels as a function of time after PACAP38 application to PC12 cells. otp RNA levels were determined by quantitative real-time PCR (RNA at 10 nM). (F) Kinetics of newly synthesized Otp protein in the absence(Control) or presence of 10nM PACAP. PC12 cells were incubated with methionine-free medium containing [35S]methionine (at 100μCi/ml). Protein extracts were made at the indicated times and equal amounts of total protein were subjected to immunoprecipitation with an anti-Otp antibody followed by gel electrophoresis and autoradiography (inset). The correct position of the Otp band was confirmed by performing immunoprecipitation and western blot on the same extracts and by Otp peptide displacement. Ab, antibody; CHX, cycloheximide; IB, immunoblot.

Fig. 8.

A model for the development of IT and DA neurons. (A)Regulatory network underlying isotocinergic (IT, purple oval) and dopaminergic(DA, brown hexagon) neurons in the zebrafish hypothalamus (see text). Regulation of Otp by the proneural gene product Neurogenin1 (Neurog1) are yet to be determined (dashed arrow, see Discussion). (B) Expression of pac1, fezl and otp in either IT neurons that reside in the neurosecretory preoptic nucleus (NPO) or DA neurons that reside in the posterior tuberculum (PT) are schematically shown.

Fig. 8.

A model for the development of IT and DA neurons. (A)Regulatory network underlying isotocinergic (IT, purple oval) and dopaminergic(DA, brown hexagon) neurons in the zebrafish hypothalamus (see text). Regulation of Otp by the proneural gene product Neurogenin1 (Neurog1) are yet to be determined (dashed arrow, see Discussion). (B) Expression of pac1, fezl and otp in either IT neurons that reside in the neurosecretory preoptic nucleus (NPO) or DA neurons that reside in the posterior tuberculum (PT) are schematically shown.

The levels of otpb expression may also determine the time of appearence of IT neurons. Thus, the expression of otpb in the NPO was strongly affected in a null tof fezlMO mutant(i.e. tofm808 injected with fezlMO) and only mildly affected in the tofm808 hypomorph(Fig. 3A-C). These levels of otpb transcripts correlated with the sustained absence of IT in tof fezlMO and delayed IT development in the tofm808 hypomorph allele(Fig. 3G). Conversely, the deficit in DA neurons in tofm808 is maintained throughout embryogenesis and in adult mutant animals(Rink and Guo, 2004). The varied sensitivities of otp, IT and DA to Fezl activity correlate with fezl and otp expression patterns: whereas fezland Otp colocalize in the NPO where IT cells develop, only otp is found in DA neurons of the PT (Fig. 2). Lack of Fezl-Otp colocalization in the PT is consistent with our previously published mosaic analysis showing that fezl/tofregulates hypothalamic DA development in a non cell-autonomous manner(Levkowitz et al., 2003). Hence, coordination of IT and DA cells may be attained by different sensitivities of the otpb promoter to Fezl-mediated signal at different hypothalamic territories.

Control of neuronal specification processes by Fezl

Recent studies described the phenotype of Fezl-deficient mice. Similarly to zebrafish, mammalian Fezl is expressed in the telencephalon and diencephalon(Hirata et al., 2004; Mutsuga et al., 2005). In the mouse telencephalon, Fezl is required for fate specification and axonal projections of cortico-spinal motor neurons, subplate cortical neurons and deep-layer pyramidal neurons (Chen et al.,2005a; Chen et al.,2005b; Hirata et al.,2004; Molyneaux et al.,2005). A close homolog of Fezl, denoted Fez, is expressed in the mouse hypothalamus in partially overlapping domains with Fezl and fez-fezl double deficient mouse displays defects in diencephalic subdivisions (Hirata et al.,2006a; Hirata et al.,2006b). A similar role for zebrafish Fezl in diencephalic patterning was also reported (Jeong et al., 2007).

The precise regulation of Otp, DA and IT by the tofm808 hypomorph (Figs 1 and 3) allows us to separate the role of Fezl in regional patterning from its more selective role in cell specification. The fact that Otpb could rescue the fezl/tof phenotype indicates that Otpb is a critical target of Fezl that underlies its effect on hypothalamic differentiation. In this respect, the proneural gene neurogenin1 (neurog1) is regulated by Fezl and is both necessary and sufficient for zebrafish DA development(Jeong et al., 2006). Similarly, dlx2, which controls specification of ventral thalamic DA progenitors in the mouse, is regulated by Fezl(Andrews et al., 2003; Yang et al., 2001). Neither neurog1 nor dlx2 is affected in either otpb or pac1 morphants (data not shown), suggesting that Fezl may control both early regional diencephalic commitment, which is mediated by Neurog1 and Dlx2, and later cell-type specification, which is mediated by Otp(Fig. 8). Notably, there are two zebrafish orthologs of the mammalian Otp gene (denoted otpa and otpb). Although this study demonstrates the function and mode of regulation of otpb, a similar deficit in diencephalic DA neurons was recently found in a null mutant allele of otpa, suggesting that the activity of both otpa and otpb is required for hypothalamic development(Ryu et al., 2007). We found that the transcription of otpa was affected in the absence of the fezl/tof gene, reinforcing the significance of Fezl in regulating hypothalamic cell fate decisions (see Fig. S5 in the supplementary material).

Although the development of diencephalic neurons was not analyzed in detail, hypothalamic neurons appear to be present in Fezl-/- mice(Chen et al., 2005a; Hirata et al., 2004). However,in fezl/tofm808 mutants, otpb morphants and in otp-deficient mice, selective groups of hypothalamic DA neurons are reduced or missing, whereas other DA groups develop normally(Rink and Guo, 2004; Ryu et al., 2007)(Fig. 4). Further analysis is necessary to clarify whether subsets of hypothalamic neurons are affected in fez/fezl-deficient mice.

Finally, activation of the Otp regulatory network might be relevant to adult physiological states as fezl, pac1 and oxytocin are upregulated in the rat SON in response to hyper-osmotic conditions and fezl and oxytocin are downregulated following sustained hypo-osmolality(Gillard et al., 2006; Mutsuga et al., 2005). Moreover, PACAP is enriched in rat mesencephalic DA neurons and protects DA neurons from neurotoxin-induced death(Chung et al., 2005; Grimm et al., 2004; Reglodi et al., 2004).

In sum, our data reveal two novel genetic pathways, which control Otp activity during differentiation of hypothalamic DA and OT-like neurons and may be relevant to hypothalamic developmental defects that cause metabolic and psychiatric clinical disorders.

Acknowledgements

Thanks are due to Thomas Czerny for kindly providing the pSGH2 expression vector; E. Peles, O. Reiner, M. Fainzilber and T. Volk for comments on this work; Shifra Ben-Or and Amos Gutnick for help with the bioinformatics and statistical analyses; Philippe Vernier and members of the Levkowitz lab for stimulating discussions. This study was supported by the Israel Science Foundation grant number 944/04, Parkinson Disease Foundation, Benozyio Center for Neurological Disorders, The Helen and Martin Kimmel Stem Cell Research Institute and Minna James Heineman Foundation. G.L. is an incumbent of the Tauro Career Development Chair in Biomedical Research.

References

Acampora, D., Postiglione, M. P., Avantaggiato, V., Di Bonito,M., Vaccarino, F. M., Michaud, J. and Simeone, A. (
1999
). Progressive impairment of developing neuroendocrine cell lineages in the hypothalamus of mice lacking the Orthopedia gene.
Genes Dev.
13
,
2787
-2800.
Andrews, G. L., Yun, K., Rubenstein, J. L. and Mastick, G. S. (
2003
). Dlx transcription factors regulate differentiation of dopaminergic neurons of the ventral thalamus.
Mol. Cell. Neurosci.
23
,
107
-120.
Bajoghli, B., Aghaallaei, N., Heimbucher, T. and Czerny, T.(
2004
). An artificial promoter construct for heat-inducible misexpression during fish embryogenesis.
Dev. Biol.
271
,
416
-430.
Cao, Y. J., Gimpl, G. and Fahrenholz, F.(
2000
). A mutation in the second intracellular loop of the pituitary adenylate cyclase activating polypeptide type I receptor confers constitutive receptor activation.
FEBS Lett.
469
,
142
-146.
Chen, B., Schaevitz, L. R. and McConnell, S. K.(
2005a
). Fezl regulates the differentiation and axon targeting of layer 5 subcortical projection neurons in cerebral cortex.
Proc. Natl. Acad. Sci. USA
102
,
17184
-17189.
Chen, J. G., Rasin, M. R., Kwan, K. Y. and Sestan, N.(
2005b
). Zfp312 is required for subcortical axonal projections and dendritic morphology of deep-layer pyramidal neurons of the cerebral cortex.
Proc. Natl. Acad. Sci. USA
102
,
17792
-17797.
Chung, C. Y., Seo, H., Sonntag, K. C., Brooks, A., Lin, L. and Isacson, O. (
2005
). Cell type-specific gene expression of midbrain dopaminergic neurons reveals molecules involved in their vulnerability and protection.
Hum. Mol. Genet.
14
,
1709
-1725.
Corbitt, J., Vivekananda, J., Wang, S. S. and Strong, R.(
1998
). Transcriptional and posttranscriptional control of tyrosine hydroxylase gene expression during persistent stimulation of pituitary adenylate cyclase-activating polypeptide receptors on PC12 cells:regulation by protein kinase A-dependent and protein kinase A-independent pathways.
J. Neurochem.
71
,
478
-486.
Gillard, E. R., Leon-Olea, M., Mucio-Ramirez, S., Coburn, C. G.,Sanchez-Islas, E., de Leon, A., Mussenden, H., Bauce, L. G., Pittman, Q. J. and Curras-Collazo, M. C. (
2006
). A novel role for endogenous pituitary adenylate cyclase activating polypeptide in the magnocellular neuroendocrine system.
Endocrinology
147
,
791
-803.
Grimm, J., Mueller, A., Hefti, F. and Rosenthal, A.(
2004
). Molecular basis for catecholaminergic neuron diversity.
Proc. Natl. Acad. Sci. USA
101
,
13891
-13896.
Hirata, T., Suda, Y., Nakao, K., Narimatsu, M., Hirano, T. and Hibi, M. (
2004
). Zinc finger gene fez-like functions in the formation of subplate neurons and thalamocortical axons.
Dev. Dyn.
230
,
546
-556.
Hirata, T., Nakazawa, M., Muraoka, O., Nakayama, R., Suda, Y. and Hibi, M. (
2006a
). Zinc-finger genes Fez and Fez-like function in the establishment of diencephalon subdivisions.
Development
133
,
3993
-4004.
Hirata, T., Nakazawa, M., Yoshihara, S., Miyachi, H., Kitamura,K., Yoshihara, Y. and Hibi, M. (
2006b
). Zinc-finger gene Fez in the olfactory sensory neurons regulates development of the olfactory bulb non-cell-autonomously.
Development
133
,
1433
-1443.
Iversen, S., Iversen, L. and Saper, C. B.(
2000
). The autonomic nervous system and the hypothalamus. In
Principles of Neuroscience.
4th edn (ed. E. R. Kandel,J. H. Schwartz and T. M. Jessell), pp.
960
-981. New York: McGraw-Hill.
Jeong, J. Y., Einhorn, Z., Mercurio, S., Lee, S., Lau, B.,Mione, M., Wilson, S. W. and Guo, S. (
2006
). Neurogenin1 is a determinant of zebrafish basal forebrain dopaminergic neurons and is regulated by the conserved zinc finger protein Tof/Fezl.
Proc. Natl. Acad. Sci. USA
103
,
5143
-5148.
Jeong, J. Y., Einhorn, Z., Mathur, P., Chen, L., Lee, S.,Kawakami, K. and Guo, S. (
2007
). Patterning the zebrafish diencephalon by the conserved zinc-finger protein Fezl.
Development
134
,
127
-136.
Landgraf, R. and Neumann, I. D. (
2004
). Vasopressin and oxytocin release within the brain: a dynamic concept of multiple and variable modes of neuropeptide communication.
Front. Neuroendocrinol.
25
,
150
-176.
Levkowitz, G., Zeller, J., Sirotkin, H. I., French, D.,Schilbach, S., Hashimoto, H., Hibi, M., Talbot, W. S. and Rosenthal, A.(
2003
). Zinc finger protein too few controls the development of monoaminergic neurons.
Nat. Neurosci.
6
,
28
-33.
Lin, X., State, M. W., Vaccarino, F. M., Greally, J., Hass, M. and Leckman, J. F. (
1999
). Identification, chromosomal assignment, and expression analysis of the human homeodomain-containing gene Orthopedia (OTP).
Genomics
60
,
96
-104.
Markakis, E. A. (
2002
). Development of the neuroendocrine hypothalamus.
Front. Neuroendocrinol.
23
,
257
-291.
Michaud, J. L., Rosenquist, T., May, N. R. and Fan, C. M.(
1998
). Development of neuroendocrine lineages requires the bHLH-PAS transcription factor SIM1.
Genes Dev.
12
,
3264
-3275.
Michaud, J. L., DeRossi, C., May, N. R., Holdener, B. C. and Fan, C. M. (
2000
). ARNT2 acts as the dimerization partner of SIM1 for the development of the hypothalamus.
Mech. Dev.
90
,
253
-261.
Molyneaux, B. J., Arlotta, P., Hirata, T., Hibi, M. and Macklis,J. D. (
2005
). Fezl is required for the birth and specification of corticospinal motor neurons.
Neuron
47
,
817
-831.
Mutsuga, N., Shahar, T., Verbalis, J. G., Xiang, C. C.,Brownstein, M. J. and Gainer, H. (
2005
). Regulation of gene expression in magnocellular neurons in rat supraoptic nucleus during sustained hypoosmolality.
Endocrinology
146
,
1254
-1267.
Ohyama, K., Ellis, P., Kimura, S. and Placzek, M.(
2005
). Directed differentiation of neural cells to hypothalamic dopaminergic neurons.
Development
132
,
5185
-5197.
Peter, R. E. and Fryer, J. N. (
1983
). Endocrine functions of the hypothalamus of actinopterygians. In
Fish Neurobiology. Higher Brain Areas and Functions
(ed. R. E. Davis and R. G. Northcutt), pp.
165
-201. Ann Arbor, MI:University of Michigan Press.
Peyron, C., Faraco, J., Rogers, W., Ripley, B., Overeem, S.,Charnay, Y., Nevsimalova, S., Aldrich, M., Reynolds, D., Albin, R. et al.(
2000
). A mutation in a case of early onset narcolepsy and a generalized absence of hypocretin peptides in human narcoleptic brains.
Nat. Med.
6
,
991
-997.
Puelles, L. and Rubenstein, J. L. (
2003
). Forebrain gene expression domains and the evolving prosomeric model.
Trends Neurosci.
26
,
469
-476.
Reglodi, D., Lubics, A., Tamas, A., Szalontay, L. and Lengvari,I. (
2004
). Pituitary adenylate cyclase activating polypeptide protects dopaminergic neurons and improves behavioral deficits in a rat model of Parkinson's disease.
Behav. Brain Res.
151
,
303
-312.
Rink, E. and Wullimann, M. F. (
2002
). Development of the catecholaminergic system in the early zebrafish brain: an immunohistochemical study.
Brain Res. Dev. Brain Res.
137
,
89
-100.
Rink, E. and Guo, S. (
2004
). The too few mutant selectively affects subgroups of monoaminergic neurons in the zebrafish forebrain.
Neuroscience
127
,
147
-154.
Robberecht, P., Gourlet, P., De Neef, P., Woussen-Colle, M. C.,Vandermeers-Piret, M. C., Vandermeers, A. and Christophe, J.(
1992
). Structural requirements for the occupancy of pituitary adenylate-cyclase-activating-peptide (PACAP) receptors and adenylate cyclase activation in human neuroblastoma NB-OK-1 cell membranes. Discovery of PACAP(6-38) as a potent antagonist.
Eur. J. Biochem.
207
,
239
-246.
Rohr, K. B., Barth, K. A., Varga, Z. M. and Wilson, S. W.(
2001
). The nodal pathway acts upstream of hedgehog signaling to specify ventral telencephalic identity.
Neuron
29
,
341
-351.
Ryu, S., Mahler, J., Acampora, D., Holzschuh, J., Erhardt, S.,Omodei, D., Simeone, A. and Driever, W. (
2007
). Orthopedia homeodomain protein is essential for diencephalic dopaminergic neuron development.
Curr. Biol.
17
,
873
-880.
Sambrook, J. and Russell, D. W. (
2001
). Expression of cloned genes in Escherichia coli. In
Molecular Cloning: A Laboratory Manual
. Vol.
3
, pp.
15.18
-15.19. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Schonemann, M. D., Ryan, A. K., McEvilly, R. J., O'Connell, S. M., Arias, C. A., Kalla, K. A., Li, P., Sawchenko, P. E. and Rosenfeld, M. G. (
1995
). Development and survival of the endocrine hypothalamus and posterior pituitary gland requires the neuronal POU domain factor Brn-2.
Genes Dev.
9
,
3122
-3135.
Schreiber, E., Matthias, P., Muller, M. M. and Schaffner, W.(
1989
). Rapid detection of octamer binding proteins with`mini-extracts', prepared from a small number of cells.
Nucleic Acids Res.
17
,
6419
.
Swaab, D. F. (
2004
). Neuropeptides in hypothalamic neuronal disorders.
Int. Rev. Cytol.
240
,
305
-375.
Swaab, D. F., Purba, J. S. and Hofman, M. A.(
1995
). Alterations in the hypothalamic paraventricular nucleus and its oxytocin neurons (putative satiety cells) in Prader-Willi syndrome: a study of five cases.
J. Clin. Endocrinol. Metab.
80
,
573
-579.
Unger, J. L. and Glasgow, E. (
2003
). Expression of isotocin-neurophysin mRNA in developing zebrafish.
Gene Expr. Patterns
3
,
105
-108.
Vaudry, D., Gonzalez, B. J., Basille, M., Yon, L., Fournier, A. and Vaudry, H. (
2000
). Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions.
Pharmacol. Rev.
52
,
269
-324.
Wang, W. and Lufkin, T. (
2000
). The murine Otp homeobox gene plays an essential role in the specification of neuronal cell lineages in the developing hypothalamus.
Dev. Biol.
227
,
432
-449.
Wang, W., Grimmer, J. F., Van De Water, T. R. and Lufkin, T.(
2004
). Hmx2 and Hmx3 homeobox genes direct development of the murine inner ear and hypothalamus and can be functionally replaced by Drosophila Hmx.
Dev. Cell
7
,
439
-453.
Wang, Y., Wong, A. O. and Ge, W. (
2003
). Cloning, regulation of messenger ribonucleic acid expression, and function of a new isoform of pituitary adenylate cyclase-activating polypeptide in the zebrafish ovary.
Endocrinology
144
,
4799
-4810.
Wu, S., Adams, B. A., Fradinger, E. A. and Sherwood, N. M.(
2006
). Role of two genes encoding PACAP in early brain development in zebrafish.
Ann. N. Y. Acad. Sci.
1070
,
602
-621.
Yang, Z., Liu, N. and Lin, S. (
2001
). A zebrafish forebrain-specific zinc finger gene can induce ectopic dlx2 and dlx6 expression.
Dev. Biol.
231
,
138
-148.
Ye, W., Shimamura, K., Rubenstein, J. L., Hynes, M. A. and Rosenthal, A. (
1998
). FGF and Shh signals control dopaminergic and serotonergic cell fate in the anterior neural plate.
Cell
93
,
755
-766.

Supplementary information