In Xenopus, Wnt signals and their transcriptional effectorβ-catenin are required for the development of dorsal axial structures. In zebrafish, previous loss-of-function studies have not identified an essential role for β-catenin in dorsal axis formation, but the maternal-effect mutation ichabod disrupts β-catenin accumulation in dorsal nuclei and leads to a reduction of dorsoanterior derivatives. We have identified and characterized a second zebrafish β-catenin gene,β-catenin-2, located on a different linkage group from the previously studied β-catenin-1, but situated close to the ichabod mutation on LG19. Although the ichabod mutation does not functionally alter the β-catenin-2 reading frame, the level of maternal β-catenin-2, but not β-catenin-1,transcript is substantially lower in ichabod, compared with wild-type, embryos. Reduction of β-catenin-2 function in wild-type embryos by injection of morpholino antisense oligonucleotides (MOs)specific for this gene (MO2) results in the same ventralized phenotypes as seen in ichabod embryos, and administration of MO2 to ichabod embryos increases the extent of ventralization. MOs directed against β-catenin-1 (MO1), by contrast, had no ventralizing effect on wild-type embryos. β-catenin-2 is thus specifically required for organizer formation and this function is apparently required maternally, because the ichabod mutation causes a reduction in maternal transcription of the gene and a reduced level of β-catenin-2 protein in the early embryo. A redundant role of β-catenins in suppressing formation of neurectoderm is revealed when both β-catenin genes are inhibited. Using a combination of MO1 and MO2 in wild-type embryos,or by injecting solely MO1 in ichabod embryos, we obtain expression of a wide spectrum of neural markers in apparently appropriate anteroposterior pattern. We propose that the early, dorsal-promoting function ofβ-catenin-2 is essential to counteract a later, dorsal- and neurectoderm-repressing function that is shared by both β-catenin genes.
INTRODUCTION
Wnt signaling pathways are involved in both formation of the major dorsal signaling centers in vertebrate embryos (i.e. Nieuwkoop center and Spemann organizer and cognate structures) (Harland and Gerhart, 1997; Sokol,1999; Tao et al.,2005; Schier and Talbot,2005) and also, somewhat later in development, in the posteriorizing and ventralizing signals that derive from more lateral and ventral embryonic regions (Erter et al.,2001; Lekven et al.,2001). Indeed, a GFP reporter assay for β-catenin-responsive gene activation in the zebrafish reveals Wnt signaling activity in a localized, presumably dorsal, domain at dome stage, and in both dorsal and ventrolateral discrete domains at shield stage(Dorsky et al., 2002). These two phases of Wnt signaling have been considered (e.g. Kim et al., 2002; Momoi et al., 2003) as components of sequential activator and transformer signals that fit Nieuwkoop's two signal model of neural induction and patterning(Nieuwkoop et al., 1952; Nieuwkoop and Nitgevecht,1954).
Wnt signaling mediated by the transcriptional effector β-catenin plays an essential role in axis formation and neural induction. A functionalβ-catenin gene is essential for formation of the Nieuwkoop center and Spemann organizer in amphibians (Heasman et al., 1994; Wylie et al.,1996; Heasman, 2000) and for gastrulation and normal axis formation in the mouse (Haegel et al., 1995; Huelsken et al., 2000). Accumulation of nuclear β-catenin is first observed on the dorsal side of pregastrula Xenopus (Schneider et al., 1996; Larabell et al.,1997; Rowning et al.,1997) and zebrafish (Schneider et al., 1996; Kelly et al.,2000; Dougan et al.,2003) embryos, consistent with the key role of β-catenin in initiating the activation of dorsalizing genes.
In zebrafish embryos bred from females homozygous for ichabod, a spontaneous maternal effect mutation resulting in severe ventralization,β-catenin fails to localize to dorsal yolk syncytial layer (YSL) and blastomere nuclei (Kelly et al.,2000). RNA injection experiments showed that Wnt pathway components upstream of β-catenin failed to rescue these embryos, but RNAs for β-catenin and for the downstream nodal-related factor Squint(Znr2/Ndr1) and homeodomain factor Bozozok (Dharma/Nieuwkoid) can rescue the embryos to wild-type phenotype (Kelly et al., 2000). These results indicated that failure to regulateβ-catenin properly in the zebrafish embryo results in loss of dorsal axial structures.
The Wnt pathway also promotes posterior and ventral fates and inhibits formation of anterior neural tissue. wnt8, expressed in the ventrolateral germ ring (Kelly et al.,1995b), is required for formation of ventrolateral and posterior mesoderm and spinal cord and posterior brain(Lekven et al., 2001; Erter et al., 2001; Momoi et al., 2003; Ramel and Lekven, 2004). Similarly, Xenopus wnt8 is expressed in the ventrolateral marginal zone (and in a wider vegetal region)(Christian et al., 1991; Smith and Harland, 1991; Christian and Moon, 1993) and may have a similar posteriorizing role(Christian and Moon, 1993; Hoppler et al., 1996; Fredieu et al., 1997). Ventralizing and posteriorizing Wnt signals also appear to be dependent on β-catenin (Dorsky et al.,2002; Weidinger et al.,2005) and thus, may be impaired in embryos with β-catenin deficiencies.
We report here that the zebrafish genome contains a second β-catenin gene, β-catenin-2 (ctnnb2 - Zebrafish Information Network). Considering that both the formation of the organizer and the somewhat later posteriorizing and ventralizing effects of Wnt signaling are both mediated by β-catenin, it was of interest to explore the degree of redundancy of function of the two β-catenins in this organism. Moreover,we report that β-catenin-2 maps close to the ichabodmutation and that maternal expression of β-catenin-2 is impaired in ichabod mutant embryos, and we provide evidence thatβ-catenin-2 is the sole β-catenin gene required for formation of the dorsal organizer in the zebrafish. When onlyβ-catenin-1 (ctnnb1 - Zebrafish Information Network)function was inhibited, we observed no early patterning defects, indicating that this factor was not solely required for Wnt signaling activities that control the extent and nature of posterior and ventral tissue formation. Inhibiting the expression of both β-catenin genes, however, resulted in an unexpected phenotype in which neurectoderm of both anterior and posterior identity develop with at least some appropriate anteroposterior patterning. Thus, the two β-catenin genes normally act with functional redundancy to restrict formation of neurectoderm. In the absence of bothβ-catenin-1 and β-catenin-2 function, the embryo fails to form a recognizable organizer, but as a consequence of the loss of repressive effects on neurectoderm formation, the embryo is still capable of expressing both posterior and anterior neural makers.
MATERIALS AND METHODS
Fish husbandry
Embryos of the brass strain of zebrafish (originally obtained from EkkWill Waterlife Resources, Gibbonston, FL), selected as `wild-type' embryos because their delayed onset of pigmentation is advantageous for hybridization,were raised under standard conditions at 28.5°C(Westerfield, 1993). ichabod p1 embryos were obtained by breeding homozygous ichabod females with brass males. Only ichabodfemales that reproducibly gave severely ventralized phenotypes were used in this work. Throughout this report, we will use the expression`ichabod embryos' to mean those embryos derived from homozygous ichabod mothers.
DNA constructs and phylogenetic analysis
Sequence searches of the zebrafish EST database identified ESTs that defined fragments of a second β-catenin gene in zebrafish, which we termβ-catenin-2. Sequences from these ESTs were used to identify a PCR-based polymorphism (primers: 5′-CCTACCTGGATTCAGGGATTC-3′ and 5′-ATGAGCAGAGTCGAACTGGGT-3′) for genetic mapping and to obtain a full-length cDNA clone by screening an embryonic cDNA library. The sequence of the β-catenin-2 cDNA has been deposited in GenBank (Accession Number AF329680). β-catenin-2 was mapped to the telomeric region of LG 19 by scoring the polymorphism in the Heat Shock mapping panel(Woods et al., 2000; Woods et al., 2005).
The following clones were used to prepare antisense probes for hybridization and/or sense RNAs for embryo injection:β-catenin-1 (Kelly et al.,1995a), β-catenin-2, krox20(Oxtoby and Jowett, 1993), emx1 (Morita et al.,1995), hoxb6b (previously named hoxa7)(Prince et al., 1998), islet-1 (Inoue et al.,1994), myoD (Weinberg et al., 1996), bozozok/nieuwkoid/dharma(Koos and Ho, 1998), squint/znr2/ndr1 (Erter et al.,1998; Rebagliati et al.,1998), chordin(Miller-Bertoglio et al.,1997) and goosecoid(Stachel et al., 1993).β-catenin-2* RNA contained nucleotides -100 to +15 ofβ-catenin-1 (Accession Number NM_131059) substituted for -167 to+3 of β-catenin-2 (Accession Number AF329680) andβ-catenin-1* RNA contained nucleotides -120 to +3 ofβ-catenin-2 substituted for -195 to +3 ofβ-catenin-1, where +1 is the A of the initiating ATG codon. The coding sequence of β-catenin-1* was identical toβ-catenin-1, but the coding sequence ofβ-catenin-2* contained an additional four amino acids after the initiating methionine.
For phylogenetic analysis, translated cDNA sequences were aligned using MUSCLE (Edgar, 2004) and based on this alignment, a maximum parsimony tree of nucleic acid coding sequence was performed using the protpars program from the PHYLIP package(Felsenstein, 1989). For this analysis, 1000 bootstrap replicates were performed. Accession Numbers for theβ-catenin genes of rat, human, chicken, Pelodiscus sinensis (a turtle), Xenopus laevis, goldfish and Ciona intestinalisare, respectively, NM_053357, NM_001904, NM_205081, AB124575, BC082826,AY336093 and AB031543. Sequences of the two β-catenin genes of Tetraodon and Takifugu were obtained from the data bases of the Tetraodon(http://www.genoscope.cns.fr/externe/English/Projets/Projet_C/C.html)and Takifugu(http://fugu.hgmp.mrc.ac.uk/)genome projects.
RNA probe synthesis, hybridization, mRNA synthesis and injection
Antisense RNA probes were synthesized and hybridization procedures were performed as previously described (Kelly et al., 2000) except that BM purple alkaline phosphatase substrate(Roche) was used as chromogen. Capped mRNAs were synthesized using the appropriate mMessage mMachine Kit (Ambion), following the manufacturer's protocol. RNAs were stored in distilled sterile H2O at -80°C,and injection solutions were prepared by adjusting the RNA concentration to twice that desired and then adding an equal volume of Dulbecco's modified phosphate-buffered saline containing 0.5% Phenol Red (Sigma). Approximately 1 nl of RNA solution was injected through the intact chorion into the yolk at the base of the blastomeres of one- to four-cell stage embryos, using an agar mold to hold the embryos.
Morpholino antisense oligonucleotide injections
The following custom-designed morpholino antisense oligonucleotides were obtained from Gene Tools (Philomath, OR): β-catenin-1 MO1,CTGGGTAGCCATGATTTTCTCACAG; β-catenin-1 MO1mis,CTcGGaAGCCATcATTTTCaCAgAG; β-catenin-1 MO1-2,CTGTGTCAAAAGCTGTATATTCCTG; β-catenin-1 MO1-3,CAGCACGTAAAACGCGAATAATGGC; β-catenin-2 MO2,CCTTTAGCCTGAGCGACTTCCAAAC; β-catenin-2 MO2mis,CgTTTaGCCTcAGCGACTTgCAtAC; and β-catenin-2 MO2-2,GTGTCTTGTAAGCAGTGAATCCACC. The morpholino oligonucleotides were diluted and injected as described above for the RNAs.
RT-PCR
Total RNA was isolated from 20 whole embryos using TRIzol reagent(Invitrogen). Oligo-dT-primed cDNA was synthesized and RT-PCR reactions were performed using SuperScript First-Strand Synthesis System for RT-PCR(Invitrogen) from 14 μg of total RNA, following the manufacturer's protocol. Separate reactions were set up with primer pairs derived fromβ-catenin-1, β-catenin-2 and ef1αusing 25 cycles at an annealing temperature of 55°C (in the semi-quantitative range). The following primers were used for the amplifications: β-catenin-1,5′-CGCACACATTCACTCTCAGC-3′ and 5′-TGGGTAGCCATGATTTTCTCA-3′; β-catenin-2,5′-ACGCTCAGGATCTGATGGAC-3′ and 5′-AGGCACTTTCTGAACCTCCA-3′; ef1α,5′-ACCGGCCATCTGATCTACAA-3′ and 5′-CAATGGTGATACCACGCTCA-3′.
RESULTS
Identification of a second zebrafish β-cateningene
Sequence searches identified zebrafish ESTs (e.g. AI657717) that represented fragments of a second β-catenin gene in the zebrafish genome,which we term β-catenin-2. A full-length cDNA clone (GenBank Accession Number AF329680) was isolated by screening a zebrafish embryo cDNA library with probes derived from these EST sequences. The β-catenin-2 open reading frame (ORF) is predicted to encode a protein of 778 amino acids. The nucleotide sequence of the protein coding region is 82% identical to the previously characterized zebrafish β-catenin gene(Kelly et al., 1995a),hereafter named β-catenin-1. No significant homology was found in the 5′ UTR and 3′ UTR when comparing theβ-catenin-1 and β-catenin-2 cDNAs. Theβ-catenin 1 and 2 proteins are 92.9% identical and 96.4% similar. Most of the protein is highly conserved, with 96.1% identity from amino acids 1-686. Only the C-terminal 92 amino acids (#687-778), comprising part of the C-terminal activation domain, showed marked divergence, and even here the sequence identity was 70.2% (Fig. 1A). Although these proteins are highly conserved, zebrafishβ-catenin-2 is more diverged from zebrafish β-catenin-1 than the latter is from any of the tetrapod β-catenins. Maximum parsimony phylogenetic analysis of nucleotide sequences shows that zebrafishβ-catenin-1 is part of a highly conserved branch that includes human,mouse, Xenopus, goldfish and pufferfish β-catenins, with zebrafish β-catenin-2 and a second β-catenin gene (not clearly orthologous) of pufferfish (both Fugu and Tetraodon)branching off somewhat earlier (Fig. 1B). All of these vertebrate β-catenins are more related to one another than to ascidian, D. melanogaster or C. elegansβ-catenins, or to vertebrate plakoglobins (data not shown).
We mapped β-catenin-2 near the telomere of LG19 (this work)(Woods et al., 2005), whereasβ-catenin-1 had already been mapped to LG16(Postlethwait et al., 1998). Although the phenotype of the ichabod mutation was consistent with a loss of function of a β-catenin gene, we had ruled out the involvement ofβ-catenin-1, the only known zebrafish β-catenin gene at the time of the initial characterization of this mutant, because the mutation mapped to LG19 (Kelly et al.,2000). The finding of a second β-catenin gene on the same region as ichabod prompted us to re-examine whether the ichabod phenotype was a consequence of a loss of function ofβ-catenin-2.
The ichabod mutation maps near β-catenin-2 but does not functionally change its ORF
Map crosses were set up between ichabod homozygous females and brass males and the resulting fertilized eggs were injected withβ-catenin-2 RNA, which allowed rescue of these embryos to fertile adult fish. These heterozygotes were mated with each other and the F2 generation raised to adulthood. DNA was prepared from the adult female ichabod homozygotes (identified from the ichabod phenotype of their F3 offspring embryos), and tested for linkage of simple sequence repeat markers by standard techniques(Talbot and Schier, 1999). As shown in Fig. 2A, ichabod is located near the telomere of LG19, 1.1 cM distal to a CA repeat marker (CA85.6-3, a marker polymorphic for the map cross, found from genomic sequence to be closely linked to the non-polymorphic z26695 marker),and close to the position of β-catenin-2, which had been mapped to the same region in a separate map cross(Woods et al., 2000; Woods et al., 2005). We found that six markers distal to CA85.6-3, extending to a genetic distance of 10 cM from this marker, failed to show any recombination with the ichabodlocus. One of these markers was a CA repeat marker (CA91.6-1) located within the 3′ UTR of β-catenin-2. Because these results suggested a suppression of recombination in the telomeric region of ichabodLG19, we retested recombination frequencies of a number of markers from this region in an independent map cross (Fig. 2B). These markers were found to recombine with each other, as expected from their previously reported map positions(Shimoda et al., 1999)(http://zebrafish.mgh.harvard.edu/zebrafish/index.htm). Thus, it appears that the ichabod chromosome contains a region of suppressed recombination, perhaps owing to an inversion or other chromosomal rearrangement, in proximity to both the ichabod locus and theβ-catenin-2 gene. It is interesting in this regard that the cycb16 mutation, a deletion of the cyclops region near the telomere of LG12, also suppresses recombination on that chromosome(Talbot et al., 1998).
Comparison of sequence of zebrafish β-catenin-2 with otherβ-catenins. (A) ClustalW-generated sequence alignment of the least conserved regions of Xenopus β-catenin (Accession Number AAA49670), goldfish β-catenin (AAP94282.1), zebrafish β-catenin-1(AAC59732.1), zebrafish β-catenin-2 (AAM53438.1), and computationally predicted β-catenin-1 and β-catenin-2 proteins from Fuguand Tetraodon (using Ensembl genomic data sets). Of the 55 amino acid differences between the two zebrafish β-catenins, five changes are at positions 105-109 and 28 are in the N-terminal end of the protein (the same region that shows high levels of divergence in the predicted pufferfishβ-catenin-2 proteins). Based on sequences in these two regions, zebrafishβ-catenin-1 clearly forms a closely related group with the Xenopus and goldfish β-catenins, and with pufferfishβ-catenin-1, whereas zebrafish and pufferfish β-catenin-2 are more distantly related. (B) Maximum parsimony analysis of vertebrate and Ciona β-catenin cDNA nucleotide coding sequences. Numbers indicate the hits supporting the branching pattern from 1000 bootstraps.
Comparison of sequence of zebrafish β-catenin-2 with otherβ-catenins. (A) ClustalW-generated sequence alignment of the least conserved regions of Xenopus β-catenin (Accession Number AAA49670), goldfish β-catenin (AAP94282.1), zebrafish β-catenin-1(AAC59732.1), zebrafish β-catenin-2 (AAM53438.1), and computationally predicted β-catenin-1 and β-catenin-2 proteins from Fuguand Tetraodon (using Ensembl genomic data sets). Of the 55 amino acid differences between the two zebrafish β-catenins, five changes are at positions 105-109 and 28 are in the N-terminal end of the protein (the same region that shows high levels of divergence in the predicted pufferfishβ-catenin-2 proteins). Based on sequences in these two regions, zebrafishβ-catenin-1 clearly forms a closely related group with the Xenopus and goldfish β-catenins, and with pufferfishβ-catenin-1, whereas zebrafish and pufferfish β-catenin-2 are more distantly related. (B) Maximum parsimony analysis of vertebrate and Ciona β-catenin cDNA nucleotide coding sequences. Numbers indicate the hits supporting the branching pattern from 1000 bootstraps.
Sequence comparison of RT-PCR β-catenin-2 products from wild-type and ichabod homozygous fish revealed one amino acid change in the conceptually translated sequence. This change, a valine to methionine at position 450, however, does not diminish the ability of injectedβ-catenin-2 RNA to rescue the ventral phenotypes of ichabod embryos, as efficient rescue was obtained in two separate experiments.
ichabod maps near the β-catenin-2 locus in the telomeric region of LG19. (A) Linkage map of the distal region of LG19 obtained from a map cross of an ichabod female and brass male (see text for description). Map positions (in cM) are obtained from the latest update of the integrated map of the zebrafish genome(see Day et al. at http://zfin.org). Two markers were tested for map position 91.5 cM (z68894/z24777) and for map position 91.6 (z1799/CA91.6-1) and single markers were tested at other map positions. Recombination frequencies (recombinants/meiosis tested) between ichabod and each of the markers are shown below the map. In addition to testing SSLP markers from the MGH microsatellite map (`Z' markers), we tested two additional markers: (1) CA85.6-3, a polymorphic CA-repeat marker located 1.5 kb from the non-polymorphic marker, Z26695, previously mapped to position 85.6 cM on LG19; and (2) CA(91.6)-1, a polymorphic CA-repeat marker found within the 3′UTR of β-catenin-2 cDNA [an EST forβ-catenin-2, fc16f05/mgc:65770 had previously been mapped to 91.6 on the heat shock meiotic panel by Ian Woods and William Talbot(unpublished)]. The closest marker showing recombination with ichabodwas CA(85.6)-3, located 1.1 cM away. No recombinants were obtained between ichabod and z68894, z24777, CA(91.6)-1, z1799, z25291 and z61401,even though these markers were spread over a region extending almost 10 cM from CA(85.6)-3. (B) Linkage map of SSLP markers determined from a completely independent map cross (generated from a WIK ×OregonAB/TübingenWT cross). To test if the map positions in the non-recombinant region of the map cross shown in A were correct, we determined recombination frequencies using markers that spanned this region. As is indicated, in contrast to the ichabod map cross, we did observe recombination in this region of LG19 (except between markers z14236 and z25291).
ichabod maps near the β-catenin-2 locus in the telomeric region of LG19. (A) Linkage map of the distal region of LG19 obtained from a map cross of an ichabod female and brass male (see text for description). Map positions (in cM) are obtained from the latest update of the integrated map of the zebrafish genome(see Day et al. at http://zfin.org). Two markers were tested for map position 91.5 cM (z68894/z24777) and for map position 91.6 (z1799/CA91.6-1) and single markers were tested at other map positions. Recombination frequencies (recombinants/meiosis tested) between ichabod and each of the markers are shown below the map. In addition to testing SSLP markers from the MGH microsatellite map (`Z' markers), we tested two additional markers: (1) CA85.6-3, a polymorphic CA-repeat marker located 1.5 kb from the non-polymorphic marker, Z26695, previously mapped to position 85.6 cM on LG19; and (2) CA(91.6)-1, a polymorphic CA-repeat marker found within the 3′UTR of β-catenin-2 cDNA [an EST forβ-catenin-2, fc16f05/mgc:65770 had previously been mapped to 91.6 on the heat shock meiotic panel by Ian Woods and William Talbot(unpublished)]. The closest marker showing recombination with ichabodwas CA(85.6)-3, located 1.1 cM away. No recombinants were obtained between ichabod and z68894, z24777, CA(91.6)-1, z1799, z25291 and z61401,even though these markers were spread over a region extending almost 10 cM from CA(85.6)-3. (B) Linkage map of SSLP markers determined from a completely independent map cross (generated from a WIK ×OregonAB/TübingenWT cross). To test if the map positions in the non-recombinant region of the map cross shown in A were correct, we determined recombination frequencies using markers that spanned this region. As is indicated, in contrast to the ichabod map cross, we did observe recombination in this region of LG19 (except between markers z14236 and z25291).
Maternal expression of β-catenin-2, but not β-catenin-1, is decreased in ichabod embryos
The mapping data, and the possibility that the ichabod mutation involves a chromosomal rearrangement near β-catenin-2, prompted us to test whether ichabod embryos had decreased levels ofβ-catenin-2 transcript. We examined this by RT-PCR and by hybridization. Semi-quantitative RT-PCR (Fig. 3A) revealed no differences in β-catenin-1 transcript levels between wild-type and ichabod embryos at all stages examined, from the one-cell stage to 24 hpf. By contrast, β-catenin-2 transcript levels were markedly reduced in ichabod embryos from the one-cell stage to 50% epiboly. At bud stage, the level of β-catenin-2 RNA was only slightly lower in mutant embryos and by 24 hpf, the levels of this transcript were about the same in the two types of embryos. These results indicate that ichabod embryos exhibit a specific deficit in maternal (but not zygotic) expression of β-catenin-2.
In situ hybridization also revealed that β-catenin-2 mRNA is reduced in ichabod mutant embryos at early stages(Fig. 3B-M). In wild-type embryos, β-catenin-1 and β-catenin-2 transcripts were observed at the one-cell stage (Fig. 3B,H)and ubiquitously at sphere (Fig. 3C,I) and 90% epiboly stages(Fig. 3D,J). At the 90% epiboly stage, there was somewhat more pronounced expression of both genes in the dorsal midline. In ichabod embryos, there was little difference in expression of β-catenin-1 at the two early stages(Fig. 3E,F), and at 90%epiboly, expression in the animal half of the embryo was reduced and expression in the vegetal half of the embryo was more intense(Fig. 3G). The results were very different with β-catenin-2 expression at the one-cell and sphere stage embryos (Fig. 3K,L), which revealed a very low expression of this gene in ichabod embryos. By 90% epiboly(Fig. 3M), someβ-catenin-2 transcript can be detected, mainly in the vegetal half of the embryo. These findings support the idea that ichabodembryos are defective in maternal expression of β-catenin-2.Results from microarray hybridization experiments also were consistent with these findings. Using a Sigma-Compugen oligonucleotide microarray and RNA targets prepared from wild-type or ichabod embryos at 30% epiboly, we found that β-catenin-2 showed 3.7-fold downregulation in the mutant embryos (W. Wang, S.M. and E.S.W. unpublished). As will be described later, indirect assays using western immunoblotting show that pre-gastrula ichabod embryos are deficient in β-catenin-2, but notβ-catenin-1, protein. Thus, four lines of evidence all reveal a deficit in maternal expression of β-catenin-2 in ichabodembryos, but indicate no downregulation of zygotic expression of this gene or of maternal or zygotic expression of β-catenin-1 in mutant embryos.
Maternal β-catenin-2 transcript is reduced in ichabodembryos. (A) RT-PCR assay of RNA expression levels in wild-type and ichabod embryos. For each stage shown, oligo dT-primed cDNA was used as a template for three separate PCR amplifications using primers forβ-catenin-1, β-catenin-2 and ef1α. Maternal β-catenin-2 transcript was reduced in ichabod embryos,but reduction of maternal β-catenin-1 transcript or zygotic transcripts of either gene was not observed. (B-M) Whole-mount in situ hybridization showing ubiquitous expression of both β-catenin genes and low expression of maternal β-catenin-2. One-cell stage (top row:B,E,H,K), sphere stage (middle row: C,F,I,L) and 90% epiboly (bottom row:D,G,J,M) wild-type (B-D, H-J) and ichabod (E-G, K-M) embryos were tested for expression of β-catenin-1 (B-G) andβ-catenin-2 (H-M). Embryos in D,J are shown in lateral view with dorsal towards the right.
Maternal β-catenin-2 transcript is reduced in ichabodembryos. (A) RT-PCR assay of RNA expression levels in wild-type and ichabod embryos. For each stage shown, oligo dT-primed cDNA was used as a template for three separate PCR amplifications using primers forβ-catenin-1, β-catenin-2 and ef1α. Maternal β-catenin-2 transcript was reduced in ichabod embryos,but reduction of maternal β-catenin-1 transcript or zygotic transcripts of either gene was not observed. (B-M) Whole-mount in situ hybridization showing ubiquitous expression of both β-catenin genes and low expression of maternal β-catenin-2. One-cell stage (top row:B,E,H,K), sphere stage (middle row: C,F,I,L) and 90% epiboly (bottom row:D,G,J,M) wild-type (B-D, H-J) and ichabod (E-G, K-M) embryos were tested for expression of β-catenin-1 (B-G) andβ-catenin-2 (H-M). Embryos in D,J are shown in lateral view with dorsal towards the right.
β-Catenin-2, but not β-catenin-1, is required for organizer formation
To determine if β-catenin-2 is essential for development of dorsal axial structures, we injected morpholino antisense oligonucleotides(MOs) into one- to two-cell stage wild-type embryos. Injection of an MO directed against the translation initiation region ofβ-catenin-2 (MO2) phenocopied ichabod(Fig. 4D-H), whereas an MO directed against the translation initiation region ofβ-catenin-1 (MO1) had no ventralizing effect(Fig. 4A-C). After injection,embryos were allowed to develop to 24 hpf and then scored for degree of ventralization using a slight modification of previously defined criteria(Kelly et al., 2000). C1-C4 embryos all lack notochord and have increasing amounts of neural tube. C1 embryos (e.g. Fig. 4F) lack an embryonic axis, have a protruding tail-like structure, often with multiple tail fins, and a protruding mass of necrotic cells on the opposite end of the embryo. C1a embryos have spinal cord tissue, often reduced in length and girth, but do not form more anterior neural structures. C2 embryos have spinal cord, hindbrain and midbrain, but do not have forebrain or eyes (e.g. Fig. 4E). C3 embryos have defects in forebrain and/or eye development but have an intact neural tube posterior to the forebrain. C4 embryos have a normal appearing neural tube but lack notochord. C5 ichabod embryos, which are very rare, appear to be normal at 24 hpf, but do not survive. ichabod embryos are usually C1,C1a and C2, but as the expressivity of the mutation is somewhat variable, some crosses also yield substantial numbers of C3 embryos and, more rarely, C4 and C5 embryos.
Wild-type embryos injected with MO2 show all of the ventralized phenotypes found in progeny of female ichabod homozygotes(Fig. 4D-F,H). A second MO,MO2-2, designed against a non-overlapping region of β-catenin-2,gave similar distributions of ventralized embryos, when injected into wild-type embryos, whereas a mismatched MO, MO-2mis, with five base pair differences, had no effect (Fig. 4G). Injection of MO2 into ichabod embryos resulted in a shift of distribution of phenotypes to the more severely ventralized classes(Fig. 4I), suggesting that someβ-catenin-2 function remains in ichabod embryos and that this function is further reduced by the MO. In contrast to the results obtained with β-catenin-2 MOs, no ventralizing effect was seen in embryos injected with MOs designed against β-catenin-1 (e.g. Fig. 4A-C), even at high concentrations that caused bent tails and head necrosis(Fig. 4C). These phenotypes caused by high concentrations of MO1 were not rescued by injection ofβ-catenin-1* mRNA (in which the 5′-UTR ofβ-catenin-1 RNA was altered so that it was no longer complementary to the sequence of MO1, see Materials and methods), indicating that they were probably not due to specific interactions of the MO withβ-catenin-1 mRNA (data not shown). Injection into wild-type embryos of one or another of two additional non-overlapping MOs (MO1-2, MO1-3), designed against the 5′ UTR of β-catenin-1, also failed to yield ventralized phenotypes.
Injection of morpholino antisense oligonucleotides (MOs) directed against the translational initiation site of β-catenin-2 can phenocopy the ichabod mutation, whereas MOs againstβ-catenin-1 have no ventralizing effect. (A-C) Effect of injection of MO1 into wild-type embryos. Injection of 1 mM MO1 often results in a slight necrosis in the head (B) and 3 mM MO1 causes more severe necrosis and bent shortened tails (C), but in neither case were the embryos ventralized. A wild-type embryo at the same stage is shown for comparison (A).(D-G) Effect of injection of MO2 into wild-type embryos. Examples of Class 2 (E) and Class 1 (F) embryos obtained by injecting wild-type embryos with 3 mM MO2 are compared with a wild-type embryo (D) and an embryo injected with 3 mM MO2mis (G). (H) The effects of injection of 3 mM MO2 can be rescued by co-injection of β-catenin-2*RNA (β-catenin-2 RNA with an altered ribosome binding region that will not bind to MO2). Injection of 3 mM MO2 alone yielded a distribution of ventralized phenotypes (red bars). Injection ofβ-catenin-2* RNA alone had no ventralizing effect(compare green and yellow bars). Co-injection of MO2 and the RNA yielded mostly wild-type-appearing embryos, with only a few embryos exhibiting weak ventralization (blue bars). In this experiment, we classified non-ventralized embryos into two classes, wild-type and C5, with C5 embryos exhibiting kinky notochords. (I) Injection of MO2 into ichabod embryos shifted the phenotypic distribution to more-severe ventralized classes.
Injection of morpholino antisense oligonucleotides (MOs) directed against the translational initiation site of β-catenin-2 can phenocopy the ichabod mutation, whereas MOs againstβ-catenin-1 have no ventralizing effect. (A-C) Effect of injection of MO1 into wild-type embryos. Injection of 1 mM MO1 often results in a slight necrosis in the head (B) and 3 mM MO1 causes more severe necrosis and bent shortened tails (C), but in neither case were the embryos ventralized. A wild-type embryo at the same stage is shown for comparison (A).(D-G) Effect of injection of MO2 into wild-type embryos. Examples of Class 2 (E) and Class 1 (F) embryos obtained by injecting wild-type embryos with 3 mM MO2 are compared with a wild-type embryo (D) and an embryo injected with 3 mM MO2mis (G). (H) The effects of injection of 3 mM MO2 can be rescued by co-injection of β-catenin-2*RNA (β-catenin-2 RNA with an altered ribosome binding region that will not bind to MO2). Injection of 3 mM MO2 alone yielded a distribution of ventralized phenotypes (red bars). Injection ofβ-catenin-2* RNA alone had no ventralizing effect(compare green and yellow bars). Co-injection of MO2 and the RNA yielded mostly wild-type-appearing embryos, with only a few embryos exhibiting weak ventralization (blue bars). In this experiment, we classified non-ventralized embryos into two classes, wild-type and C5, with C5 embryos exhibiting kinky notochords. (I) Injection of MO2 into ichabod embryos shifted the phenotypic distribution to more-severe ventralized classes.
To test whether the MO effects observed at 24 hpf were a consequence of the disruption of early signaling centers, we examined expression of the early dorsal markers, bozozok (boz) and squint(sqt), in wild-type embryos injected with specific and control MOs(Fig. 5). Both of these markers are absent from dorsal blastomeres of severely ventralized batches of ichabod embryos at sphere stage(Kelly et al., 2000). Injection of MO2, but not MO1, is effective in eliminating bozexpression from wild-type sphere stage embryos(Fig. 5B,C). MO2 also decreases sqt expression in these embryos, although some transcript is still produced, but MO1 has no effect on expression of this gene(Fig. 5F,G). Thus, reducing expression of maternal β-catenin-2, but notβ-catenin-1, in wild-type embryos eliminates or reduces the expression of very early markers of the dorsal organizer. Although injection of MO2 ventralizes wild-type embryos, it does not result in the majority of embryos showing the most severe phenotypes(Fig. 4H), and thus, the failure to obtain complete inhibition of expression of early dorsal markers(e.g. sqt) in MO2-injected embryos is not unexpected. boz,however, is extremely sensitive to levels of β-catenin-2 but is completely insensitive to inhibition of β-catenin-1 expression. These results strongly support a specific requirement for β-catenin-2 in the early dorsal signaling center.
β-catenin-2, but not β-catenin-1, is required for normal expression of the early dorsal markers bozozokand squint. Wild-type embryos were injected with 3 mM MO1 (B,E)or 3 mM MO2 (C,F) and compared with uninjected embryos (A,D) for bozozok (A-C) and squint (D-F) expression at 30% epiboly stage. bozozok expression is inhibited by MO2 and squint expression is partially inhibited by MO2; MO1 injection has no effect on expression of these two markers.
β-catenin-2, but not β-catenin-1, is required for normal expression of the early dorsal markers bozozokand squint. Wild-type embryos were injected with 3 mM MO1 (B,E)or 3 mM MO2 (C,F) and compared with uninjected embryos (A,D) for bozozok (A-C) and squint (D-F) expression at 30% epiboly stage. bozozok expression is inhibited by MO2 and squint expression is partially inhibited by MO2; MO1 injection has no effect on expression of these two markers.
In addition to obtaining similar phenotypes with multiple MOs and the use of mismatched MO controls, we performed a number of additional tests to show that the MOs specifically act on their target transcripts. MO1 and MO2 were each shown to specifically inhibit the translation of their cognate lacZ fusion targets when the RNA targets and MO were injected together into wild-type embryos (data not shown). More importantly, we were able to rescue the ventralizing effects of MO2 on wild-type embryos(Fig. 4H). For this experiment,the 5′-UTR of β-catenin-2 RNA was altered so that it was no longer complementary to the sequence of MO2 (see Materials and methods). Injection of this RNA (β-cat-2* RNA) into ichabod embryos was effective in rescuing these embryos (data not shown). When this RNA was co-injected with MO2 into wild-type embryos, we observed effective rescue of the ventralized phenotype obtained with MO2 alone in the very same batch of embryos (Fig. 4H). Injection of the β-cat-2* RNA,alone, did not alter the wild-type phenotype. Additional controls, to show that the MO1 and MO2 that were used in these experiments were effective in decreasing the level of expressed β-catenin proteins, will be described in the next section along with results indicating that there is a deficiency in the amount of β-catenin-2 protein in pre-gastrula ichabodembryos.
Expression of the two β-catenin proteins in wild-type and ichabod embryos
The two β-catenin zebrafish proteins are of identical size and are very highly conserved in sequence. Although it would be extremely useful to obtain antibodies that could distinguish the two β-catenins, we have thus far been unsuccessful in raising antibodies against the specific C-terminal peptides. However, we were able to employ an indirect immunological approach to identify the contribution of each of the β-catenins to total cellularβ-catenin protein in wild-type and ichabod embryos. To achieve this, we used a pan-β-catenin antibody on western blots to compare levels of β-catenin in embryos injected with specific MOs against eachβ-catenin transcript or with control mismatched MOs (see Fig. S1 in the supplementary material). By comparing the effects of the MO treatment, it is possible to determine the relative amounts of β-catenin derived from the two types of β-catenin RNA. In wild-type and ichabod embryos at 100% epiboly, MO2 or MO1 treatment each decreases the amount of β-catenin and a combination of MO1 and MO2 reduces the level of β-catenin even further. We conclude that at this developmental stage when most of theβ-catenin transcript is presumably zygotically derived, the twoβ-catenins are expressed in both types of embryos. At 30% epiboly, the MO treatments gave different results for wild-type and ichabod embryos. In wild-type embryos, the results of MO treatment at 30% and 100% epiboly are essentially the same. Treatment of ichabod embryos at 30% epiboly,however, shows that MO2 has no effect on β-catenin protein levels,whereas MO1 greatly reduced the protein and, importantly, no further reduction is observed when the two MOs are injected together. We conclude that ichabod embryos produce little or no β-catenin-2 protein from maternal transcripts, although maternal expression of β-catenin-1 is normal. These results reinforce the conclusion that the ichabodmutation causes a specific downregulation of maternal expression ofβ-catenin-2.
The two β-catenins function redundantly to repress neurectoderm
To test if β-catenin-1 and β-catenin-2 might have overlapping functions in early embryonic patterning, we analyzed the phenotype of embryos in which expression of both β-catenin genes is inhibited. We carried out these studies in two ways: first, by injecting MO1 into ichabod embryos; and second, by injecting MO1 and MO2 into wild-type embryos (Fig. 6). Both types of embryos exhibited a new phenotype, which we termed `ciuffo' (a tuft or quiff of hair, in Italian) because of the appearance of a protrusion of the embryo away from the yolk (Fig. 6B,D). Examination of expression of a series of mesodermal and neurectodermal markers revealed that instead of a ventralized phenotype that might have been expected if both β-catenins functioned redundantly to promote dorsalization, the `ciuffo' embryos were dorsalized and expressed all neurectodermal markers that were tested. To determine whether this dorsalizing and neuralizing effect of injection of MO1 into ichabod embryos was due to the specific inhibition of β-catenin-1 transcript, we performed an RNA rescue experiment (Fig. 6E-H). Typical severe ichabod embryos(Fig. 7E) were mostly converted into `ciuffo' embryos by injection of MO1(Fig. 6F), but reverted back to C1, C1a and C2 ventralized embryos when MO1 and β-catenin-1*RNA were co-injected (Fig. 6H). When just the RNA was injected, full and partial rescue of the ichabod phenotype was obtained(Fig. 6G), a result expected from our finding that injection of all β-catenin RNAs tested, including Xenopus β-catenin RNA (Kelly et al., 2000), can induce organizer and rescue ichabod.The main conclusion of this experiment, however, is that the `ciuffo'phenotype can be rescued, indicating that the phenotype is not a result of a non-specific effect of MO1 on a non-β-catenin transcript.
We tested for expression of emx1(Fig. 6L-N), krox20(Fig. 7I-K) and hoxb6b(Fig. 6O-Q) to determine if`ciuffo' embryos were able to express a wide range of anterior and posterior neurectodermal markers. Whereas emx1 and krox20 were not expressed in the severe ichabod embryos used for these experiments(Fig. 6J,M), they are expressed at localized regions of the protrusion in `ciuffo' embryos(Fig. 6K,N), which developed as a result of injection of MO1 into ichabod embryos of the same breeding. Most ichabod embryos also fail to express hoxb6b(Fig. 6P), although expression is observed by hybridization in a small number of 24 hpf embryos (not illustrated) and confirmed by RT-PCR (data not shown). This low level of expression is consistent with the finding that ichabod mutants do express earlier posterior neurectodermal markers(Kudoh et al., 2004). hoxb6b is expressed in all `ciuffo' embryos (e.g. Fig. 6Q) and RT-PCR indicates a much greater amount of this transcript is present than in ichabodembryos. Thus, even for the most posterior marker tested, the absence of expression of the two β-catenins resulted in an increase in transcript levels. Interestingly, the more posterior the marker, the further its expression site was from the yolk. This pattern, as well as the double ring of krox20 expression (found in some, but not all embryos stained for this marker), indicated that the `ciuffo' protrusion had some degree of appropriate anteroposterior patterning, although the morphology of the embryo was abnormal. We also tested for expression of the neuronal markers, islet1 (Fig. 6R-T), tlxA (Andermann and Weinberg,2001) (data not shown) and HuC (data not shown). None of these genes was expressed in severely mutant ichabod embryos (e.g. Fig. 6S), but each was expressed in the `ciuffo' embryos obtained after MO1 injection. Thus, the neurectoderm that is formed by reducing expression of the two β-catenins does generate neurons, although they are not organized in a recognizably patterned way. We also assayed the expression of a number of mesodermal markers. Notably, myoD, which is expressed in concentric rings at the posterior end of ichabod embryos(Fig. 6V), is also expressed in the `ciuffo' protrusion (Fig. 6Z). ntl, although expressed during gastrula stages in ichabod embryos (Kelly et al.,2000) and `ciuffo' embryos (data not shown) as a pan-mesodermal marker, is not expressed in `ciuffo' gastrulae in any notochord-like structure or at post-gastrula stages. We also found that `ciuffo' embryos fail to express sonic hedgehog, another notochord marker. Thus, loss of function of β-catenin-1 in embryos already deficient inβ-catenin-2 leads to a restoration of neurectoderm, but not notochord. It is noteworthy that none of these effects observed in `ciuffo'embryos occurs merely by inhibiting expression of β-catenin-1 in wild-type embryos, indicating a genetic redundancy of the two β-catenins in repression of neurectoderm.
A new phenotype (`ciuffo') results from loss of function of bothβ-catenin genes. (A-D) The `ciuffo' phenotype is apparent in ichabod embryos injected with 3 mM MO1 (B) and wild-type embryos injected with 3 mM MO1 and 3 mM MO2 (D). Uninjected ichabod (A) and wild-type (C) embryos are shown for comparison. (E-H) Co-injection ofβ-catenin-1* RNA (β-catenin-1RNA with an altered ribosome binding region that will not bind to MO1) into ichabod embryos can suppress the `ciuffo' phenotype produced by MO1 injection. In comparison with uninjected ichabod embryos, which develop to C1 phenotypes (E), injection of 1 mM MO1 transforms approximately two-thirds of the embryos into `ciuffo' phenotypes (F), injection of the RNA alone causes rescue to wild-type and less ventralized C2-C4 phenotypes (G),but co-injection of both MO1 and RNA results in embryos with the original severe C1 phenotype and with C1a phenotype (H). Each of these panels shows a group of representative embryos of one of four repeats of this experiment,which all gave consistent results. (I-Z) Hindbrain and anterior neural markers and neuronal markers are not expressed in ichabod embryos(J,M,S) but are expressed in 3 mM MO1-injected ichabod (`ciuffo')embryos (K,N,T). The posterior neural marker hox6b6 is expressed in some ichabod embryos (P) and in `ciuffo' embryos (Q). Wild-type embryos are shown as positive controls (I,L,O,R). The following probes were used: krox20 (I-K), emx1 (L-N), hoxb6b (O-Q) and islet1 (R-T). All three types of embryos express myoD (U-Z),although the expression is radialized in both ichabod (V) and`ciuffo' (Z) embryos compared with wild type (U). Embryos in A-H and L-N are at 24 hpf and those in I-K,O-V are at 22 hpf. For I-Z, probes are indicated in the lower left corner and type of embryo in the lower right corner of each panel.
A new phenotype (`ciuffo') results from loss of function of bothβ-catenin genes. (A-D) The `ciuffo' phenotype is apparent in ichabod embryos injected with 3 mM MO1 (B) and wild-type embryos injected with 3 mM MO1 and 3 mM MO2 (D). Uninjected ichabod (A) and wild-type (C) embryos are shown for comparison. (E-H) Co-injection ofβ-catenin-1* RNA (β-catenin-1RNA with an altered ribosome binding region that will not bind to MO1) into ichabod embryos can suppress the `ciuffo' phenotype produced by MO1 injection. In comparison with uninjected ichabod embryos, which develop to C1 phenotypes (E), injection of 1 mM MO1 transforms approximately two-thirds of the embryos into `ciuffo' phenotypes (F), injection of the RNA alone causes rescue to wild-type and less ventralized C2-C4 phenotypes (G),but co-injection of both MO1 and RNA results in embryos with the original severe C1 phenotype and with C1a phenotype (H). Each of these panels shows a group of representative embryos of one of four repeats of this experiment,which all gave consistent results. (I-Z) Hindbrain and anterior neural markers and neuronal markers are not expressed in ichabod embryos(J,M,S) but are expressed in 3 mM MO1-injected ichabod (`ciuffo')embryos (K,N,T). The posterior neural marker hox6b6 is expressed in some ichabod embryos (P) and in `ciuffo' embryos (Q). Wild-type embryos are shown as positive controls (I,L,O,R). The following probes were used: krox20 (I-K), emx1 (L-N), hoxb6b (O-Q) and islet1 (R-T). All three types of embryos express myoD (U-Z),although the expression is radialized in both ichabod (V) and`ciuffo' (Z) embryos compared with wild type (U). Embryos in A-H and L-N are at 24 hpf and those in I-K,O-V are at 22 hpf. For I-Z, probes are indicated in the lower left corner and type of embryo in the lower right corner of each panel.
β-Catenin-1 and β-catenin-2 function redundantly to repress expression of chordin and goosecoid
To better understand how loss of function of both β-catenin genes can give rise to a wide range of anterior and posterior neural markers, we examined the expression in `ciuffo' embryos of genes normally expressed in dorsal regions at gastrula and pregastrula stages(Fig. 7). At 30% epiboly, the prospective organizer expresses high levels of boz, sqt, goosecoid(gsc) and chordin (chd)(Fig. 5A,D; Fig. 7A,D,G,M), while ichabod embryos do not express boz, gsc and chd,and express sqt circumferentially around the germ ring without any sign of a dorsal expression domain (Fig. 7B,E,H,N) (Kelly et al.,2000). In `ciuffo' embryos produced by MO1 treatment of ichabod embryos, there is no indication of dorsal expression of any of these markers at 30% epiboly, with results identical to ichabodembryos for boz, sqt and chd, and a faint radial symmetric expression of gsc around the germ ring(Fig. 7C,F,I,O). At 50%epiboly, this germ ring expression of gsc becomes more intense and a similar expression of chd is now observed(Fig. 7J,R). By this stage, for all three types of embryos, boz expression disappeared and sqt expression was greatly decreased (data not shown). We also tested for expression of fgf3 and fgf8, and their patterns of expression in the three types of embryos were identical to sqt at these stages. We conclude that a defined organizer does not form in `ciuffo'embryos, as there is no expression of boz and no dorsal expression of sqt, chd, fgf3 and fgf8. Although radial germ ring expression was observed for sqt, fgf3 and fgf8 in `ciuffo'embryos, the pattern was unchanged qualitatively and quantitatively from that of ichabod embryos. The late onset of gsc and chdexpression around the germ ring, however, indicates that β-catenin-1 andβ-catenin-2 normally function redundantly to repress expression of these genes in this domain. None of the genes tested was ectopically expressed when wild-type embryos were treated with MO1 (data not shown). Thus, the ventrolateral ectopic expression of a subset of genes normally expressed only dorsally is observed only in the absence of the two β-catenins. Interestingly, ectopic chd expression has also been observed in embryos expressing a dominant-negative form of Tcf3, which would be expected to inhibit the function of both β-catenins(Pelegri and Maischein, 1998). The ectopic expression of chd in the germ ring ventrolateral domain would be expected to result in inhibition of BMP signaling, thus explaining the precocious expression of neural markers in `ciuffo' embryos.
β-Catenin-1 and β-catenin-2 function redundantly to repress expression of chordin and goosecoid, but not bozozok or squint. Wild-type(A,D,G,J,M,P), ichabod(B,E,H,K,N,Q) or MO1-injected ichabod (C,F,I,L,O,R)embryos were assayed for expression of boz (A-C), sqt (D-F), gsc (G-L) or chd (M-R) at 30% epiboly (A-I,M-O) or 50%epiboly (J-L,P-R). MO1-injected and non-injected ichabod embryos of the same embryo clutch were compared for each marker. All embryos are shown in animal pole views.
β-Catenin-1 and β-catenin-2 function redundantly to repress expression of chordin and goosecoid, but not bozozok or squint. Wild-type(A,D,G,J,M,P), ichabod(B,E,H,K,N,Q) or MO1-injected ichabod (C,F,I,L,O,R)embryos were assayed for expression of boz (A-C), sqt (D-F), gsc (G-L) or chd (M-R) at 30% epiboly (A-I,M-O) or 50%epiboly (J-L,P-R). MO1-injected and non-injected ichabod embryos of the same embryo clutch were compared for each marker. All embryos are shown in animal pole views.
DISCUSSION
ichabod embryos lack maternal expression ofβ-catenin-2
ichabod, a spontaneous maternal effect mutation affecting organizer formation was found to disrupt Wnt pathway signaling and lead to a failure to localize β-catenin in dorsal YSL and blastomere nuclei(Kelly et al., 2000). Our more recent discovery of a second β-catenin gene, β-catenin-2,led us to consider that the phenotypes of ichabod mutant embryos were a result of failure of proper regulation of this gene. ichabod was found to map close to the position of β-catenin-2 in the telomeric region of LG19. Very suggestive of a chromosome rearrangement in this region of the ichabod chromosome was the failure to observe any recombination between markers extending from LG19 map positions 91.5 to 95.4 cM. Still ongoing fluorescent hybridization studies with interphase nuclei clearly show a different order of markers in this region of the ichabod chromosome compared with wild-type chromosomes (S.M., M. Nimmakayalu, B. Emanuel and E.S.W., unpublished). RT-PCR and whole mount hybridization experiments presented above show that ichabod mutant embryos are defective in maternal, but not zygotic, expression ofβ-catenin-2. Treatment of ichabod embryos with MO2 results in a shift of phenotypes to more severely ventralized classes(Fig. 4I), suggesting that ichabod is a hypomorphic β-catenin-2 mutant, which is shifted towards a null phenotype by further depletion of the protein product. Moreover, evidence from western blots of MO2- and MO1-treated embryos also indicated that β-catenin-2 (but not β-catenin-1) protein levels are low in pre-gastrula ichabod embryos. As MO β-catenin-2loss-of-function phenotypes are clearly the same as the ventralized ichabod phenotypes, we suggest that the ichabod mutation is a regulatory mutation affecting the maternal expression ofβ-catenin-2.
Maternal expression of β-catenin-2 is required for organizer formation
The results presented here clearly show that both zebrafish β-catenin genes are expressed maternally and zygotically in wild-type embryos. Although mRNA from both genes is expressed ubiquitously, we have uncovered a specific role of β-catenin-2 in organizer formation and early dorsal signaling. Wild-type embryos treated with MO2, or embryos bred from homozygous ichabod mothers both show a decrease in β-catenin-2transcripts and protein (Fig. 3, Fig. 6), fail to express markers of the organizer and anterior neurectoderm(Fig. 5, Fig. 7J,M), and exhibit similar ventralized phenotypes (Fig. 6). MOs directed against β-catenin-1 have no ventralizing effects on wild-type embryos and do not enhance the ventralization of ichabod embryos.
The specific requirement for β-catenin-2 for organizer formation was unexpected. Both β-catenin transcripts are expressed ubiquitously at stages prior to and during organizer formation. Moreover, our experiments revealed that both proteins were expressed from maternal transcripts in wild-type embryos. However, as we have not yet had success in raising antibodies that can specifically recognize each of the two proteins, we were not able to determine whether both proteins are present in the dorsal region of the embryo where β-catenin acts to establish DV asymmetry. At least three formal possibilities exist to explain the requirement forβ-catenin-2. First, the level of β-catenin-1 protein in dorsal territories may not be sufficient to compensate functionally for the loss ofβ-catenin-2. Second, the protein itself may be under post-translational control resulting in rapid inactivation of β-catenin-1 on the dorsal side of the embryo. Third, the β-catenin 1 and 2 proteins might have different activities (e.g. different transactivation domains or different requirements for co-factors), such that endogenous levels ofβ-catenin-1 are not able to activate early dorsal gene expression even though it can do so when overexpressed. A model in which β-catenin-2 promotes organizer formation by sequestering components that otherwise would facilitate degradation of β-catenin-1 is unlikely because MO1 depletion of β-catenin-1 in wild-type embryos does not ventralize and, in ichabod embryos, fails to increase the severity of ventralization. Most of the differences between the two β-catenins are found in the C-terminal 92 amino acids, corresponding to the major region of a transactivation domain known to interact with CBP and p300(Hecht et al., 2000; Takemaru and Moon, 2000). This region also can interact with the armadillo repeat region of the protein(Cox et al., 1999; Piedra et al., 2001) and has been implicated in regulating selective binding to cadherin or Tcf proteins(Gottardi and Gumbiner, 2004). However, to explain the lack of sufficiency of β-catenin-1 for organizer formation, such differences between the two β-catenins would also have to explain why both β-catenins appear to be absent in dorsal nuclei of ichabod embryos (Kelly et al.,2000).
We performed two types of experiments to judge if there were indeed functional differences between the two β-catenins in the context of organizer formation. First, we determined if expression of eitherβ-catenin from injected RNA was more efficient in rescuing ichabod embryos. The results showed that the two β-catenin RNAs were equally efficient in rescue, with a precipitous decline in the ability to rescue when the concentration of injected RNA for each of the twoβ-catenins was reduced from 10 ng/μl to 5 ng/μl. We also carried out an experiment in which tagged forms of each β-catenin were expressed from RNAs co-injected into ichabod embryos, and the subcellular and embryonic localization of the two proteins were then determined at the 500-cell stage using antibodies against the tagged epitopes(GFP-β-catenin-1 and myc-β-catenin-2) (data not shown). Our initial results showed that β-catenin-2 had a nuclear localization in a small group of marginal cells on one side of the embryo. However, taggedβ-catenin-1 protein was also found in the very same nuclei, offering no support for a difference in subcellular distribution between the twoβ-catenins as the basis for the requirement for β-catenin-2 for organizer formation. As each of the β-catenins is capable of localizing in blastoderm marginal nuclei, it is not surprising that rescue of ichabod embryos is achieved by injection of either β-catenin,but we still do not know the basis of the specific requirement for endogenousβ-catenin-2 for organizer formation.
Zebrafish β-catenins redundantly inhibit neurectoderm
In contrast to formation of the dorsal axial structures, loss of function of one or the other of the two zebrafish β-catenins does not appear to affect the role of the Wnt pathway in posteriorization and ventralization of neurectoderm and mesoderm (Lekven et al.,2001; Erter et al.,2001; Momoi et al.,2003; Ramel and Lekven,2004). We found that reduction of β-catenin-2expression alone results in ventralization, not dorsalization, and reduction of β-catenin-1 expression alone has no effect on dorsoventral or anteroposterior patterning. However, when expression of both β-catenins is inhibited, we found a robust formation of neurectodermal tissue in comparison with wild-type embryos treated with MO2 or with ichabodembryos, which only occasionally express posterior neural markers in their tail-like appendage. Although the neurectoderm formed when bothβ-catenins are inhibited is not organized into a normal neural tube, a substantial amount of tissue expressing both anterior and posterior neurectodermal markers is incorporated into a large protrusion extending out from the yolk (e.g. Fig. 7K,N,Q). The neurectoderm of these `ciuffo' embryos is able to form neurons (Fig. 7T) and appears to express neural markers in correct anteroposterior order. In the absence of organizer and β-catenin-2 expression,β-catenin-1 expression alone is able to repress the expression of all neural markers tested. When β-catenin-2 expression is unperturbed, inhibition of β-catenin-1 does not lead to an expansion of neural tissue or patterning defects. Thus, only when expression of both β-catenin genes is inhibited do we find a de-repression of neural markers.
It is very likely that this activation of neural marker expression is due to an impairment of Wnt pathway signaling normally involved in posteriorization and ventralization. A posteriorizing activity of zebrafish ventrolateral germring tissue has been demonstrated by transplantation studies(Woo and Fraser, 1997), and wnt8, which is expressed in this region of the embryo(Kelly et al., 1995b), is required for formation of ventrolateral and posterior mesoderm and spinal cord and posterior brain (Lekven et al.,2001; Erter et al.,2001; Momoi et al.,2003; Ramel and Lekven,2004). The posteriorizing effect of zebrafish Wnt signaling, at least in part, functions by negating the repression of posterior neural factors by Tcf3a (Kim et al.,2000; Dorsky et al.,2003). Other important targets of ventroposteriorizing Wnt signals include the vox/vent/ved, related homeodomain transcriptional repressors that restrict dorsal gene expression to the proper territories, and cdx4, which regulates the action of posterior Hox genes(Kawahara et al., 2000a; Kawahara et al., 2000b; Imai et al., 2001; Ramel and Lekven, 2004; Shimizu et al., 2005).
In zebrafish embryos lacking expression of both β-catenins, we hypothesize that the dorsolateral Wnt8 signals that normally posteriorize the neurectoderm are not transduced. Indeed, we find that ichabod embryos treated with MOs targeted against both translated forms of wnt8(Lekven et al., 2001) develop the `ciuffo' phenotype and, moreover, such embryos, as well as wild-type embryos injected with both MOs, express large amounts of chordintranscript around the germ ring (M.V., S.M. and E.S.W., unpublished)(Ramel and Lekven, 2004). Our finding that MO1 treatment of ichabod embryos also results in germ ring chordin expression (Fig. 7R) suggests that chordin repression by Wnt8 and vox/vent/ved is mediated by both β-catenin-1 and -2 (M.V., S.M. and E.S.W., unpublished). A true dorsal signaling center is not established in these embryos as boz fails to be expressed, and otherwise dorsal markers are expressed later than they normally would be, consistent with a response to the later Wnt8 signaling. Although some ichabod embryos express hoxb6b in their tail extension [an observation consistent with expression of earlier posterior neural markers in ichabodembryos (Kudoh et al., 2004)],the amount of transcript of this factor is also markedly increased in MO1-treated ichabod embryos. Thus, not only do the twoβ-catenins act to posteriorize and ventralize the embryo, but they also act to repress formation of neurectoderm. In a normal embryo, such repression may act to restrict the amount of organizer-induced neurectoderm formation.
Neurectoderm patterning in the absence of an organizer
The studies presented above add to an array of evidence indicating that AP patterning of the neurectoderm can occur in embryos lacking organizer tissue. Ectoderm of embryos lacking expression of both β-catenins forms neurectoderm that expresses posterior, hindbrain and forebrain markers in apparently correct AP order. Wnt/β-catenin signaling is thus not required in the early embryo for either neural induction or for at least some degree of proper AP patterning. A similar conclusion has recently been reached by simultaneous elimination of the Spemann organizer and BMP signaling in Xenopus (Reversade et al.,2005). In this case, BMP signaling was eliminated by MO treatment against three different BMP ligands. In the zebrafish, as shown above, the depletion of the two β-catenins results in ectopic expression of chordin, which would in effect reduce or eliminate BMP signaling in the absence of organizer. A significant difference between the two organisms is that elimination of the single β-catenin in Xenopus does not result in chordin expression(Reversade et al., 2005), and totally eliminates neural induction(Heasman et al., 1994; Heasman et al., 2000), whereas in zebrafish both β-catenins appear to be required to prevent chordin expression in ventrolateral regions of the germ ring. In both organisms, however, it is now clear that extensive neurectoderm can be formed with a degree of proper AP pattern in the absence of β-catenin and organizer. Further study of this condition may provide insight into factors that could underlie the anteroposterior pattern of the neurectoderm in the absence of both Wnt/β-catenin and BMP signaling.
Supplementary material
Acknowledgements
We thank Joshua Bradner, Jiangyan He, Richard Gill, Jr and Carol Hu for fish care and general laboratory assistance. We gratefully acknowledge Lucía Peixoto for help with the phylogenetic analysis. This work was supported by NIH grants HD39272 (to E.S.W.) and RR12349 (to W.S.T.).