A key event in patterning the developing Drosophila compound eye is the progressive restriction of the transcription factor Atonal in the morphogenetic furrow. The Atonal pattern evolves from expression in all cells to an over-dispersed pattern of single founder cells (the future R8 photoreceptors). This restriction involves Notch-mediated lateral inhibition. However, there have been inconsistent data on a similar proposed role for the Egf receptor (Egfr). Experiments using a conditional Egfr mutation(Egfrtsla) suggested that Egfr does not regulate Atonal restriction, whereas experiments using Egfr-null mosaic Minute+ clones suggested that it does. Here, we have re-examined both approaches. We report that the lesion in Egfrtslais a serine to phenylalanine change in a conserved extracellular ligand-binding domain. We show by biochemical and genetic approaches that the Egfrtsla protein is rapidly and completely inactivated upon shift to the non-permissive temperature. We also find that on temperature shift the protein moves from the cell surface into the cell. Finally, we report a flaw in the Egfr-null mosaic Minute+ clone approach. Thus, we demonstrate that Egfr does not play a role in the initial specification or spacing of ommatidial founder cells.

The Drosophila Epidermal growth factor receptor homolog (Egfr) is similar to vertebrate ERBB1 and to Let-23 in C. elegans, and is a type 1 transmembrane protein with intrinsic tyrosine kinase activity(Bogdan and Klambt, 2001; Shilo, 2003). In the developing fly eye, the major positive ligand is Spitz(Freeman, 2002). Like vertebrate EGFR, upon ligand binding the fly protein dimerizes, is activated and trans-autophosphorylates. Inside the cell, the signal is propagated via Ras and a kinase cascade with the final step being the fly homolog of P42/44 mitogen activated protein kinase (MAPK): Rolled(Marshall, 1994; Freeman, 2002; Shilo, 2003). Activated MAPK(pMAPK) translocates to the nucleus, where it can modulate the activities of transcription factors such as Pointed and Anterior open (Yan) in the fly eye(Brunner et al., 1994; O'Neill et al., 1994; Treisman, 1996; Freeman, 2002; Voas and Rebay, 2004).

Patterning in the Drosophila eye imaginal disc begins in the third larval instar when the morphogenetic furrow begins to move from posterior to anterior (Ready et al., 1976). This furrow produces the spaced array of ommatidia, with a new column made roughly every two hours (Ready et al.,1976; Basler and Hafen,1989). The first photoreceptor cell to be specified and to differentiate is R8 (Ready et al.,1976; Tomlinson and Ready,1987). R8 later induces the remaining cells of the facet and is thus also known as the ommatidial founder cell(Tomlinson, 1988; Freeman, 1997).

Coincident with the process of R8/founder cell specification is the expression of the proneural basic helix-loop-helix transcription factor Atonal; in atonal loss-of-function mutants, R8 cells do not form(Jarman et al., 1993; Jarman et al., 1994; Jarman et al., 1995). The level of Atonal first rises in all cell nuclei, then, deep in the furrow, it is then lost from some cells to leave spaced groups (the `intermediate groups'). Finally, Atonal is restricted to the single founder cells, where it persists for a few columns (Baker et al.,1996; Dokucu et al.,1996). R8/founder cell specification and spacing involves the Notch and Hedgehog pathways, through the regulation of atonaltranscription (Cagan and Ready,1989; Baker and Zitron,1995; Baker et al.,1996; Dominguez,1999; Suzuki and Saigo,2000; White and Jarman,2000; Baonza and Freeman,2001; Baker,2004).

In the developing eye, Egfr signaling is required for late R8 cell maintenance, the induction of all cells following the R8/founder cell,proliferation, ommatidial rotation and cell survival(Freeman, 1994; Tio et al., 1994; Freeman, 1996; Freeman, 1997; Tio and Moses, 1997; Dominguez et al., 1998; Kumar et al., 1998; Kurada and White, 1998; Halfar et al., 2001; Brown and Freeman, 2003; Firth and Baker, 2003; Kumar et al., 2003; Strutt and Strutt, 2003; Yang and Baker, 2003). It has also been suggested that Egfr signaling has a primary function in the initial specification and spacing of the Atonal-positive intermediate groups and/or the R8/founder cells based on four observations: pMAPK is strongly expressed in the intermediate groups; the gain-of function mutation EgfrElp has reduced numbers of R8 cells; Ras pathway signals promote the expression of the Rough transcription factor in the cells that do not become R8s; and Ras pathway loss-of-function mosaic clones show reduced precision in the array of R8 cells(Baker and Rubin, 1989; Zak and Shilo, 1992; Dokucu et al., 1996; Kumar et al., 1998; Spencer et al., 1998; Baonza et al., 2001; Yang and Baker, 2001; Yang and Baker, 2003). Of these the most direct and elegant evidence is the last (Ras pathway loss-of-function mosaic clones).

Egfr null clones are very small because of an early proliferation defect (Xu and Rubin, 1993). Thus, we generated a conditional Egfr loss-of-function mutation(Egfrtsla, a temperature-sensitive allele) and used it to remove Egfr function at specific times, by-passing the proliferation defect. We found that while this abolishes pMAPK in the intermediate groups,it does not affect the establishment or spacing of the Atonal-positive R8/founder cells (Kumar et al.,1998). We also observed that the high-level pMAPK antigen in the intermediate groups is predominantly cytoplasmic and proposed that there is a block to pMAPK nuclear translocation (`MAPK cytoplasmic hold')(Kumar et al., 1998; Kumar et al., 2003).

A second approach to overcome the proliferation defect was to use the Minute technique to give Egfr null cells a growth advantage(Baonza et al., 2001; Yang and Baker, 2001). In these clones, the single Atonal-positive cells are irregularly arranged rather than accurately spaced. This observation was made independently by two groups and led to the conclusion that Egfr signaling has a primary role in ommatidial spacing (Baonza et al., 2001; Yang and Baker, 2001).

How may these two views be reconciled? If Egfr signals do not regulate R8 spacing, then the pMAPK pattern may be explained by cytoplasmic hold, the EgfrElp phenotype may be an indirect consequence of a gain-of-function mutation, and the regulation of Rough expression in the non-R8 cells could be through a direct Egfr function in these cells, not due to any Egfr function in the R8s [indeed, a rough null has normal early ommatidial development(Tomlinson et al., 1988)]. However, if Egfr signals do regulate R8 cell spacing then the pMAPK pattern may be explained by a direct function, the EgfrElpphenotype may be due to over-inhibition of R8 cell formation and Rough expression in the non-R8 cells may be a direct result of Egfr signaling.

The two apparently direct loss-of-function experiments give different results: Egfrtsla temperature shift versus Egfr-null Minute mosaics. We have now re-examined these two experiments and have tested them for four possible flaws. (1) The Egfrtsla protein could be temperature-sensitive only during synthesis, so that after temperature shift the previously synthesized protein remains active and provides sufficient function for normal R8 patterning (a form of perdurance). (2) The Egfrtsla mutation might not be null at the restrictive temperature, and residual function could support normal R8 patterning. (3) At the time of the temperature shift, the furrow in Egfrtsla eyes might arrest, freezing the Atonal pattern so that it appears to be wild type. (4) Minute+ clones may have non-cell autonomous effects on Atonal patterning.

Here, we report the characterization of Egfrtsla,including its mutant lesion, the effects of temperature on its activity and stability, and the relocalization of the protein from the cell surface into the cell. We show by biochemical and genetic means that Egfrtsla is temperature-sensitive for activity and that it is functionally null at the restrictive temperature. We also report that, indeed, the Minutetechnique artifactually disturbs ommatidial spacing in the Egfr null mosaic experiments. We conclude that Egfr signaling does not normally function in the initial spacing of the R8/founder cells.

Drosophila stocks and mosaic analysis

Genomic DNA

Egfrtsla/Df(2R)Egfr5 and cn bw.

Egfrtsla Minute+ clones

y1 w1118 ey:FLP;P{ry+=neoFRT}42D P{w+mc=Ubi:GFP.nls}2R1P{Ubi:GFP.nls}2R2/P{ry+=neoFRT}42D Egfrtsla.

Egfrf2 Minute+ clones

y1 w1118 ey:FLP;P{ry+=neoFRT}42D P{w+mc=Ubi:GFP.nls}2R1P{Ubi:GFP.nls}2R2/P{ry+=neoFRT}42D Egfrf2.

Egfrf2 M(2)53 clones

P{ry+t7.2=hsFLP}1 w1118;P{ry+=neoFRT}42D Egfrf2/P{ry+t7.2= neoFRT}42D P{w+mC=arm-lacZ.V}51D M(2)53.

Egfrtsla M(2)53 clones

P{ry+t7.2=hsFLP}1 w1118;P{ry+=neoFRT}42D Egfrtsla/P{ry+t7.2= neoFRT}42D P{w+mC=arm-lacZ.V}51D M(2)53.

Egfrtop-18A M(2)56i clones

P{ry+t7.2=hsFLP}1 w1118;P{ry+=neoFRT}42D Egfrtop-18A/P{ry+t7.2= neoFRT}42D P{w+mC=arm-lacZ.V}51D M(2)56i.

Egfrtsla M(2)56i clones

P{ry+t7.2=hsFLP}1 w1118;P{ry+=neoFRT}42D Egfrtsla/P{ry+t7.2= neoFRT}42D P{w+mC=arm-lacZ.V}51D M(2)56i.

Wild-type M(2)53 clones

P{ry+t7.2=hsFLP}1 w1118;P{ry+=neoFRT}42D/P{ry+t7.2 =neoFRT}42D P{w+mC=arm-lacZ.V}51D M(2)53.

Sequencing of Egfrtsla DNA

PCR primer pairs were as follows.

Exon 1, type I: forward primer (fp), ATAGCTTGGAAGAGGGCTTGATTC; reverse primer (rp), TGGGCAGCCAGTCAGTCAGCCAGA.

Exon 1, type II: fp, TTGACTAGGCACCACAACGCCACC; rp,CAATATTTATGTGCCACATTTCAG;

Exon 2: fp1, GGGTCAACCGAAACAACAAAACCCATT; fp2, TGCATCGCCACTAAATCTCGG; rp1,GTACAGGGTATTAGGTCTAGTCCA; rp2, CTTGGGAAATACCACTTTCTT.

Exon 3: fp1, CTACAAATCATTCGCGGACGC; fp2, CCCAAGTGCCACGAGAGCTGC; fp3,CCGCCCATGCGCAAGTACAAT; fp4, GTCCTGCATGCCGGCAACATT; fp5,GGAACCCACCCGCAGTCCCGGAAT; fp6, TGGCCGGCCATTCAGAAGGAG; rp1,GCACTGATCCGAGCAAATGGT; rp2, TCTATTATGCTGGATGACCAC; rp3, GATCTCCTTCACCGTGGAGAA;rp4, GGGGCACGGTCCATTGCAGGG; rp5, CTCCTTGCATACGCCCTCGTC; rp6,ACACTCGCGCTCCGGAGCAGT.

Exon 4: fp1, GAGAAAAATGGAACCATTTGCTCG; fp2, GCACTGATCCGAGCAAATGGT.

Exon 5: fp1, GTCTGCCGAGAGTGCCACGCC; fp2, GAACAGGTGTGCTCCAAGTGC; fp3,GCCATTGGACCCTACTGTGCA; fp4, GCCAATCTATGCAAGTTGCGC; fp5, GTGCGAAATAACCGGGACAAG;fp6, GCACTGGAGTGCATTCGCAAT; fp7, TGGCACTTGGATGCCGCCATG; fp8,ACCGACTGCACGGATGAGATA; fp9, AATATGGCAGCTGTGGGCGTG; rp1,GACTCCCATCACCGGTATCCCGAT; rp2, CACGCCCACTTCCCGGGCACT; rp3,AATGGCCAGATAGCGACCCGG; rp4, CACACCAAAGGCCCAGACATC; rp5, ACCCTCCGGCACCCAAACGCC;rp6, CACCAGAACAGCACCAGTGATGTGATCGGCCGGACACTCGGT.

Sequencing was done at the University of Iowa facility.

Antibodies and histochemistry

Two rabbits were injected with an Egfr C-terminal peptide[(C)QRELQPLHRNRNTETR] (Lesokhin et al.,1999), coupled to keyhole limpet hemocyanin. Sera were affinity purified (by Zymed). For imaging, S2 cells were cultured on cover slips after transfection and prepared as previously described(Lee et al., 2001). Eye discs(except those used for the anti-Egfr stains) were prepared as previously described (Tomlinson and Ready,1987), modified as described by Tio and Moses(Tio and Moses, 1997), mounted in Vectashield (Vector Labs, H-1000) and imaged by confocal microscopy. For Egfr staining, the fix was 4% paraformaldehyde in PBS for 30 minutes at room temperature; eye discs were then washed and blocked as above, then incubated with primary antibody overnight at room temperature(Moberg et al., 2004). Primary antibodies: rabbit anti-Egfr [1:3000 for blots, gift of N. Baker(Lesokhin et al., 1999)],rabbit anti-Egfr (1:100 for immunoprecipitation, 1:500 for immunohistochemistry), rat anti-Spitz [1:20(Schweitzer et al., 1995)],mouse anti pTyr (PY20, 1:500, Santa Cruz Biotechnology SC-508), mouse anti-pMAPK [1:5000 for blots, 1:500 for immunohistochemistry, Sigma M-8159(Gabay et al., 1997)], rabbit anti-MAPK (anti-ERK, 1:1000, Cell Signaling Technologies 9102), rabbit anti-Ato [1:1000 (Jarman et al.,1993)], rat anti-Elav [1:500, 7E8A10 from DSHB(O'Neill et al., 1994)],guinea-pig anti-Senseless [1:1000, gift of G. Mardon(Nolo et al., 2000)], mouse anti-β-gal (1:1000, Promega 23783), guinea-pig anti-Hrs [1:100, gift from Ursula Weber (Lloyd et al.,2002)], mouse anti-Armadillo [1:10, DSHB N2 7A1(Riggleman et al., 1990)]. Secondary antibodies were mainly from Jackson ImmunoResearch: goat anti-mouse Cy5 (1:500, 115-175-003), goat anti-rabbit TRITC (1:250, 111-025-003), goat anti-rat Cy5 (1:200, 112-175-003), goat anti-mouse HRP (1:40, 115-035-003),goat anti-guinea pig TRITC, (1:150, 106-025-003). Goat anti-rabbit-HRP(1:8,000, 65-6120) was from Zymed. Syto-24 was used to stain DNA (1:10,000,Molecular Probes S-7559).

Tissue culture

The Egfr+ plasmid pMtEgfrType I was a gift of N. Baker(Lesokhin et al., 1999). The Egfrtsla plasmid pMtEgfrtslaType I was derived from pMtEgfrType I using a Stratagene `QuickChange' Site-Directed Mutagenesis Kit. The secreted Spitz plasmid is pMTsSpitz, a gift of B.-Z. Shilo(Schweitzer et al., 1995). Schneider line 2 (S2) cells were maintained in Drosophila Schneider's medium (Invitrogen 11720-034) with 10% heat-inactivated Fetal Bovine Serum at 25°C. Transfections were performed with Cellfectin (Invitrogen 10362-010)in serum-free medium for 4 hours 25°C. DNA concentrations used for transfections were: 2-3 μg/ml for wild-type and mutant Egfrplasmids, or 12 μg/ml for pMtsSpitz. Egfr transfections were incubated at 18°C for 15-16 hours in serum + medium, then for 24 hours in serum-free medium with 100 μM CuSO4. Fresh medium containing 10μg/ml cycloheximide (CHX) was added and the cells were then treated as described in the text. We tested cycloheximide between 0 and 100 μg/ml, as assayed by 35S-methionine incorporation (data not shown). Spitz transfections were incubated at 25°C, following the same protocol except for the use of 0.7 mM CuSO4. Spitz supernatants were validated by immunoblot (data not shown). Cells were lysed with RIPA buffer as described previously(Schweitzer et al., 1995). Gel blots were performed by standard protocols (BioRad). Immunoprecipitation was performed as previously described(Schweitzer et al., 1995).

For surface biotinylation, the transfections and temperature shifts were as above, the cells were then incubated with 0.5 mg/ml EZ-Link™sulfo-NHS-Biotin (Pierce, 21217) at 4°C for 30 minutes and the extract was precipitated with streptavidin beads (Pierce 2349) as described previously(Salazar and Gonzalez, 2002). Quantification was by the following steps. (1) Densitometry from non-saturated films to measure total band intensities (integrated over a standard area) for Egfr antigen from the untransfected control cells and from those transfected for Egfr+ and Egfrtsla, and for pMAPK.(2) Track background (measured below each band) was subtracted from each total band density. (3) The untransfected control value was subtracted from each experimental transfection (Egfr+ and Egfrtsla). (4) The pMAPK value was divided by the Egfr antigen value (for each track) to give the activity per receptor. (5) Values were standardized to make the activity of Egfr+ at 30°C 100;all other values are percentages of wild type. (6) Three replicates were used for the mean and the standard error of the mean.

Egfrtsla lesion

We sequenced Egfrtsla and found a single coding change relative to the parent chromosome: the transition C1,754T [using the numbering system of Clifford and Schüpbach(Clifford and Schüpbach,1994)] produces a missense S511F mutation (in the type I isoform). The change lies in the extracellular, conserved L2 domain, which is a leucine-rich repeat that functions in ligand binding(Clifford and Schüpbach,1994; Burgess et al.,2003). S511 is not conserved in either vertebrate or nematode Egfr homologs, but lies in a variable region that functions in ligand specificity(Clifford and Schüpbach,1994; Burgess et al.,2003). Three other temperature-sensitive alleles of Egfrhave been reported, although, unlike Egfrtsla, none have strong phenotypes at the restrictive temperature. Two of these lesions lie in the intracellular kinase domain, and one (EgfrSH2) lies in the L1 domain [L206Q in the type I isoform(Clifford and Schüpbach,1994)].

Egfrtsla protein is thermo-labile for activity

To determine if the Egfrtsla protein is temperature sensitive only during its synthesis or for its activity, we developed a tissue culture assay system using Drosophila Schneider line 2 cells (S2 cells)[Fig. 1A, assay adapted from Schweitzer et al. and Lesokhin et al.(Schweitzer et al., 1995; Lesokhin et al., 1999)]. These cells express low levels of endogenous Egfr, so all of the experiments were done in parallel with untransfected controls. We transfected cells to express additional Egfr+ or Egfrtsla at 18°C (the permissive temperature). One day later, we shifted the cells to 30°C and added cycloheximide to inhibit new protein synthesis. One hour later, we added conditioned media containing Spitz and harvested the cells at different time points. The levels of Egfr+ antigen remained fairly constant after 60 minutes with cycloheximide, suggesting that the wild-type protein has a much longer half-life than one hour under these conditions;Egfrtsla antigen was also detectable, although less so than wild type (Fig. 1B). In this assay,Egfr+ drives a ligand-dependent, high level of pMAPK within 5 minutes (asterisk in Fig. 1C),whereas Egfrtsla does not.

As a second test for receptor activity we measured autophosphorylation. Again, we transfected S2 cells at 18°C for Egfr+ or Egfrtsla expression. The cells were grown at either 18°C or 30°C for one hour and then treated with ligand(Fig. 1D). We assayed anti-Egfr immunoprecipitates for phospho-Tyrosine(Fig. 1E,F). We detected phosphorylated Egfr for both Egfr+ and Egfrtsla at 18°C, but only for Egfr+ at 30°C (white asterisks). Egfr antigen was detected under all conditions(Fig. 1G,H); however, we detected reduced levels of Egfrtsla at 30°C, perhaps through instability (see below).

We previously reported that Egfrtsla mutants loose pathway activity within 30 minutes at 29°C in vivo(Kumar et al., 1998). We therefore determined whether Egfrtsla becomes inactive in this system in a similar time frame after temperature shift. S2 cells were treated as described above, shifted to 30°C (for 0, 15, 30 or 60 minutes, Fig. 2A) and then treated with ligand. We detected reduced levels of Egfrtsla antigen after the temperature shift. We always detected robust levels of MAPK phosphorylation driven by both Egfr+ and Egfrtsla at 18°C. However,Egfrtsla lost this activity within 15 minutes at 30°C in all experiments (Fig. 2B-D).

Fig. 1.

Time course of Spitz induction of Egfr signaling in S2 cells. (A) Protocol used in B,C, see text. (B) Blot probed for Egfr. Second, non-specific band(asterisk) serves as a loading control. The DNA used and the times after Spitz induction are indicated above. (C) Blot for pMAPK shows pathway activation(same gel as is shown in B); asterisk indicates the level of pMAPK activation after 5 minutes. Note, the pMAPK intensity at 0 minutes (no time with Spitz induction) is indistinguishable from that of the untransfected controls. Also note, there is no detectable pMAPK (above controls) in the Egfrtsla transfections, whereas there is detectable Egfr antigen. (D) Protocol used in E-H, see text. Lysates were prepared by immunoprecipitation using anti-Egfr. (E,F) Blot probed for phospho-Tyrosine(`pTyr'). Note that, at 18°C (E), the anti-Egfr precipitable pTyr signal is detectable over control (black asterisk) for the Egfr+and Egfrtsla transfections (white asterisks), whereas at 30°C (F), Egfr+ yields detectable anti-Egfr precipitable pTyr signal (white asterisk), but Egfrtsladoes not (black asterisk). (G,H) The same gels as in E,F, re-probed for Egfr antigen.

Fig. 1.

Time course of Spitz induction of Egfr signaling in S2 cells. (A) Protocol used in B,C, see text. (B) Blot probed for Egfr. Second, non-specific band(asterisk) serves as a loading control. The DNA used and the times after Spitz induction are indicated above. (C) Blot for pMAPK shows pathway activation(same gel as is shown in B); asterisk indicates the level of pMAPK activation after 5 minutes. Note, the pMAPK intensity at 0 minutes (no time with Spitz induction) is indistinguishable from that of the untransfected controls. Also note, there is no detectable pMAPK (above controls) in the Egfrtsla transfections, whereas there is detectable Egfr antigen. (D) Protocol used in E-H, see text. Lysates were prepared by immunoprecipitation using anti-Egfr. (E,F) Blot probed for phospho-Tyrosine(`pTyr'). Note that, at 18°C (E), the anti-Egfr precipitable pTyr signal is detectable over control (black asterisk) for the Egfr+and Egfrtsla transfections (white asterisks), whereas at 30°C (F), Egfr+ yields detectable anti-Egfr precipitable pTyr signal (white asterisk), but Egfrtsladoes not (black asterisk). (G,H) The same gels as in E,F, re-probed for Egfr antigen.

From these experiments, we conclude that Egfrtsla protein is wild type at 18°C for ligand-dependent signaling activity. However, at 30°C, Egfrtsla becomes inactive within 15 minutes. Furthermore,this is due to the temperature sensitivity of the protein after synthesis and this effect is rapid.

Egfrtsla activity at the restrictive temperature is not detectably different to zero

We quantified the experiments in Fig. 2, at the 0- and 60-minute time points. Each condition was repeated in triplicate and two such experiments were quantified per receptor at 30°C (see Materials and methods and Fig. 3). From the two experiments, we conclude that the activity of Egfrtsla is wild type at 18°C but that at 30°C its activity is very low, and is indistinguishable from no activity at all.

Furthermore, we directly visualized the activity of Egfr in individual cells by immunofluorescence (Fig. 4). We examined cells at the 60-minute time point, as above(Fig. 2A). Untransfected cells show low background levels of Egfr antigen(Fig. 4A,D) and a low level of pMAPK antigen (Fig. 4B,D). Transfected cells express elevated levels of Egfr antigen(Fig. 4E-P). Cells that express additional Egfr+ at 30°C (white arrowheads in Fig. 4E-H) and 18°C (not shown), and Egfrtsla at 18°C(Fig. 4I-L), drive increased levels of nuclear pMAPK antigen (arrows in Fig. 4F,H,J,L), but cells expressing Egfrtsla at 30°C do not(Fig. 4N,P).

Fig. 2.

Egfrtsla is rapidly made inactive by a shift to 30°C. (A)Diagram of the protocol, see text. (B) Blot probed for Egfr. The DNA used and the time incubated at 30°C are indicated. (C) Blot probed for pMAPK shows pathway activation (same gel as is shown in B). Note, pMAPK levels appear constant over 60 minutes at 30°C for wild-type Egfr. However, for Egfrtsla, although pMAPK is detected at 18°C, after the shift to 30°C, the level falls rapidly down to background levels. Asterisks in B and C indicate examples of the 60-minute time-point bands used in the quantification shown in Fig. 3. (D) Same blot as in C, re-probed for total MAPK (loading control).

Fig. 2.

Egfrtsla is rapidly made inactive by a shift to 30°C. (A)Diagram of the protocol, see text. (B) Blot probed for Egfr. The DNA used and the time incubated at 30°C are indicated. (C) Blot probed for pMAPK shows pathway activation (same gel as is shown in B). Note, pMAPK levels appear constant over 60 minutes at 30°C for wild-type Egfr. However, for Egfrtsla, although pMAPK is detected at 18°C, after the shift to 30°C, the level falls rapidly down to background levels. Asterisks in B and C indicate examples of the 60-minute time-point bands used in the quantification shown in Fig. 3. (D) Same blot as in C, re-probed for total MAPK (loading control).

Fig. 3.

Quantification of the temperature-shift Egfr-activity data from S2 cells. Histograms for two experiments shown in Fig. 2, showing 0-minute at 18°C and 60-minute at 30°C time points (see text). Data are shown as a percentage of wild type at 30°C. Error bars indicate s.e.m.

Fig. 3.

Quantification of the temperature-shift Egfr-activity data from S2 cells. Histograms for two experiments shown in Fig. 2, showing 0-minute at 18°C and 60-minute at 30°C time points (see text). Data are shown as a percentage of wild type at 30°C. Error bars indicate s.e.m.

Fig. 4.

Nuclear pMAPK following Spitz activation in S2 cells. S2 cells were stained for Egfr antigen, pMAPK antigen and DNA as indicated. Conditions are as in Fig. 2A and Fig. 3, see text. Transfected DNA and temperature are indicated on the left. Transfected cells express elevated Egfr antigen (arrowheads), untransfected control cells do not. Note that cells transfected with Egfrtsla, at 30°C, do not express pMAPK over background levels. Arrows indicate increased levels of pMAPK antigen. Scale bar: 5 μm.

Fig. 4.

Nuclear pMAPK following Spitz activation in S2 cells. S2 cells were stained for Egfr antigen, pMAPK antigen and DNA as indicated. Conditions are as in Fig. 2A and Fig. 3, see text. Transfected DNA and temperature are indicated on the left. Transfected cells express elevated Egfr antigen (arrowheads), untransfected control cells do not. Note that cells transfected with Egfrtsla, at 30°C, do not express pMAPK over background levels. Arrows indicate increased levels of pMAPK antigen. Scale bar: 5 μm.

All of these biochemical and cell biological experiments show that Egfrtsla is a mutation that is temperature sensitive for activity. The level of ligand-dependent Egfrtsla activity at the permissive temperature is not distinguishable from that of the wild type, and the activity at the restrictive temperature is indistinguishable from no activity at all. In addition, these experiments show that the effect of the temperature shift is rapid, occurring within 15 minutes. These results are consistent with the in vivo study we published previously, which showed that Egfrtsla mutants rapidly loose pMAPK antigen from the morphogenetic furrow (Kumar et al.,1998). We conclude that Egfrtsla is indeed a rapidly acting mutation that is temperature sensitive for activity. Egfrtsla is effectively wild type at 18°C and effectively null at 30°C.

Egfrtsla antigen is rapidly removed from the cell surface after a shift to 30°C

We detected reduced levels of Egfr antigen in cells transfected with Egfrtsla at 30°C (see above). It could be that after temperature shift, the Egfrtsla protein is removed from the cell surface and targeted for degradation. To study this, we labeled transfected S2 cells with a non-membrane permeable biotinylation reagent to separate superficial from intracellular Egfr (Fig. 5A). We compared biotinylated Egfr antigen (see asterisk in Fig. 5B) to total Egfr antigen(see asterisk in Fig. 5C). We detected biotinylated Egfr at all time points from cells transfected with Egfr+. Biotinylated Egfrtsla is also seen at 18°C, but is rapidly lost so that none is detectable after 60 minutes at 30°C (Fig. 5B), and a low level of total antigen remains (Fig. 5C). These results strongly suggest that Egfrtslaprotein undergoes a ligand-independent conformational change at 30°C,leading to rapid internalization.

To investigate this relocalization in vivo, we raised a new anti-Egfr serum[to the same C-terminal peptide as previously reported(Lesokhin et al., 1999)]. We tested it for specificity by staining eye imaginal disc Egfrf2 homozygous clones (data not shown). We stained wild-type eye discs and saw an Egfr expression pattern as has been previously described (data not shown) (Lesokhin et al., 1999). We see the wild-type pattern in Egfrtsla homozygous retinal clones raised at 18°C(Fig. 6A,B). In the furrow, we observed antigen concentrated in a subset of the Armadillo-positive cell junctions and the first two columns of ommatidial preclusters (see white arrrowhead in Fig. 6B)(Takahashi et al., 1996; Ahmed et al., 1998). This junctional stain occurs around all sides of the cells deep in the furrow (see white arrrowhead in Fig. 6B),but, at the edges of the furrow, it becomes lost from the faces of the cells that lie away from the furrow. The junctions between the cells within the precluster are heavily stained (see white arrrowhead in Fig. 6B, inset); however, the junctions between the precluster cells and the surrounding cells are not (see black arrrowhead in Fig. 6B,inset). We also saw numerous cytoplasmic granules in the assembling ommatidia(see arrows in Fig. 6A,B).

Fig. 5.

Egfr antigen is removed from the cell surface in Egfrtsla after temperature shift. (A) Diagram of the protocol used in B,C, see text. (B) Biotinylated material, probed for Egfr.(C) Total lysate, probed for Egfr. Note that after the temperature shift,biotinylated Egfrtsla antigen is lost more quickly than is total Egfr antigen.

Fig. 5.

Egfr antigen is removed from the cell surface in Egfrtsla after temperature shift. (A) Diagram of the protocol used in B,C, see text. (B) Biotinylated material, probed for Egfr.(C) Total lysate, probed for Egfr. Note that after the temperature shift,biotinylated Egfrtsla antigen is lost more quickly than is total Egfr antigen.

Thus, we find that Egfr antigen is normally strongly localized in the furrow to a specific subset of cell junctions: essentially the cells held in G1 cell-cycle arrest (Ready et al.,1976; Wolff and Ready,1991; Thomas et al.,1994). This observation is intriguing, but the pattern does not correlate precisely with known Egfr signaling activity (from pMAPK staining). Egfr junctional staining is seen within and between the Atonal-positive intermediate groups, whereas pMAPK staining is seen only within them(Gabay et al., 1997; Kumar et al., 1998; Spencer et al., 1998). Thus,the biological significance of this pattern is presently unclear.

Fig. 6.

Egfr antigen localization is rapidly altered in Egfrtsla after temperature shift. Eye discs with mosaic clones homozygous for Egfrtsla were stained for Egfr antigen. In all figures, anterior is shown to the right. (A,C,E) Posterior region; (B,D,F-H) the furrow. Times and temperatures are indicated left, see text. A granular, non-nuclear stain in all parts of the disc (white arrows)and a strong additional stain in the furrow between specific cells (white arrowheads in B) is observed. Note that rapidly after the shift to 30°C the furrow cell border stain is lost and is replaced by a heavy antigen stain in larger granules. (G,H) Eye discs stained for (G) Armadillo (Arm), and for(H) Hrs (green) and Egfr (red). Note, Armadillo junctional stain persists after temperature shift (arrow in G), but that Egfr and Hrs do not co-localize(white arrowhead in H indicates an Hrs-positive granule and black arrowhead in H indicates an Egfr-positive granule). Scale bar: 5 μm.

Fig. 6.

Egfr antigen localization is rapidly altered in Egfrtsla after temperature shift. Eye discs with mosaic clones homozygous for Egfrtsla were stained for Egfr antigen. In all figures, anterior is shown to the right. (A,C,E) Posterior region; (B,D,F-H) the furrow. Times and temperatures are indicated left, see text. A granular, non-nuclear stain in all parts of the disc (white arrows)and a strong additional stain in the furrow between specific cells (white arrowheads in B) is observed. Note that rapidly after the shift to 30°C the furrow cell border stain is lost and is replaced by a heavy antigen stain in larger granules. (G,H) Eye discs stained for (G) Armadillo (Arm), and for(H) Hrs (green) and Egfr (red). Note, Armadillo junctional stain persists after temperature shift (arrow in G), but that Egfr and Hrs do not co-localize(white arrowhead in H indicates an Hrs-positive granule and black arrowhead in H indicates an Egfr-positive granule). Scale bar: 5 μm.

When we shift these discs to the non-permissive temperature, the junctional antigen in the furrow and early preclusters is rapidly converted to larger granules: partially after 15 minutes at 30°C (and then up to 15 minutes dissection time at room temperature, Fig. 6D and inset), and completely by 30 minutes (and then up to 15 minutes dissection time at room temperature, Fig. 6F). Under these conditions Armadillo staining is unaffected(Fig. 6G). Thus, although Egfr antigen may co-localize with Armadillo in some of the Armadillo-positive junctions (furrow and early preclusters), Armadillo antigen distribution is not dependent on Egfr function (at least not in the short term). In mammals,ligand bound EGFR has been shown to pass through an endocytic pathway(Carpenter, 2000), and the Drosophila Hepatocyte growth factor regulated tyrosine kinase substrate (Hrs) protein affects trafficking so that active Egfr is degraded(Lloyd et al., 2002; Weber et al., 2003). We co-stained Egfrtsla homozygous retinal clones after 30 minutes at 30°C for Egfr and Hrs antigens(Fig. 6H) and found no significant co-localization. This suggests that the Egfr antigen is removed from the Armadillo-positive junctional domains following temperature shift,but that this is not via a pathway that involves Hrs.

Fig. 7.

Egfrtsla clones affect cell growth, late R8 spacing and neural differentiation. (A-H) Eye discs with ey:Flp induced mosaic clones are shown; clones are negatively marked with GFP and are outlined in E-H. (A-D) Homozygous clone genotypes and the times incubated at each temperature are indicated (see text). (E-H) Egfrtslaclones, raised at 18°C, and shifted to 30°C 24 hours before dissection. (E,F) Senseless; note the presence of Senseless-positive R8 cells,sometimes immediately adjacent to each other (arrow). (G,H) Elav; note that although most Elav-positive cells are lost (asterisk), some persist for some time (arrows).

Fig. 7.

Egfrtsla clones affect cell growth, late R8 spacing and neural differentiation. (A-H) Eye discs with ey:Flp induced mosaic clones are shown; clones are negatively marked with GFP and are outlined in E-H. (A-D) Homozygous clone genotypes and the times incubated at each temperature are indicated (see text). (E-H) Egfrtslaclones, raised at 18°C, and shifted to 30°C 24 hours before dissection. (E,F) Senseless; note the presence of Senseless-positive R8 cells,sometimes immediately adjacent to each other (arrow). (G,H) Elav; note that although most Elav-positive cells are lost (asterisk), some persist for some time (arrows).

These results are consistent with the biotinylation data described above. The simplest interpretation is that the Egfrtsla protein undergoes a conformational change upon temperature shift, leading to ligand-independent internalization via a non-signaling pathway.

Egfrtsla is null by genetic criteria

Egfr null mosaic clones are small(Xu and Rubin, 1993), so we compared the sizes of Egfrtsla clones to Egfrnull clones. We used ey:Flp to induce Egfrtsla clones and raised the animals continuously at 18°C (Fig. 7A), at 18°C and then at 30°C for their last day(Fig. 7B), or continuously at 30°C (Fig. 7C). The total area of the Egfrtsla clone territory was roughly equal in size to the total area of wild-type twin-spots when raised continuously at 18°C and after one day at 30°C (although they are reduced towards the posterior side). However, the clones are very much smaller after continuous growth at 30°C. Likewise, Egfr homozygous null clones made without Minute mutations are very small and are similar to Egfrtsla homozygous clones after continuous growth at 30°C (compare Fig. 7C and 7D).

Egfr is required for late ommatidial development, so we stained Egfrtsla clones (raised at 30°C for 24 hours) for a late R8 marker, Senseless (Fig. 7E,F) (Frankfort et al.,2001), and a neural marker, Elav(Fig. 7G,H)(Robinow and White, 1991). As previously reported (Dominguez et al.,1998; Kumar et al.,1998; Spencer et al.,1998; Baonza et al.,2001; Yang and Baker,2001), we find that R8 cells do form, although at later stages they are sometimes abnormally close (Fig. 7E,F). Elav expression is lost from the non-R8 photoreceptors(Fig. 7G,H) and also from most of the R8s, because of a late maintenance requirement(Kumar et al., 1998).

Thus, by these proliferation and differentiation defects, Egfrtsla (at the restrictive temperature) is indistinguishable from nulls.

Egfrtsla does not affect the rate of furrow progression

Thus far, we have tested for the first two of the four possible artifacts defined above: Egfrtsla is temperature sensitive for activity(there is no perdurance of activity), and it is biochemically and genetically indistinguishable from a null. The third possible artifact was that the normal Atonal expression pattern in temperature-shifted Egfrtslaeye discs might result from a rapid arrest of furrow movement with no further change in the Atonal pattern. To test this, we stained Egfrtsla homozygous clones that were raised at 18°C and held at 30°C for 24 hours for Atonal. In this experiment, the Egfrtsla territories abut Egfr+ twin spots. If the loss of Egfr function causes the furrow to arrest with `frozen'Atonal expression, we would see the furrow about twelve columns more advanced in the wild-type tissue than in the mutant clones. As before(Kumar et al., 1998), we saw normal Atonal expression in this mutant tissue. We also saw that the position of the furrow was equally advanced in the mutant clones and in the wild-type twin spots (Fig. 8A-C). Thus,we conclude that Egfr does not regulate the rate of furrow progression. We also confirm again that Egfrtsla has no effect on R8/founder cell initial spacing, neither with a 24-hour shift(Fig. 8A-C), nor when raised continuously at the non-permissive temperature(Fig. 8D-F).

Two different Minute mutations in mosaic clones have dominant and non-cell autonomous effects on Atonal expression

Having investigated the possible artifacts of the Egfrtsla studies, we turned to the fourth possibility:some artifact in the Egfr null Minute mosaic experiments. It could be that the Egfr mutations used in these experiments have some dominant effects on Atonal expression under these conditions (24 hours at 30°C). Therefore, we stained eye discs heterozygous for three Egfr alleles in trans to wild type (Egfrtsla,Egfrf2 and Egfrtop-18A, Fig. 9A-C), and we found that there was some variation in the Atonal antigen staining intensity in different specimens, but that this does not correlate with the three Egfrgenotypes. In all three cases, Atonal expression was normal.

Fig. 8.

Egfrtsla clones do not affect the speed of furrow progression or Atonal patterning. Eye discs with Egfrtslaclones, stained for Atonal antigen. (A,C,D,F) GFP; (B,C,E,F) Atonal. Mosaic clones are negatively marked by GFP and are outlined. (A-C) ey:FLP-induced clone homozygous for Egfrtsla,raised at 18°C, then at 30°C for 24 hours. Note that the position of the furrow is the same in the clone (black arrowheads) and in the flanking territory (white arrowheads). (D-F) Same genotype, raised continuously at 30°C. Note the normal appearance of Atonal expression in the mutant territory, both anterior (white arrow) and posterior (black arrow) to the furrow. Scale bar: 20 μm.

Fig. 8.

Egfrtsla clones do not affect the speed of furrow progression or Atonal patterning. Eye discs with Egfrtslaclones, stained for Atonal antigen. (A,C,D,F) GFP; (B,C,E,F) Atonal. Mosaic clones are negatively marked by GFP and are outlined. (A-C) ey:FLP-induced clone homozygous for Egfrtsla,raised at 18°C, then at 30°C for 24 hours. Note that the position of the furrow is the same in the clone (black arrowheads) and in the flanking territory (white arrowheads). (D-F) Same genotype, raised continuously at 30°C. Note the normal appearance of Atonal expression in the mutant territory, both anterior (white arrow) and posterior (black arrow) to the furrow. Scale bar: 20 μm.

It could be that Minute mutations have dominant and/or non-cell autonomous clone effects on Atonal expression and R8/founder cell patterning. Indeed, it has been reported that a Minute mutation affects gene expression and cell growth in competing, wild-type clones(de la Cova et al., 2004). To test for this and other possible artifacts, we repeated the Egfr null experiments, exactly as previously reported, using stocks kindly supplied by those investigators. We placed Egfrf2 in trans to Minute(2)53 (Baonza et al.,2001), and we placed Egfrtop-18A in trans to Minute(2)56i (Yang and Baker,2001). We also placed Egfrtsla in trans to both Minute(2)53 and Minute(2)56i. All four genotypes were raised at 18°C until the early second instar and then clones were induced with hs:Flp (90 minutes at 37°C). Thereafter, the animals were raised at 30°C and eye discs were stained for Atonal. In all four cases(Fig. 9D-O), we found that the pattern of Atonal expression was not wild type (compare with Fig. 9A-C). In these cases, the Egfrtsla clones were indistinguishable from the clones of the two Egfr null alleles made with the same Minutemutations (compare Fig. 9D-F with 9G-I, and compare 9J-L with 9M-O). Thus, by this phenotype also, Egfrtsla raised at 30°C is indistinguishable from the nulls.

Furthermore, we find that the pattern of Atonal expression is different to that of wild type, both within the Egfr homozygous mutant territories and outside of them (in the Egfr Minute heterozygous cells). These abnormalities include the occasional twinning of Atonal-positive cells(Fig. 9E,F), reduced differentiation of the intermediate groups (all four cases) and reduced Atonal expression in some cases (arrows in Fig. 9K,L,N,O). Taken together, these data suggest that some factor in both Minute experiments causes dominant and non-cell autonomous defects in the pattern of Atonal expression and R8/founder cell/ommatidial spacing.

How could the use of the Minute mutations produce these effects?The simplest possibility is that Minute(2)53 and Minute(2)56i have a dominant effect on Atonal patterning on their own. Indeed, as well as affecting body size, developmental time and bristle morphology, some Minute mutants are reported to have dominant rough eye phenotypes (Plough and Ives,1934; Dunn and Mossige,1937; Brehme,1939; Kalisch and Rasmuson,1974; Sinclair et al.,1981). However, neither Minute(2)53 nor Minute(2)56i show a dominant rough eye phenotype. Furthermore, we stained the heterozygous stocks for Atonal expression and saw no defects (data not shown). Thus, the Atonal defects are not due to a simple dominant effect of the Minute mutations.

It could be that the phenotype is due to a dominant synthetic interaction between the Minute mutations and Egfr. Again, this is not probable, as the Egfr mutant clones are Minute+after the somatic recombination. We stained animals that were Egfrmutant in trans to the two Minute mutations (without inducing clones)for Atonal expression and again saw no defects (data not shown). Thus, the Atonal defects are not due to a dominant synthetic interaction between the Minute mutations and Egfr.

It may be that cell competition effects between the Minute+ and Minute heterozygous territories produce the Atonal patterning defects. Such competition effects have been reported in other Minute experiments(de la Cova et al., 2004). Another possibility is that the dying Minute cells release developmental signals that affect retinal patterning in the surrounding tissues. Indeed, it has been reported that dying cells release both Wingless and Dpp (Perez-Garijo et al., 2004; Ryoo et al.,2004). If either of these possibilities is true, then we would expect to see defects in the Atonal expression pattern when clones are induced from Minute heterozygous flies, even without any Egfrmutation present in trans. In other words, fully wild-type clones adjacent to Minute heterozygous territories would have Atonal defects similar to those seen in the Egfr mutant clone-containing discs. We stained such wild-type clones for Atonal expression, and do indeed see just such defects,both within and outside of the clones (Fig. 9P-R). We observed a total of fifteen such clones in the Atonal expression domain, taken from five imaginal discs. Indeed, the Atonal pattern in these Minute (alone) clones is indistinguishable from that in clones for the same Minute with Egfr (compare Fig. 9Q to 9E,H).

Our data suggest that the Atonal patterning defects seen in mosaic clone experiments, when the Minute technique is used, may be due to a genetic effect of the Minute, and not of the Egfr,mutation.

We characterized the lesion in Egfrtsla and found that it is a missense mutation in the conserved ligand-binding, extracellular L2 domain(Burgess et al., 2003). Our biochemical and localization data suggest that the Egfrtsla protein functions normally at 18°C as a ligand-activated receptor. However, after shift to the non-permissive temperature, Egfrtsla rapidly becomes inactive and is removed from the cell surface, probably via a non-signaling endocytic pathway (with or without ligand). It may be that the Egfrtsla protein is conformationally unstable at 30°C and is degraded. Human EGFR is normally only internalized in response to ligand binding (Burke et al., 2001),but it has been reported that inhibition of PKA leads to internalization of unbound EGFR (Salazar and Gonzalez,2002). Our mutation in the extracellular L2 domain suggests that this domain may be involved in mediating the stability of Egfr in the membrane.

Fig. 9.

Two different Minute mutations affect Atonal expression, whereas Egfr alleles do not. Eye discs stained for Atonal are shown inA-C,E,F,H,I,K,L,N,O,Q,R. Clones are negatively marked by β-gal (white in D,G,J,M,P, blue in F,I,L,O,R) and are outlined. (A-C) Egfr alleles in trans to wild type; note normal Atonal expression. (D-R) hs:Flp-induced clones induced in trans to Minutechromosomes. (D-O) β-gal-positive territories are heterozygous for the Egfr allele and for the Minute mutation. Black (β-gal negative) territories are homozygous for the Egfr allele and are wild type for the Minute mutation. (P-R) β-gal-positive territories are heterozygous for the Minute mutation. Black (β-gal negative)territories are genetically (but not phenotypically) wild type. No Minute homozygous cells survive. Mutations are indicated on the left. Note, the Atonal pattern is not wild type in either the Egfr homozygous (black in D-O) or the Egfr heterozygous territories (compare the β-gal-positive regions to the heterozygous examples shown in A-C). Also, the Atonal pattern is not wild type in either the wild-type territories (white arrows in P-R) or the adjacent Minute heterozygous cells (black arrows in P-R). Note that Minute(2)53 and Minute(2)56i have different, but self-consistent dominant effects on Atonal expression. Atonal expression in the Egfrtsla Minute+ clones is indistinguishable from that in the two Egfr null alleles. Scale bar:10 μm.

Fig. 9.

Two different Minute mutations affect Atonal expression, whereas Egfr alleles do not. Eye discs stained for Atonal are shown inA-C,E,F,H,I,K,L,N,O,Q,R. Clones are negatively marked by β-gal (white in D,G,J,M,P, blue in F,I,L,O,R) and are outlined. (A-C) Egfr alleles in trans to wild type; note normal Atonal expression. (D-R) hs:Flp-induced clones induced in trans to Minutechromosomes. (D-O) β-gal-positive territories are heterozygous for the Egfr allele and for the Minute mutation. Black (β-gal negative) territories are homozygous for the Egfr allele and are wild type for the Minute mutation. (P-R) β-gal-positive territories are heterozygous for the Minute mutation. Black (β-gal negative)territories are genetically (but not phenotypically) wild type. No Minute homozygous cells survive. Mutations are indicated on the left. Note, the Atonal pattern is not wild type in either the Egfr homozygous (black in D-O) or the Egfr heterozygous territories (compare the β-gal-positive regions to the heterozygous examples shown in A-C). Also, the Atonal pattern is not wild type in either the wild-type territories (white arrows in P-R) or the adjacent Minute heterozygous cells (black arrows in P-R). Note that Minute(2)53 and Minute(2)56i have different, but self-consistent dominant effects on Atonal expression. Atonal expression in the Egfrtsla Minute+ clones is indistinguishable from that in the two Egfr null alleles. Scale bar:10 μm.

Atonal expression and R8/founder cell spacing are normal in Egfrtsla eye discs incubated at the non-permissive temperature. We examined three possible artifacts that could have invalidated this observation. (1) Egfrtsla could be temperature sensitive for synthesis but not activity. If so, then protein made before the shift to 30°C might continue to supply sufficient function at the non-permissive temperature to support normal R8/founder cell development. However, we have shown that Egfrtsla is in fact temperature sensitive for activity,and that activity is lost within minutes of the temperature shift, while Atonal expression and R8/founder cell formation continues normally for 24 hours. (2) Egfrtsla could be leaky (i.e. not null) at 30°C, and some residual activity might supply sufficient function at the non-permissive temperature to support normal R8/founder cell development. We have shown before that Egfrtsla mutants (at the non-permissive temperature) are genetically indistinguishable from a null(Egfrf24) for three phenotypes(Kumar et al., 1998). Here, we have shown in addition that Egfrtsla mutants at 30°C are phenotypically indistinguishable from nulls (Egfrf2and Egfrtop-18A), in Minute+ mosaic clones, as well as in their growth deficits in clones made without Minute mutations. Furthermore, we have undertaken quantitative biochemical experiments using S2 cells to show that Egfrtsla at 30°C is indistinguishable from a null in its ability to drive both the phosphorylation of MAPK and its own autophosphorylation. (3) It could be that,at 30°C, the furrow just freezes in Egfrtsla mutant eyes, leaving an arrested but apparently normal furrow. Here, we have shown that in adjacent Egfrtsla and Egfr+territories, the furrow advances at the same rate after the temperature shift to 30°C. Thus, we conclude that our observation of normal Atonal and R8/founder cell patterning in Egfrtsla mutant eyes is not invalidated by any of these three possible artifacts.

Next, we turned to the possible problems associated with the Minute+ mosaic method used to make the same observations with the Egfr nulls (Baonza et al., 2001; Yang and Baker,2001). We replicated the Minute+ Egfr null experiments exactly as previously reported, using the same Drosophilastocks, except to run them at 30°C. In parallel, we did the same experiments with Egfrtsla. If the known Egfrnulls were to have a different phenotype to Egfrtsla, we would be forced to conclude that Egfrtsla is not behaving as a null in this assay. If, however, the two Egfr nulls have the same phenotype in this assay as Egfrtsla does, then we could conclude that the temperature-sensitive allele is indistinguishable from the nulls at 30°C, and that the difference is due to the Minutetechnique and not to Egfr. Indeed, we did find that the Egfrtsla and Egfr null phenotypes are indistinguishable, and thus we conclude that the Egfrtslaphenotypes assayed without the Minute technique are valid and that the discrepancy stems from some aspect of the use of the Minutemutations. We went on to stain Minute clones made without any Egfr mutation present and obtained the very same Atonal expression defects. Taken together, these data suggest that the spacing defects previously reported by others, and replicated by us here, are genetically dependent on the presence of the Minute clones, and are not an affect of the Egfr mutations.

Therefore, we conclude that Egfr has no primary role in R8/founder cell spacing and also that Egfrtsla is a rapidly acting temperature-sensitive mutation that is functionally null at the non-permissive temperature.

We thank A. D'Costa, V. Faundez, D. Marenda, K. Moberg, M. Powers, E. Rogers, A. Vrailas and D. Zarnescu for their helpful comments; D. Ritsick and G. Salazar for intellectual contributions; R. Boyd and J. Kumar for assistance with sequencing; and N. Baker, G. Mardon, B.-Z. Shilo and U. Weber for their gifts of reagents. This work was supported in the Moses laboratory by a grant from the National Eye Institute (EY12537).

Ahmed, Y., Hayashi, S., Levine, A. and Wieschaus, E.(
1998
). Regulation of Armadillo by a Drosophila APC inhibits neuronal apoptosis during retinal development.
Cell
93
,
1171
-1182.
Baker, N. E. (
2004
). Atonal points the way-protein-protein interactions and developmental biology.
Dev. Cell
7
,
632
-634.
Baker, N. E. and Rubin, G. M. (
1989
). Effect on eye development of dominant mutations in Drosophila homologue of the EGF receptor.
Nature
340
,
150
-153.
Baker, N. E. and Zitron, A. E. (
1995
). Drosophila eye development: Notch and Delta amplify a neurogenic pattern conferred on the morphogenetic furrow by scabrous.
Mech. Dev.
49
,
173
-189.
Baker, N. E., Yu, S. and Han, D. (
1996
). Evolution of proneural atonal expression during distinct regulatory phases in the developing Drosophila eye.
Curr. Biol.
6
,
1290
-1301.
Baonza, A. and Freeman, M. (
2001
). Notch signalling and the initiation of neural development in the Drosophilaeye.
Development
128
,
3889
-3898.
Baonza, A., Casci, T. and Freeman, M. (
2001
). A primary role for the epidermal growth factor receptor in ommatidial spacing in the Drosophila eye.
Curr. Biol.
11
,
396
-404.
Basler, K. and Hafen, E. (
1989
). Dynamics of Drosophila eye development and temporal requirements of sevenless expression.
Development
107
,
723
-731.
Bogdan, S. and Klambt, C. (
2001
). Epidermal growth factor receptor signaling.
Curr. Biol.
11
,
R292
-R295.
Brehme, K. S. (
1939
). A study of the effect on development of “Minute” mutations in Drosophila melanogaster.
Genetics
24
,
131
-161.
Brown, K. E. and Freeman, M. (
2003
). Egfr signalling defines a protective function for ommatidial orientation in the Drosophila eye.
Development
130
,
5401
-5412.
Brunner, D., Ducker, K., Oellers, N., Hafen, E., Scholz, H. and Klambt, C. (
1994
). The ETS domain protein pointed-P2 is a target of MAP kinase in the sevenless signal transduction pathway.
Nature
370
,
386
-389.
Burgess, A. W., Cho, H. S., Eigenbrot, C., Ferguson, K. M.,Garrett, T. P.,Leahy, D. J., Lemmon, M. A., Sliwkowski, M. X., Ward,C. W. andYokoyama, S. (
2003
). An open-and-shut case?Recent insights into the activation of EGF/ErbB receptors.
Mol. Cell
12
,
541
-552.
Burke, P., Schooler, K. and Wiley, H. S.(
2001
). Regulation of epidermal growth factor receptor signaling by endocytosis and intracellular trafficking.
Mol. Biol. Cell
12
,
1897
-1910.
Cagan, R. L. and Ready, D. F. (
1989
). Notch is required for successive cell decisions in the developing Drosophila retina.
Genes Dev.
3
,
1099
-1112.
Carpenter, G. (
2000
). The EGF receptor: a nexus for trafficking and signaling.
BioEssays
22
,
697
-707.
Clifford, R. and Schüpbach, T. (
1994
). Molecular analysis of the Drosophila EGF receptor homolog reveals that several genetically defined classes of alleles cluster in subdomains of the receptor protein.
Genetics
137
,
531
-550.
de la Cova, C., Abril, M., Bellosta, P., Gallant, P. and Johnston, L. A. (
2004
). Drosophila myc regulates organ size by inducing cell competition.
Cell
117
,
107
-116.
Dokucu, M. E., Zipursky, L. S. and Cagan, R. L.(
1996
). Atonal, Rough and the resolution of proneural clusters in the developing Drosophila retina.
Development
122
,
4139
-4147.
Dominguez, M. (
1999
). Dual role for Hedgehog in the regulation of the proneural gene atonal during ommatidia development.
Development
126
,
2345
-2353.
Dominguez, M., Wasserman, J. D. and Freeman, M.(
1998
). Multiple functions for the EGF receptor in Drosophila eye development.
Curr. Biol.
8
,
1039
-1048.
Dunn, L. C. and Mossige, J. C. (
1937
). The effects of the Minute mutations of Drosophila melanogasteron developmental rate.
Hereditas
23
,
70
-90.
Firth, L. C. and Baker, N. E. (
2003
). EGF receptor signaling: a prickly proposition.
Curr. Biol.
13
,
R773
-R774.
Frankfort, B. J., Nolo, R., Zhang, Z., Bellen, H. and Mardon,G. (
2001
). senseless Repression of rough Is Required for R8 Photoreceptor Differentiation in the Developing Drosophila Eye.
Neuron
32
,
403
-414.
Freeman, M. (
1994
). The spitz gene is required for photoreceptor determination in the Drosophila eye where it interacts with the EGF receptor.
Mech. Dev.
48
,
25
-33.
Freeman, M. (
1996
). Reiterative use of the EGF receptor triggers differentiation of all cell types in the Drosophilaeye.
Cell
87
,
651
-660.
Freeman, M. (
1997
). Cell determination strategies in the Drosophila eye.
Development
124
,
261
-270.
Freeman, M. (
2002
). A fly's eye view of EGF receptor signalling.
EMBO J.
21
,
6635
-6642.
Gabay, L., Seger, R. and Shilo, B.-Z. (
1997
). In situ activation pattern of Drosophila EGF receptor pathway during development.
Science
277
,
1103
-1106.
Halfar, K., Rommel, C., Stocker, H. and Hafen, E.(
2001
). Ras controls growth, survival and differentiation in the Drosophila eye by different thresholds of MAP kinase activity.
Development
128
,
1687
-1696.
Jarman, A. P., Grau, Y., Jan, L. Y. and Jan, Y. N.(
1993
). atonal is a proneural gene that directs chordotonal organ formation in the Drosophila peripheral nervous system.
Cell
73
,
1307
-1321.
Jarman, A. P., Grell, E. H., Ackerman, L., Jan, L. Y. and Jan,Y. N. (
1994
). Atonal is the proneural gene for Drosophila photoreceptors.
Nature
369
,
398
-400.
Jarman, A. P., Sun, Y., Jan, L. Y. and Jan, Y. N.(
1995
). Role of the proneural gene, atonal, in formation of the Drosophila chordotonal organs and photoreceptors.
Development
121
,
2019
-2030.
Kalisch, W. E. and Rasmuson, B. (
1974
). Changes of zeste phenotype induced by autosomal mutations in Drosophila melanogaster.
Hereditas
78
,
97
-104.
Kumar, J. P., Tio, M., Hsiung, F., Akopyan, S., Gabay, L.,Seger, R., Shilo,B.-Z. and Moses, K. (
1998
). Dissecting the roles of the Drosophila EGF receptor in eye development and MAP kinase activation.
Development
125
,
3875
-3885.
Kumar, J. P., Hsiung, F., Powers, M. and Moses, K.(
2003
). Nuclear translocation of activated MAP kinase is developmentally regulated in the developing Drosophila eye.
Development
130
,
3703
-3714.
Kurada, P. and White, K. (
1998
). Ras promotes cell survival in Drosophila by downregulating hidexpression.
Cell
95
,
319
-329.
Lee, J. R., Urban, S., Garvey, C. F. and Freeman, M.(
2001
). Regulated intracellular ligand transport and proteolysis control EGF signal activation in Drosophila.
Cell
107
,
161
-171.
Lesokhin, A. M., Yu, S. Y., Katz, J. and Baker, N. E.(
1999
). Several levels of EGF receptor signaling during photoreceptor specification in wild-type, Ellipse, and null mutant Drosophila.
Dev. Biol.
205
,
129
-144.
Lloyd, T. E., Atkinson, R., Wu, M. N., Zhou, Y., Pennetta, G. and Bellen, H. J. (
2002
). Hrs regulates endosome membrane invagination and tyrosine kinase receptor signaling in Drosophila.
Cell
108
,
261
-269.
Marshall, C. J. (
1994
). MAP kinase kinase kinase, MAP kinase kinase and MAP kinase.
Curr. Opin. Genet. Dev.
4
,
82
-89.
Moberg, K. H., Mukherjee, A., Veraksa, A., Artavanis-Tsakonas,S. andHariharan, I. K. (
2004
). The Drosophila F box protein Archipelago regulates dMyc protein levels in vivo.
Curr. Biol.
14
,
965
-974.
Nolo, R., Abbott, L. A. and Bellen, H. J.(
2000
). Senseless, a Zn finger transcription factor, is necessary and sufficient for sensory organ development in Drosophila.
Cell
102
,
349
-362.
O'Neill, E. M., Rebay, I., Tjian, R. and Rubin, G. M.(
1994
). The activities of two Ets-related transcription factors required for Drosophila eye development are modulated by the Ras/MAPK pathway.
Cell
78
,
137
-147.
Perez-Garijo, A., Martin, F. A. and Morata, G.(
2004
). Caspase inhibition during apoptosis causes abnormal signalling and developmental aberrations in Drosophila.
Development
131
,
5591
-5598.
Plough, H. H. and Ives, P. T. (
1934
). New mutants report.
Dros. Inf. Serv.
1
,
31
-34.
Ready, D. F., Hanson, T. E. and Benzer, S.(
1976
). Development of the Drosophila retina, a neurocrystalline lattice.
Dev. Biol.
53
,
217
-240.
Riggleman, B., Schedl, P. and Wieschaus, E.(
1990
). Spatial expression of the Drosophila segment polarity gene armadillo is posttranscriptionally regulated by wingless.
Cell
63
,
549
-560.
Robinow, S. and White, K. (
1991
). Characterization and spatial distribution of the ELAV protein during Drosophila melanogaster development.
J. Neurobiol.
22
,
443
-461.
Ryoo, H. D., Gorenc, T. and Steller, H. (
2004
). Apoptotic cells can induce compensatory cell proliferation through the JNK and the Wingless signaling pathways.
Dev. Cell
7
,
491
-501.
Salazar, G. and Gonzalez, A. (
2002
). Novel mechanism for regulation of epidermal growth factor receptor endocytosis revealed by protein kinase A inhibition.
Mol. Biol. Cell
13
,
1677
-1693.
Schweitzer, R., Shaharabany, M., Seger, R. and Shilo, B.-Z.(
1995
). Secreted Spitz triggers the DER signaling pathway and is a limiting component in embryonic ventral ectoderm determination.
Genes Dev.
9
,
1518
-1529.
Shilo, B. Z. (
2003
). Signaling by the Drosophila epidermal growth factor receptor pathway during development.
Exp. Cell Res.
284
,
140
-149.
Sinclair, D. A., Suzuki, D. T. and Grigliatti, T. A.(
1981
). Genetic and developmental analysis of a temperature-sensitive Minute mutation of Drosophila melanogaster.
Genetics
97
,
581
-606.
Spencer, S. A., Powell, P. A., Miller, D. T. and Cagan, R. L. (
1998
). Regulation of EGF receptor signaling establishes pattern across the developing Drosophila retina.
Development
125
,
4777
-4790.
Strutt, H. and Strutt, D. (
2003
). EGF signaling and ommatidial rotation in the Drosophila eye.
Curr. Biol.
13
,
1451
-1457.
Suzuki, T. and Saigo, K. (
2000
). Transcriptional regulation of atonal required for Drosophilalarval eye development by concerted action of eyes absent, sine oculis and hedgehog signaling independent of fused kinase and cubitus interruptus.
Development
127
,
1531
-1540.
Takahashi, F., Endo, S., Kojima, T. and Saigo, K.(
1996
). Regulation of cell-cell contacts in developing Drosophila eyes by Dsrc41, a new, close relative of vertebrate c-src.
Genes Dev.
10
,
1645
-1656.
Thomas, B. J., Gunning, D. A., Cho, J. and Zipursky, S. L.(
1994
). Cell cycle progression in the developing Drosophila eye: roughex encodes a novel protein required for the establishment of G1.
Cell
77
,
1003
-1014.
Tio, M. and Moses, K. (
1997
). The Drosophila TGFα homolog Spitz acts in photoreceptor recruitment in the developing retina.
Development
124
,
343
-351.
Tio, M., Ma, C. and Moses, K. (
1994
). spitz, a Drosophila homolog of transforming growth factor-α, is required in the founding photoreceptor cells of the compound eye facets.
Mech. Dev.
48
,
13
-23.
Tomlinson, A. (
1988
). Cellular interactions in the developing Drosophila eye.
Development
104
,
183
-193.
Tomlinson, A. and Ready, D. F. (
1987
). Neuronal differentiation in the Drosophila ommatidium.
Dev. Biol.
120
,
366
-376.
Tomlinson, A., Kimmel, B. E. and Rubin, G. M.(
1988
). rough, a Drosophila homeobox gene required in photoreceptors R2 and R5 for inductive interactions in the developing eye.
Cell
55
,
771
-784.
Treisman, R. (
1996
). Regulation of transcription by MAP kinase cascades.
Curr. Opin. Cell. Biol.
8
,
205
-215.
Voas, M. G. and Rebay, I. (
2004
). Signal integration during development: Insights from the Drosophila eye.
Dev. Dyn.
229
,
162
-175.
Weber, U., Eroglu, C. and Mlodzik, M. (
2003
). Phospholipid membrane composition affects EGF receptor and Notch signaling through effects on endocytosis during Drosophila development.
Dev. Cell
5
,
559
-570.
White, N. M. and Jarman, A. P. (
2000
). Drosophila atonal controls photoreceptor R8-specific properties and modulates both Receptor Tyrosine Kinase and Hedgehog signalling.
Development
127
,
1681
-1689.
Wolff, T. and Ready, D. F. (
1991
). The beginning of pattern formation in the Drosophila compound eye: the morphogenetic furrow and the second mitotic wave.
Development
113
,
841
-850.
Xu, T. and Rubin, G. M. (
1993
). Analysis of genetic mosaics in developing and adult Drosophila tissues.
Development
117
,
1223
-1237.
Yang, L. and Baker, N. E. (
2001
). Role of the EGFR/Ras/Raf pathway in specification of photoreceptor cells in the Drosophila retina.
Development
128
,
1183
-1191.
Yang, L. and Baker, N. E. (
2003
). Cell cycle withdrawal, progression, and cell survival regulation by Egfr and its effectors in the differentiating Drosophila eye.
Dev. Cell
4
,
359
-369.
Zak, N. B. and Shilo, B.-Z. (
1992
). Localization of DER and the pattern of cell divisions in wild-type and Ellipse eye imaginal discs.
Dev. Biol.
149
,
448
-456.