Many Hox proteins are thought to require Pbx and Meis co-factors to specify cell identity during embryogenesis. Here we demonstrate that Meis3 synergizes with Pbx4 and Hoxb1b in promoting hindbrain fates in the zebrafish. We find that Hoxb1b and Pbx4 act together to induce ectopic hoxb1a expression in rhombomere 2 of the hindbrain. In contrast, Hoxb1b and Pbx4 acting together with Meis3 induce hoxb1a, hoxb2, krox20 and valentino expression rostrally and cause extensive transformation of forebrain and midbrain fates to hindbrain fates, including differentiation of excess rhombomere 4-specific Mauthner neurons. This synergistic effect requires that Hoxb1b and Meis3 have intact Pbx-interaction domains, suggesting that their in vivo activity is dependent on binding to Pbx4. In the case of Meis3, binding to Pbx4 is also required for nuclear access. Our results are consistent with Hoxb1b and Meis3 interacting with Pbx4 to form complexes that regulate hindbrain development during zebrafish embryogenesis.

Vertebrate hox genes, like their Drosophila counterparts the HOM-C genes, play essential roles during embryogenesis. For instance, their expression in overlapping domains along the anteroposterior (AP) axis provides a ‘hox code’ that specifies AP positional identity, and changes in hox gene expression lead to homeotic transformations in the AP axis, wherein anterior structures acquire the character of more posterior structures (reviewed by Krumlauf, 1994).

Genetic analyses in Drosophila revealed that many HOM-C genes require the extradenticle (exd) and homothorax (hth) genes for proper function (Rauskolb et al., 1993; Rieckhof et al., 1997). Homologs of exd and hth are encoded by the vertebrate pbx (Kamps et al., 1990; Monica et al., 1991; Nourse et al., 1990; Vlachakis et al., 2000) and meis/prep (Berthelsen et al., 1998; Moskow et al., 1995; Nakamura et al., 1996) gene families, respectively. Recently, the zebrafish lazarus mutation, which disturbs segmental patterning in hindbrain and trunk, was cloned (Popperl et al., 2000) and found to encode the previously reported pbx4 gene (Vlachakis et al., 2000), suggesting a role for pbx genes also in vertebrate development. Vertebrate meis genes also likely play a role, as misexpression of Xenopus Meis3 leads to abnormalities of the AP axis (Salzberg et al., 1999).

Pbx and Meis form dimeric and trimeric complexes with Hox proteins in vitro and these complexes are thought to modulate Hox activity, primarily by conferring high-specificity DNA-binding (reviewed by Mann and Affolter, 1998). An in vivo role for such complexes is suggested by the effect of dominant negative forms of Hth in Drosophila (Jaw et al., 2000; Ryoo et al., 1999), by the finding that dimers (e.g. Chang et al., 1997; Knoepfler et al., 1997) and trimers (Ferretti et al., 2000; Shen et al., 1999) can be reconstituted in cell extracts and by the observation that Meis, Pbx and Hox binding sites are present in several Hox-dependent promoters (Ferretti et al., 2000; Jacobs et al., 1999; Pöpperl et al., 1995; Ryoo et al., 1999).

pbx4, meis3 and hoxb1b are co-expressed in the caudal hindbrain primordium of the zebrafish embryo and Pbx4, Meis3 and Hoxb1b form complexes in vitro (Vlachakis et al., 2000). Here we explore the role of these proteins during zebrafish development and test whether they need to interact to function in vivo. We find that Hoxb1b and Pbx4 act together to induce ectopic hoxb1a expression in rhombomere (r) 2. In marked contrast, Hoxb1b and Pbx4 together with Meis3 induce massive rostral expression of several hindbrain genes (hoxb1a, hoxb2, krox20 and valentino) and cause anterior truncations, apparently due to the transformation of rostral (forebrain and midbrain) fates to caudal (hindbrain) fates. This transformation is extensive enough that we observe excess Mauthner neurons (normally found in r4) anteriorly. These effects are dependent on Meis3 and Hoxb1b having intact Pbx interaction domains, suggesting that they interact with Pbx4 in vivo. Our results also indicate that Meis3 must interact with Pbx4 to access the nucleus. Since meis3, pbx4 and hoxb1b are co-expressed in the zebrafish hindbrain primordium during embryogenesis, our results are consistent with complexes containing combinations of Pbx4, Hoxb1b and Meis3 regulating normal hindbrain development.

Cloning

All genes used were derived from zebrafish, all expression constructs were in the pCS2+ vector and all constructs were verified by sequencing. Meis3, Pbx4, HA-Hoxb1b and MutMeis3 (carries two point mutations in the homeodomain, Q44μE and N51μA) have been described (Vlachakis et al., 2000, Sagerström et al, 2001). In

μhoxb1b, the N-terminal 146 amino acids (aa) were deleted by digesting pCS2+HAHoxb1b with SmaI/PstI and inserting oligonucleotide 5μ-TTCCCGGGGTAGGCTGCA-3μ. In BMNMeis3 the N-terminal 171 aa were replaced with the FRB (FKBP 12- rapamycin binding) domain from FRAP (FKBP 12-rapamycin associated protein) (Chen et al., 1995). Primers 5μ- TATATCTAGACTGCTTTGAGATTCGTCGGA-3μ and 5μ-GGATG- AATTCATGGACTATAAAGATGACGA-3μ amplified the FLAG- FRB domain which was subcloned via EcoRI and XbaI sites in the primers into pCS2+ (pCS2+FLAG-FRB). Primers 5μ-GGTCT- AGACGAGAGGGTGGATCTAAATCTGAC-3μ and 5μ-GGTCT- AGATCAGTGGGCATGTATGTCAAG-3μ amplified aa 172-415 of the Meis3 ORF from pCS2+meis3. This was subcloned via XbaI sites in the primers into pCS2+FLAG-FRB downstream of FRB. MYCFRBMeis3 was generated by subcloning an XhoI/NotI fragment from pCS2+FLAG-FRBMeis3 into pCS2+MT cut with XhoI/NotI. For Meis3-VP16 primers 5μ-AAAGATATCCCCACCGTAC- TCGTCAATTCC-3μ and 5μ-AAAGATATCTCGACGGCCCCCCC- GACCGATGTCAGC-3μ amplified the VP16 domain from pCS2+vp16N (Kessler, 1997). This was subcloned via EcoRV sites in the primers into the SmaI site (1092 bp in Meis3 ORF) of pCS2+meis3. All point mutations were generated with the QuikChange kit from Stratagene: BMHoxb1b (has a substitution in the pentapeptide FDWMK, W186μF) was generated using primer 5μ- GGGGGATTCCTCTTGACTTTCATAAAGTCAAAGGTTGGCGC- 3μ, BMM2Meis3 (has two substitutions in the M2 motif, L141μA and E142μA) using primer 5μ-CGGTTTCATCTATTAGAAGCAGC- AAAGGTTCATGACCTCTGTGATAATTTCTGCC-3μ, BMwM2Meis3 (has five substitutions in the M2 motif, I131μA, L134μA, L138μA, L141μA and E142μA) using primer 5μ-CTGATGATCCAGGCC- GCTCAAGTTGCACGGTTTCATGCATTAGAAGCAGC−3μ with BMM2Meis3 as a template and BMM1/2Meis3 (has four substitutions in the M1 motif, aa 64-67 KCELμNNSQ and two substitutions in the M2 motif, L141μA and E142μA) using primer 5μ- GGCTCTGGTATTTGAAAACAATTCACAGCCACTTGCTCACC- 3μ with BMM2Meis3 as a template. NLS BMM1/2Meis3 was generated by cloning oligonucleotide 5μ-GATCCCCCGGGATGGCTCC- AAAGAAGAAGCGTAAGGTAAA-3μ into BamHI/ClaI digested pCS2+MT BMM1/2Meis3.

RNA microinjections

mRNAs were synthesized from NotI-linearized pCS2+ derived plasmids, or (for lacZ) from XhoI-linearized pSP6-nucβ-gal, using the SP6 mMessage mMachine kit (Ambion) and purified with the RNeasy mini kit (Qiagen). For in situ analysis, 165 pg of each test mRNA was injected and the total amount adjusted to 500 pg by co-injecting lacZ mRNA. lacZ control injections were done with 500 pg mRNA. For western analysis and immunostaining, 300 pg mRNA was injected for Meis3 constructs and 450 pg for Hoxb1b constructs. Injections were at the 1- to 2-cell stage. β-gal staining was performed as described previously (Blader et al., 1997), except embryos were fixed for 40 minutes. For western analysis, lysates of 10 embryos (for Meis3 and HAHoxb1b constructs) or 3 embryos (for MYCMeis3 constructs) were run per lane.

In situ hybridization, immunostaining and immunoprecipitations

In situ hybridizations and immunoprecipitations have been described previously (Vlachakis et al., 2000). Immunostaining with 3A10, anti- c-myc (clone 9E10) and anti-HA (clone 12CA5) was done as described by Hatta (Hatta, 1992). HRP was detected using the TSA- direct kit (Dupont Biotechnology Systems). Photographs were taken with a Leica confocal or an Olympus inverted microscope. Rabbit polyclonal anti-Pbx4 antiserum was raised to a peptide containing the 13 C-terminal residues of Pbx4 and used at 1:1000 for western blots.

Fate mapping

Embryos were injected with hoxb1b+pbx4+meis3 mRNAs at the 1- to 2-cell stage. At early gastrula stage (6.5 hpf; hours postfertilization) animal pole cells of control and injected embryos were labeled with 1,1μ-diooctadecyl-3,3,3μ,3μ-tetramethylindocarbocyanine perchlorate (DiI) and fate mapping performed as described (Fekany-Lee et al., 2000) except embryos were fixed at 4- to 5-somite stages.

Hoxb1b requires an intact Pbx-interaction domain to induce hoxb1a expression in rhombomere 2

Misexpression of Hoxa1 in the mouse leads to ectopic Hoxb1 expression in r2 of the hindbrain (Zhang et al., 1994). To test if this is the case also for zebrafish, we expressed Hoxb1b (the zebrafish counterpart to murine Hoxa1; Alexandre et al., 1996; Amores et al., 1998) ectopically by mRNA microinjection (see Materials and Methods). Control injections with lacZ mRNA resulted in normal embryos (Fig. 1Aa,b; Table 1) while expression of Hoxb1b (Fig. 1Ac,d) resulted in ectopic expression of hoxb1a (the zebrafish counterpart to murine Hoxb1, normally expressed in r4; Amores et al., 1998; Prince et al., 1998) in r2 (52%; arrow in Fig. 1Ac), and largely normal expression of hoxb2 (Fig. 1Ad; normally expressed in r3-r5; Prince et al., 1998). This is consistent with a report demonstrating an ectopic pair of Mauthner neurons (normally found in r4) in r2 following hoxb1b misexpression in zebrafish (Alexandre et al., 1996).

Table 1.

Meis3 and Hoxb1b require intact Pbx-interaction domains for in vivo function

Meis3 and Hoxb1b require intact Pbx-interaction domains for in vivo function
Meis3 and Hoxb1b require intact Pbx-interaction domains for in vivo function
Fig. 1.

Hoxb1b and Meis3 require intact Pbx interaction domains to mediate ectopic Hox gene expression. (A) Embryos were injected with mRNAs as indicated to the left of each pair of panels and analyzed by in situ hybridization for expression of hoxb1a (left hand panels) or hoxb2 (right hand panels). Arrows in c and e indicate ectopic hoxb1a expression in r2. (B) Embryos were injected with mRNAs as indicated on the left, and scored for expression of hoxb1a (left hand panels) or hoxb2 (right hand panels). Asterisks indicate ectopic hoxb1a (e and g) and hoxb2 (f and h). (C) Embryos were injected with mRNAs as indicated to the left and scored for expression of hoxb1a (left hand panels) or hoxb2 (right hand panels). Asterisk in c and arrows in i, m, q and y indicate ectopic hoxb1a, while asterisk in d and arrows in j and n indicate ectopic hoxb2. Embryos are at the 5- (for hoxb2) or 10- (for hoxb1a) somite stage and are shown in dorsal views with anterior to the left.

Fig. 1.

Hoxb1b and Meis3 require intact Pbx interaction domains to mediate ectopic Hox gene expression. (A) Embryos were injected with mRNAs as indicated to the left of each pair of panels and analyzed by in situ hybridization for expression of hoxb1a (left hand panels) or hoxb2 (right hand panels). Arrows in c and e indicate ectopic hoxb1a expression in r2. (B) Embryos were injected with mRNAs as indicated on the left, and scored for expression of hoxb1a (left hand panels) or hoxb2 (right hand panels). Asterisks indicate ectopic hoxb1a (e and g) and hoxb2 (f and h). (C) Embryos were injected with mRNAs as indicated to the left and scored for expression of hoxb1a (left hand panels) or hoxb2 (right hand panels). Asterisk in c and arrows in i, m, q and y indicate ectopic hoxb1a, while asterisk in d and arrows in j and n indicate ectopic hoxb2. Embryos are at the 5- (for hoxb2) or 10- (for hoxb1a) somite stage and are shown in dorsal views with anterior to the left.

Adjacent Pbx and Hox binding sites are present in the murine Hoxb1 enhancer and both sites are required for expression in a transgenic model (Pöpperl et al., 1995), suggesting that Pbx and Hox proteins might interact to induce murine Hoxb1. Thus, to induce ectopic hoxb1a in zebrafish, Hoxb1b might interact with an endogenous Pbx protein. The most likely candidate is Pbx4, which is expressed broadly in the zebrafish embryo (Vlachakis et al., 2000) and is the predominant Pbx protein at this stage (Popperl et al., 2000). Expressing Pbx4 together with Hoxb1b did not have a significantly different effect than Hoxb1b alone (Fig. 1Ae,f; Table 1) and Pbx4 alone had no effect (not shown). To test if Hoxb1b interacts with Pbx4, we generated BMHoxb1b, a mutant form that is unable to bind Pbx4 (compare lanes 2 and 5 in Fig. 2A), by introducing a single amino acid substitution (W186μF) into the pentapeptide of Hoxb1b (see Materials and Methods). Analogous mutations abolish Pbx binding of other Hox proteins without altering their DNA binding (e.g. Knoepfler and Kamps, 1995; Rambaldi et al., 1994). BMHoxb1b is expressed at levels comparable to wild-type Hoxb1b following microinjection, as assayed by western blotting (compare lanes 2 and 3 in Fig. 2B) and immunohistochemistry (compare a and b in Fig. 2G). In contrast to wild-type Hoxb1b, BMHoxb1b expression led to essentially normal embryos (Fig. 1Ag,h; Table 1). This demonstrates that Hoxb1b requires an intact Pbx-interaction domain, suggesting that Hoxb1b and Pbx4 interact to activate hoxb1a expression in zebrafish r2. Since the Hoxb1 regulatory elements have been conserved from mouse to pufferfish (Pöpperl et al., 1995) such an interaction might be a general requirement for Hoxb1 induction.

Fig. 2.

Expression, Pbx4 interaction and subcellular distribution of Meis3 and Hoxb1b. (A) Pbx4 was expressed alone (lane 3) or together with HAHoxb1b (lanes 1 and 2), or HAμMHoxb1b (lanes 4 and 5) in vitro in the presence of [35S]methionine and either analyzed directly (input; lanes 1 and 4) or first immunoprecipitated with anti- HA antibody (lanes 2, 3, 5). All immunoprecipitations were performed in the presence of an oligonucleotide containing a Pbx/Hox binding site (P/H). (B) Western blot analysis (10 embryos/lane) of uninjected (lane 1), HAhoxb1b- (lane 2), HAbmhoxb1b- (lane 3), or HAμhoxb1b- (lane 4) injected embryos, probed with anti-HA. (C) Pbx4 was expressed alone (lane 4) or together with Meis3 (lanes 1-3), μMNMeis3 (lanes 5 and 6), Meis3VP16 (lanes 7 and 8), MYCMeis3 (lanes 9 and 10), MYCBMM2Meis3 (lanes 11 and 12), MYCBMwM2Meis3 (lanes 13 and 14) or MYCBMM1/2Meis3 (lanes 15 and 16) in vitro in the presence of [35S]methionine and either analyzed directly (input; lanes 1, 5, 7, 9, 11, 13, 15) or first immunoprecipitated with anti- Meis antisera (lanes 2, 4, 6, 8, 10, 12, 14, 16) or with preimmune sera (lane 3). Immunoprecipitations were performed in the presence of an oligonucleotide containing a Meis/Pbx binding site (M/P). (D) Meis3 (lanes 1 and 2), μeis3 (lanes 3 and 4), Meis-VP16 (lanes 5 and 6), MutMeis3 (lanes 7 and 8), MYCMeis3 (lanes 9 and 10), MYCBMM2Meis3 (lanes 11 and 12), MYCBMwM2Meis3 (lanes 13 and 14) or MYCBMM1/2Meis3 (lanes 15 and 16) were expressed in vitro and incubated with 32P-labeled oligonucleotide containing a Meis/Pbx binding site (M/P; lanes 1, 3, 5, 7, 9, 11, 13, 15) or a random sequence (R; lanes 2, 4, 6, 8, 10, 12, 14, 16). The samples were immunoprecipitated with anti-Meis antisera, resolved on a 5% acrylamide gel, and exposed to X-ray film to detect the presence of labeled oligonucleotides. (E) Western blot analysis (10 embryos/lane) of uninjected (lane 1), meis3- (lane 2), mutmeis3- (lane 3), bmNmeis3- (lane 4) or meis3vp16- (lane 5) injected embryos, or (3 embryos/lane) uninjected (lane 6), MYCmeis3- (lane 7), MYCbmM2meis3- (lane 8), MYCbmwM2meis3- (lane 9), MYCbmM1/2meis3- (lane 10), nlsMYCbmM1/2meis3- (lane 11), or MYCbmNmeis3- (lane 12) injected embryos, probed with anti-Meis antisera. (F) Western blot analysis of lysates of 10 uninjected embryos harvested at either 6 hpf (lane 1) or 14 hpf (lane 2) probed with anti-Meis antisera (top panel) or anti-Pbx antisera (bottom panel). (G) Embryos injected with HAhoxb1b (a), HAbmHoxb1b (b), HAμhoxb1b (c), MYCmeis3 (d,f), MYCmeis3+pbx4 (e), MYCbmM2meis3 (g), MYCbmM2meis3+pbx4 (h), MYCbmwM2meis3 (i), MYCbmwM2meis+pbx4 (j), MYCbmM1/2meis3 (k), MYCbmM1/2meis3+pbx4 (l), nlsMYCbmM1/2meis3 (m), MYCbmNmeis3 (n), or MYCbmNmeis3+pbx4 (o) mRNAs, were fixed at 5 hpf (a-e and g-o) or 13 hpf (f) and immunostained with anti-HA (a-c) or anti-MYC (d-o).

Fig. 2.

Expression, Pbx4 interaction and subcellular distribution of Meis3 and Hoxb1b. (A) Pbx4 was expressed alone (lane 3) or together with HAHoxb1b (lanes 1 and 2), or HAμMHoxb1b (lanes 4 and 5) in vitro in the presence of [35S]methionine and either analyzed directly (input; lanes 1 and 4) or first immunoprecipitated with anti- HA antibody (lanes 2, 3, 5). All immunoprecipitations were performed in the presence of an oligonucleotide containing a Pbx/Hox binding site (P/H). (B) Western blot analysis (10 embryos/lane) of uninjected (lane 1), HAhoxb1b- (lane 2), HAbmhoxb1b- (lane 3), or HAμhoxb1b- (lane 4) injected embryos, probed with anti-HA. (C) Pbx4 was expressed alone (lane 4) or together with Meis3 (lanes 1-3), μMNMeis3 (lanes 5 and 6), Meis3VP16 (lanes 7 and 8), MYCMeis3 (lanes 9 and 10), MYCBMM2Meis3 (lanes 11 and 12), MYCBMwM2Meis3 (lanes 13 and 14) or MYCBMM1/2Meis3 (lanes 15 and 16) in vitro in the presence of [35S]methionine and either analyzed directly (input; lanes 1, 5, 7, 9, 11, 13, 15) or first immunoprecipitated with anti- Meis antisera (lanes 2, 4, 6, 8, 10, 12, 14, 16) or with preimmune sera (lane 3). Immunoprecipitations were performed in the presence of an oligonucleotide containing a Meis/Pbx binding site (M/P). (D) Meis3 (lanes 1 and 2), μeis3 (lanes 3 and 4), Meis-VP16 (lanes 5 and 6), MutMeis3 (lanes 7 and 8), MYCMeis3 (lanes 9 and 10), MYCBMM2Meis3 (lanes 11 and 12), MYCBMwM2Meis3 (lanes 13 and 14) or MYCBMM1/2Meis3 (lanes 15 and 16) were expressed in vitro and incubated with 32P-labeled oligonucleotide containing a Meis/Pbx binding site (M/P; lanes 1, 3, 5, 7, 9, 11, 13, 15) or a random sequence (R; lanes 2, 4, 6, 8, 10, 12, 14, 16). The samples were immunoprecipitated with anti-Meis antisera, resolved on a 5% acrylamide gel, and exposed to X-ray film to detect the presence of labeled oligonucleotides. (E) Western blot analysis (10 embryos/lane) of uninjected (lane 1), meis3- (lane 2), mutmeis3- (lane 3), bmNmeis3- (lane 4) or meis3vp16- (lane 5) injected embryos, or (3 embryos/lane) uninjected (lane 6), MYCmeis3- (lane 7), MYCbmM2meis3- (lane 8), MYCbmwM2meis3- (lane 9), MYCbmM1/2meis3- (lane 10), nlsMYCbmM1/2meis3- (lane 11), or MYCbmNmeis3- (lane 12) injected embryos, probed with anti-Meis antisera. (F) Western blot analysis of lysates of 10 uninjected embryos harvested at either 6 hpf (lane 1) or 14 hpf (lane 2) probed with anti-Meis antisera (top panel) or anti-Pbx antisera (bottom panel). (G) Embryos injected with HAhoxb1b (a), HAbmHoxb1b (b), HAμhoxb1b (c), MYCmeis3 (d,f), MYCmeis3+pbx4 (e), MYCbmM2meis3 (g), MYCbmM2meis3+pbx4 (h), MYCbmwM2meis3 (i), MYCbmwM2meis+pbx4 (j), MYCbmM1/2meis3 (k), MYCbmM1/2meis3+pbx4 (l), nlsMYCbmM1/2meis3 (m), MYCbmNmeis3 (n), or MYCbmNmeis3+pbx4 (o) mRNAs, were fixed at 5 hpf (a-e and g-o) or 13 hpf (f) and immunostained with anti-HA (a-c) or anti-MYC (d-o).

Meis3 synergizes with Hoxb1b and Pbx4 to induce expression of both hoxb1a and hoxb2

To test the role of Meis3, we co-expressed it with various combinations of Pbx4 and Hoxb1b. Meis3 alone and Meis3+Pbx4 had minimal effect (∼90% normal; not shown and Fig. 1Bc,d; Table 1). In contrast, Hoxb1b+Meis3 and Hoxb1b+Pbx4+Meis3 resulted in massive ectopic expression of hoxb1a (Fig. 1Be,g) and hoxb2 (Fig. 1Bf,h), anterior to their normal expression domains (asterisks in Fig. 1Be-h). These phenotypes are distinct from those obtained with Hoxb1b alone or Hoxb1b+Pbx4 (Fig. 1Ac-f) and we have classified them into two groups (Table 1). The least affected embryos exhibit ectopic expression of hoxb1a and hoxb2 (approx. 30%; Table 1; example in Fig. 1Be) and the most severely affected embryos exhibit ectopic expression together with an anterior truncation (e.g. Fig. 1Bg; approx. 10% for Hoxb1b+Meis3 and approx. 39% for Hoxb1b+Pbx4+Meis3; Table 1). These data demonstrate that Meis3 synergizes with Pbx4 and Hoxb1b and that endogenous Pbx4 may be limiting for this effect.

Meis3 and Hoxb1b require intact Pbx-interaction domains to mediate the synergistic effect

Meis3 and Hoxb1b cannot interact with each other, but both bind Pbx4 (Vlachakis et al., 2000), raising the possibility that they interact with Pbx4 in vivo. In contrast to co-expression of the three wild-type proteins (∼70% affected embryos, Fig. 1Cc,d; Table 1), expression of BMHoxb1b along with Pbx4 and Meis3 led to largely normal expression of hoxb1a and hoxb2 (approx. 10% affected; Fig. 1Ce,f), similar to the effect of expressing Meis3 and Pbx4 in the absence of Hoxb1b (Fig. 1Bc,d; Table 1). This suggests that Hoxb1b must interact with Pbx4 to mediate the synergistic effect in vivo.

We next generated forms of Meis3 with reduced Pbx4 binding activity (BMMeis3 mutants, see Materials and Methods) by mutating two Meis N-terminal domains (M1 and M2) thought to mediate Pbx binding (reviewed by Mann and Affolter, 1998). Since Meis-Pbx binding is not completely characterized and mutating M1 or M2 alone may not eliminate all Pbx-binding (Jaw et al., 2000; Knoepfler et al., 1997), we generated several constructs based on a previous report (Knoepfler et al., 1997). BMM2Meis3 carries two amino acid substitutions in M2, BMwM2Meis3 has 5 amino acid substitutions in M2, BMM1/2Meis3 has the same substitution as BMM2Meis3 plus a four amino acid substitution in M1 and BMNMeis3 has had its N terminus replaced by a protein interaction domain from the unrelated FRAP protein. Each of these proteins does not bind Pbx4 in vitro (Fig. 2C), but still binds DNA (Fig. 2D) and is expressed at similar levels to wild-type Meis3 following microinjection (as assayed by western blotting in Fig. 2E and immunohistochemistry in Fig. 2G). Expression of the BMMeis3 mutants alone had no effect (Fig. 1C; Table 1). Following co-expression with Pbx4 and Hoxb1b, BMM2Meis3 was slightly less active (Fig. 1Ci,j; Table 1) than wild-type Meis3 (Fig. 1Cc,d). In contrast, the activity of BMwM2Meis3 was largely abolished, as illustrated by a pronounced reduction both in frequency (approx. 7% embryos with truncations vs. 39% for wild-type Meis3) and extent (Fig. 1Cm,n compare with c and d) of ectopic expression. BMM1/2Meis3 (Fig. 1Cq,r) and BMNMeis3 (Fig. 1Cu,v) were essentially inactive when co-expressed with Pbx4 and Hoxb1b and gave similar results to embryos injected with Hoxb1b and Pbx4 in the absence of Meis3 (Table 1). Our results therefore indicate that it is necessary to mutate both the M1 and M2 domains to abolish all Meis3 activity in vivo. Since these domains are reported to bind Pbx (reviewed in Mann and Affolter, 1998), this suggests that Meis3 must bind Pbx4 to synergize with Pbx4 and Hoxb1b in vivo. Our results also suggest that BMM2Meis3 retains the ability to bind Pbx4 in vivo, although we can not detect this by co- immunoprecipitation in vitro. This is supported by our finding that BMM2Meis3 accesses the nucleus in a Pbx4-dependent manner (see below). Furthermore, a previous report demonstrated that mutating either the M1 or M2 domain of Hth does not completely eliminate Exd binding or activity in vivo, while mutating both domains does abolish activity (Jaw et al., 2000). Our results therefore indicate that both Hoxb1b and Meis3 require intact Pbx-interaction domains to mediate their synergistic effects, suggesting that they interact with Pbx4 in vivo

Meis3, but not Hoxb1b, requires an intact Pbx- interaction domain for nuclear access

Our results indicate that both Hoxb1b and Meis3 require intact Pbx interaction domains to function in vivo, but the reason for this is not clear. In particular, Meis and Hox proteins may interact with Pbx not only to assemble a transcription regulatory complex in the nucleus, but also to access the nucleus. Although nuclear access of Exd is regulated in Drosophila embryos (Abu-Shaar et al., 1999; Jaw et al., 2000; Pai et al., 1998; Rieckhof et al., 1997), Pbx4 is nuclear throughout zebrafish embryos (Popperl et al., 2000). Many Hox proteins contain a nuclear localization signal (NLS; e.g Harvey et al., 1986) so Hoxb1b would be predicted to be nuclear in zebrafish embryos. Hth also appears to have a NLS, but is unstable in Drosophila embryos in the absence of Exd (Abu-Shaar et al., 1999; Jaw et al., 2000). To test the distribution of Hoxb1b and Meis3 in zebrafish cells, we injected mRNA of various Meis3 and Hoxb1b constructs and assessed their subcellular distribution by immunohistochemistry. We find that Hoxb1b and BMHoxb1b are nuclearly localized (Fig. 2Ga,b), indicating that Hoxb1b need not interact with Pbx4 to access the nucleus. In contrast, following micro-injection Meis3 is cytoplasmic in late blastula stage zebrafish embryos (Fig. 2Gd), but becomes primarily nuclear by early somitogenesis stages (Fig. 2Gf). This redistribution of Meis3 protein correlates with an increase in Pbx4 protein levels that takes place during normal development (Fig. 2F) and is therefore consistent with Meis3 requiring Pbx4 to access the nucleus. To test this directly, we co-expressed Meis3 and Pbx4 and found that in the presence of Pbx4, Meis3 is predominantly nuclear even at late blastula stages (Fig. 2Ge). This observation also provides an explanation for the finding that endogenous Pbx4 is limiting for the synergistic effect in Fig. 1B. BMwM2Meis3 (Fig. 2Ci,j), BMM1/2Meis3 (Fig. 2Ck,l) and BMNMeis3 (Fig. 2Cn,o) remain primarily cytoplasmic even in the presence of Pbx4, consistent with their having little or no functional activity in vivo. BMM2Meis3 however is cytoplasmic in the absence and nuclear in the presence of Pbx4 (Fig. 2Cg,h). These results indicate that wild-type Meis3 needs to interact with Pbx4 in order to access the nucleus and are consistent with the BMM2Meis3 mutant having residual Pbx4 binding activity. These results are also consistent with a report demonstrating that Prep1 requires Pbx1 to access the nucleus in mammalian tissue culture cells (Berthelsen et al., 1999).

Notably, the nuclear localization of the various Meis3 constructs in response to Pbx4 correlates with their in vivo activity as assayed in Fig. 1. If Meis3 requires Pbx4 to enter the nucleus it may or may not require Pbx4 also to function in the nucleus. To explore this we co-expressed Pbx4 and Hoxb1b with NLSBMM1/2Meis3 (see Materials and Methods). NLSBMM1/2Meis3 can access the nucleus independently of Pbx4 (Fig. 2Gm) and is expressed at similar levels to wild-type Meis3 following microinjection (Fig, 2E). We find that co- expression of NLSBMM1/2Meis3 with Pbx4 and Hoxb1b has the same effect as Pbx4+Hoxb1b alone (Fig. 1Cy,z: Table 1), demonstrating that Meis3 also requires an intact Pbx- interaction domain to function in the nucleus.

Taken together with the results in Fig. 1, these results indicate that Hoxb1b interacts with Pbx4 in the nucleus, that Meis3 interacts with Pbx4 both in the cytoplasm and the nucleus, and that these interactions are all required for Hoxb1b and Meis3 function.

The synergistic effect of Pbx4, Hoxb1b and Meis3 is mediated at the level of transcriptional activation

Consistent with their localization to the nucleus, homeodomain protein complexes are predicted to function as transcriptional regulators (reviewed by Mann and Affolter, 1998). Several Hox proteins contain transcription activation domains at their N termini (Di Rocco et al., 1997; Rambaldi et al., 1994), but Meis (or Prep1) proteins do not appear to contain regulatory domains (Berthelsen et al., 1998; Jacobs et al., 1999) and Pbx4 belongs to a Pbx class (Vlachakis et al., 2000) that lacks the C-terminal regulatory domain (Asahara et al., 1999; Di Rocco et al., 1997). Hoxb1b may therefore mediate transcriptional activation in our experiments. It has been previously demonstrated (Di Rocco et al., 1997) that deleting the N terminus significantly reduces transcriptional activation by murine Hoxb1 without affecting binding to Pbx or DNA and we have generated the analogous deletion in zebrafish Hoxb1b μHoxb1b; see Materials and Methods). μHoxb1b still localizes to the nucleus (Fig. 2Gc) and is expressed at levels similar to wild-type Hoxb1b following microinjection (compare lanes 2 and 4 in Fig. 2B). Expression of μHoxb1b by itself led to fewer embryos with ectopic hoxb1a (18%; Table 2) than did expression of wild-type Hoxb1b (52%, Table 1) and the extent of ectopic gene expression in the affected embryos was significantly reduced (compare Fig. 3e,f with Fig. 1Ac,d). Similarly, co-expression of μHoxb1b with Pbx4 and Meis3 (Fig. 3g,h) led to less extensive ectopic gene expression than co-expression of the three wild-type proteins (Fig. 3c,d) and a reduction in the frequency of affected embryos. In particular, the most severely affected embryos were reduced from approx. 39% to approx. 8% (Table 1 and 2). This demonstrates that the N terminus of Hoxb1b is required for full activity in vivo.

Table 2.

The effect of Hoxb1b, Pbx4 and Meis3 co-expression is mediated by transcriptional activation

The effect of Hoxb1b, Pbx4 and Meis3 co-expression is mediated by transcriptional activation
The effect of Hoxb1b, Pbx4 and Meis3 co-expression is mediated by transcriptional activation
Fig. 3.

The effect of Hoxb1b, Pbx4 and Meis3 co-expression is mediated at the level of transcriptional activation.Embryos were injected with mRNAs as indicated to the left and analyzed for expression of hoxb1a (left hand panels) or hoxb2 (right hand panels). Asterisks indicate ectopic hoxb1a (c,i,k,o) and hoxb2 (d,j,l,p) expression. Arrows point to small patches of ectopic hoxb1a (g) and hoxb2 (h). Embryos are at the 5- (for hoxb2) or 10- (for hoxb1a) somite stage and are shown in dorsal views with anterior to the left.

Fig. 3.

The effect of Hoxb1b, Pbx4 and Meis3 co-expression is mediated at the level of transcriptional activation.Embryos were injected with mRNAs as indicated to the left and analyzed for expression of hoxb1a (left hand panels) or hoxb2 (right hand panels). Asterisks indicate ectopic hoxb1a (c,i,k,o) and hoxb2 (d,j,l,p) expression. Arrows point to small patches of ectopic hoxb1a (g) and hoxb2 (h). Embryos are at the 5- (for hoxb2) or 10- (for hoxb1a) somite stage and are shown in dorsal views with anterior to the left.

We next generated a fusion protein where the VP16 activation domain is inserted into Meis3 (Meis3VP16; see Materials and Methods). Meis3VP16 still interacts with Pbx4 (compare lanes 2 and 8 in Fig. 2C), binds DNA, albeit somewhat less efficiently than wild-type Meis3 (compare lanes 1 and 5 in Fig. 2D) and is expressed at levels comparable to wild-type Meis3 following microinjection (compare lanes 2 and 5 in Fig. 2E). When Meis3VP16 and Pbx4 were co- expressed, we observed the same effects on hoxb1a and hoxb2 expression (asterisks in Fig. 3i,j, respectively) as on co- expression of the three wild-type proteins, and at a similar frequency (70-80% affected; Table 1 and 2). This result demonstrates that Hoxb1b can be functionally replaced by an exogenous activation domain. Taken together these results are consistent with Hoxb1b containing a transactivation domain and the synergistic effect of Meis3, Pbx4 and Hoxb1b being mediated by transcriptional activation. In agreement with this, co-injecting Meis3VP16 along with Pbx4 and wild- type Hoxb1b gave essentially the same phenotype as Meis3VP16+Pbx4 (Fig. 3k,l; Table 2), although at a higher frequency.

To further examine how Meis3, Pbx4 and Hoxb1b function to activate transcription we next tested whether Meis3 needs to bind DNA in order to synergize with Pbx4 and Hoxb1b. To this end we made use of a mutant Meis3 (MutMeis3; see Materials and Methods), that cannot bind DNA (Fig. 2D, lane 1 versus 5), but still interacts with Pbx4 (Vlachakis et al., 2000) and is expressed at similar levels to wild-type Meis3 following microinjection (compare lanes 2 and 3 of Fig. 2E). Expression of MutMeis3 by itself had no effect (Fig. 3m,n; Table 2). Expression of Hoxb1b+Pbx4+MutMeis3 resulted in embryos showing ectopic expression of hoxb1a (53%, Table 2; asterisk in Fig. 3o) and hoxb2 (37%, Table 2; asterisk in Fig. 3p), and the frequency of the most severely affected embryos was lower (∼4%; Table 2) than for the three wild-type proteins (∼39%; Table 1). However, the effect of MutMeis3 is higher than that of BMM1/2Meis3 or BMNMeis3 co-expressed with Pbx4 and Hoxb1b, indicating that MutMeis3 retains some in vivo activity. While this could be due to MutMeis3 binding DNA weakly in vivo, we think this unlikely since MutMeis3 does not bind DNA in vitro. Instead, this result may suggest that DNA-binding is not absolutely required for Meis3 to synergize with Pbx4 and Hoxb1b in vivo. This would be consistent with experiments indicating that Meis and Prep1 can participate as non-DNA binding partners in trimeric complexes with Hox and Pbx (Berthelsen et al., 1998; Shanmugam et al., 1999; Vlachakis et al., 2000).

Co-expression of Hoxb1b, Pbx4 and Meis3 induces ectopic expression of the non-hox genes krox20 and valentino

To explore the effects of Hoxb1b, Pbx4 and Meis3 in more detail we analyzed two non-hox genes normally expressed in the hindbrain, krox20 (expressed in r3 and r5; Oxtoby and Jowett, 1993) and valentino (expressed in r5 and r6; Moens et al., 1998). Co-expression of Hoxb1b+Pbx4 (Fig. 4Ac), or Meis3+Pbx4 (Fig. 4Ae) had little effect on krox20 expression (approx. 90% normal embryos; Table 1), but co-expression of Hoxb1b+Pbx4+Meis3 resulted in massive ectopic expression of krox20 (71%, Table 1; asterisk in Fig. 4Ag) anterior to its normal expression domain. This was dependent on functional Pbx interaction domains of Hoxb1b and Meis3 as expression of Hoxb1b+Pbx4+BMNMeis3 (Fig. 4Ad) or BMHoxb1b+Pbx4+Meis3 (Fig. 4Af) resulted in normal embryos (∼90%; Table 1). Hoxb1b+Pbx4+MutMeis3 resulted in ectopic krox20 expression anteriorly (47%; Table 2; asterisk in Fig. 4Ab) as did Hoxb1b+Pbx4+Meis3VP16 (not shown; 95% Table 2) and Meis3VP16+Pbx4 (Fig. 4Ah; 84% Table 2). Analysis of valentino revealed that this gene was also induced ectopically (64%, Table 1; asterisk in figure 3Bh) by co- expression of Hoxb1b, Pbx4 and Meis3. Thus, co-expression of Hoxb1b, Pbx4 and Meis3 induces the expression of two non-hox hindbrain genes and krox20 induction is regulated similarly to hoxb2 induction.

Fig. 4.

Hoxb1b, Pbx4 and Meis3 co-expression causes ectopic expression of hindbrain genes at the expense of anterior, but not posterior gene expression. (A) Embryos were injected with mRNAs as indicated to the side of each panel and analyzed by in situ hybridization by double labeling (a and c) for krox20 (red) and no tail (purple), or by single labeling (b,d,e,f,g,h) for krox20. Asterisks indicate ectopic krox20 expression in b, g and h. All embryos are at 9- to 12-somite stages and are shown in dorsal views with anterior to the left. (B) Embryos were injected with lacZ (a,c,e,g,i,k) or hoxb1b+pbx4+meis3 (b,d,f,h,j,l) mRNAs and analyzed for expression of otx2 (a,b), myoD (c,d), krox20 and myoD (both in purple; e,f), valentino and no tail (both in purple; g,h), hoxb2 and no tail (both in purple; i,j) or by triple labeling (k,l) for otx2 (in purple), krox20 (in red) and no tail (in purple). Arrows indicate diminished otx2 expression (b and l); normal krox20 expression in r3 and r5 (e); normal valentino expression in r5 and r6 (g); normal hoxb2 expression in r3 (i); normal otx2 expression in forebrain and midbrain (k). Arrowheads indicate no tail expression (g-l). Double arrowheads indicate ectopic no tail expression (l). Asterisks indicate displacement of somites (d), ectopic krox20 (f and l), valentino (h) or hoxb2 (j) expression. All embryos are at the 9- to 12-somite stages and are shown in dorsal views with anterior to the left. (C) Embryos were injected with hoxb1b+meis3 along with lacZ mRNA and stained for lacZ (light blue) and krox20 expression (purple). Embryos are at the 10-somite stage and are shown in lateral views with anterior to the left and dorsal up. Arrow in b indicates ectopic krox20 expression.

Fig. 4.

Hoxb1b, Pbx4 and Meis3 co-expression causes ectopic expression of hindbrain genes at the expense of anterior, but not posterior gene expression. (A) Embryos were injected with mRNAs as indicated to the side of each panel and analyzed by in situ hybridization by double labeling (a and c) for krox20 (red) and no tail (purple), or by single labeling (b,d,e,f,g,h) for krox20. Asterisks indicate ectopic krox20 expression in b, g and h. All embryos are at 9- to 12-somite stages and are shown in dorsal views with anterior to the left. (B) Embryos were injected with lacZ (a,c,e,g,i,k) or hoxb1b+pbx4+meis3 (b,d,f,h,j,l) mRNAs and analyzed for expression of otx2 (a,b), myoD (c,d), krox20 and myoD (both in purple; e,f), valentino and no tail (both in purple; g,h), hoxb2 and no tail (both in purple; i,j) or by triple labeling (k,l) for otx2 (in purple), krox20 (in red) and no tail (in purple). Arrows indicate diminished otx2 expression (b and l); normal krox20 expression in r3 and r5 (e); normal valentino expression in r5 and r6 (g); normal hoxb2 expression in r3 (i); normal otx2 expression in forebrain and midbrain (k). Arrowheads indicate no tail expression (g-l). Double arrowheads indicate ectopic no tail expression (l). Asterisks indicate displacement of somites (d), ectopic krox20 (f and l), valentino (h) or hoxb2 (j) expression. All embryos are at the 9- to 12-somite stages and are shown in dorsal views with anterior to the left. (C) Embryos were injected with hoxb1b+meis3 along with lacZ mRNA and stained for lacZ (light blue) and krox20 expression (purple). Embryos are at the 10-somite stage and are shown in lateral views with anterior to the left and dorsal up. Arrow in b indicates ectopic krox20 expression.

Co-expression of Hoxb1b, Pbx4 and Meis3 causes ectopic expression of hindbrain genes at the expense of anterior, but not posterior gene expression

Since co-expression of Hoxb1b, Pbx4 and Meis3 induces expression of hindbrain genes rostrally, we explored the effect on anterior gene expression. We found that expression of otx2 (normally expressed in forebrain and midbrain regions; Li et al., 1994; Mori et al., 1994) was reduced in 66% (84/128) of hoxb1b+pbx4+meis3-injected embryos (Fig. 4Bb) and in 41% (22/53) of hoxb1b+meis3-injected embryos (not shown). These numbers correlate well with the number of embryos exhibiting hindbrain gene expression anteriorly (67% and 49%, respectively; Table 1). Injections with lacZ mRNA resulted in embryos with normal otx2 expression (100%; 58/58; Fig. 4Aa). To confirm that the reduction in otx2 expression coincides with the expression of hindbrain markers anteriorly, we performed triple in situ hybridizations for otx2, krox20 and no tail (Fig. 4Bl). We find that otx2 expression (purple stain, indicated by black arrow in Fig. 4Bl) is reduced and krox20 expression (red stain, indicated by white asterisk in Fig. 4Bl) is expanded compared to lacZ-injected embryos (Fig. 4Bk), suggesting that expansion of hindbrain gene expression anteriorly is accompanied by a reduction in the expression domains of anterior genes.

Co-expression of Hoxb1b, Pbx4 and Meis3 also leads to posterior defects in some embryos (e.g. Fig. 1Bg). To explore this we analyzed expression of myoD (expressed in somites; Weinberg et al., 1996) and no tail (ntl; expressed in notochord; Schulte-Merker et al., 1994). lacZ-injected embryos had normal somites (Fig. 4B, panels c and e) and notochords (arrowheads in Fig. 4Bg,i,k). Co-expression of Hoxb1b, Pbx4 and Meis3 resulted in the majority of the embryos (∼85%; 210/248; Fig. 4Bd,f) having somites of normal appearance, although in approximately one third of these the rows of somites were slightly displaced (e.g. asterisk in Fig. 4Bd). The remaining 15% had malformed somites or were missing some somites, but ectopic myoD expression was never observed. 67% (148/223) of hoxb1b+pbx4+meis3-injected embryos also had normal notochords (Fig. 4Bh) and the remaining 33% had ectopic no tail staining (double arrowheads in Fig. 4Bl) that occasionally formed a second notochord (arrowheads in Fig. 4Bj).

To ensure that Hoxb1b, Pbx4 and Meis3 co-expression did not have a more profound effect anteriorly because of uneven distribution of injected RNAs, we introduced lacZ mRNA as a lineage label together with meis3 and hoxb1b mRNA, and detected β-galactosidase protein by its enzymatic activity. As expected, we found that the distribution of β-galactosidase varied between embryos, likely explaining the variability in phenotypes reported in Tables 1 and 2, but that there was no bias in distribution towards the anterior end of the embryo (e.g. Fig. 4Ca shows an embryo with strong β-galactosidase expression posteriorly). Furthermore, ectopic expression of hindbrain genes was accompanied by β-galactosidase expression (arrow in Fig. 4Bb points to ectopic krox20 expression (purple) overlapping with β-galactosidase staining (light blue)) confirming that Hoxb1b, Pbx4 and Meis3 mediate their effects at their site of expression.

Thus, we conclude that co-expression of Hoxb1b, Pbx4 and Meis3 has more profound effects anteriorly than posteriorly. This is phenotypically similar to the outcome of homeotic mutations and suggests that ectopic expression of these proteins may mediate a posterior transformation of anterior structures.

Co- expression of Hoxb1b, Pbx4 and Meis3 causes an anterior (forebrain and midbrain) to posterior (hindbrain) transformation of cell fate

To determine if co-expression of Hoxb1b, Pbx4 and Meis3 mediates the transformation of anterior cell fates to posterior ones, we performed fate mapping of prospective forebrain/midbrain cells in control and hoxb1b+pbx4+meis3-injected embryos. Embryos were labeled with lipophilic dye (DiI) at the animal pole (the site of prospective forebrain and midbrain precursors at this stage; Kimmel et al., 1990; Woo and Fraser, 1995) at early gastrula stages (6.5 hpf; Fig. 5A). Embryos where the injected DiI was localized at the animal pole 2 hours after labeling, as shown in Fig. 5B, were allowed to develop to the 4- to 5-somite stage, fixed, photoconverted and analyzed by whole-mount in situ hybridization for expression of krox20. In control embryos (Fig. 5C; arrow in a and b) labeled cells were present in their very rostral domain only. This domain represents the forebrain and midbrain, as illustrated by a gap between DiI-positive cells (red) and krox20 expression (purple). Embryos injected with hoxb1b+pbx4+meis3 also exhibited DiI- positive cells rostrally, but these cells also expressed ectopic krox20 (arrows in Fig. 5Cc-h). Thus, cells that normally give rise to forebrain and midbrain acquire a posterior (hindbrain) fate following ectopic expression of Hoxb1b, Pbx4 and Meis3, demonstrating that expression of these proteins can mediate posterior transformations of cell fates.

Fig. 5.

Hoxb1b, Pbx4 and Meis3 co-expression causes an anterior (forebrain and midbrain) to posterior (hindbrain) transformation of cell fate. (A) Schematic outline of fate mapping experiment. Embryos were labeled with lipophilic dye (DiI) at the animal pole at early gastrula stage (approx. 6.5 hpf). (B) Picture of an embryo 2 hours after labeling showing DiI only at the animal pole. (C) DiI-labeled uninjected (a,b) and hoxb1b+pbx4+meis3-injected (c-h) embryos were fixed at the 4- to 5-somite stages, photoconverted and analyzed by in situ hybridization for expression of krox20 (purple staining in a-h). Arrows point to DiI- labeled cells (reddish brown). Embryos are shown in dorsal views with anterior to the left. b,d,f and h (40x objective) show parts of a,c,e and g (20x objective).

Fig. 5.

Hoxb1b, Pbx4 and Meis3 co-expression causes an anterior (forebrain and midbrain) to posterior (hindbrain) transformation of cell fate. (A) Schematic outline of fate mapping experiment. Embryos were labeled with lipophilic dye (DiI) at the animal pole at early gastrula stage (approx. 6.5 hpf). (B) Picture of an embryo 2 hours after labeling showing DiI only at the animal pole. (C) DiI-labeled uninjected (a,b) and hoxb1b+pbx4+meis3-injected (c-h) embryos were fixed at the 4- to 5-somite stages, photoconverted and analyzed by in situ hybridization for expression of krox20 (purple staining in a-h). Arrows point to DiI- labeled cells (reddish brown). Embryos are shown in dorsal views with anterior to the left. b,d,f and h (40x objective) show parts of a,c,e and g (20x objective).

Co-expression of Hoxb1b, Pbx4 and Meis3 mediates formation of ectopic Mauthner neurons

In order to explore the extent to which differentiation of hindbrain fates was induced rostrally by co-expression of Hoxb1b, Pbx4 and Meis3, we examined formation of the Mauthner neurons (a segment-specific, bilateral set of neurons found in r4) in control and affected embryos. In Fig. 6 we used 3A10 antibody that specifically stains Mauthner neurons at 24-26 hpf (Hatta, 1992). Control embryos revealed a single pair of Mauthner neurons (arrows in Fig. 6a) displaying characteristic contralateral axonal projections (arrrowheads in Fig. 6a). In contrast, hoxb1b+pbx4+meis3-injected embryos displayed large numbers (at least up to 7) of Mauthner neurons and their axonal projections (individual Mauthner neurons are indicated by arrows of different sizes and colors and their axonal projections by arrowheads, in Fig. 6b and c). Cell bodies and axons were identified and traced by analyzing 20-30 confocal sections for each sample, but each panel in Fig. 6 only shows an image reconstruction for each sample. The background staining is due largely to melanocytes that were difficult to remove because of the stage and abnormal development of the injected embryos.

Fig. 6.

Hoxb1b, Pbx4 and Meis3 co-expression induces ectopic Mauthner neurons. Embryos were injected with hoxb1b/pbx4/meis3 (b,c) mRNAs and stained along with uninjected embryos (a) with 3A10 antibody to reveal Mauthner neurons. Arrows and arrowheads of the same size and color point to cell body and axons, respectively, of the same Mauthner neuron. Asterisks in b indicate axons of neurons whose cell bodies are not distinguishable. All panels are image reconstructions of confocal images and axons were assigned to ectopic Mauthner neurons by analyzing separate images of each stack.

Fig. 6.

Hoxb1b, Pbx4 and Meis3 co-expression induces ectopic Mauthner neurons. Embryos were injected with hoxb1b/pbx4/meis3 (b,c) mRNAs and stained along with uninjected embryos (a) with 3A10 antibody to reveal Mauthner neurons. Arrows and arrowheads of the same size and color point to cell body and axons, respectively, of the same Mauthner neuron. Asterisks in b indicate axons of neurons whose cell bodies are not distinguishable. All panels are image reconstructions of confocal images and axons were assigned to ectopic Mauthner neurons by analyzing separate images of each stack.

These data reveal that in addition to mediating ectopic expression of hindbrain genes, co-expression of Hoxb1b, Pbx4 and Meis3 can initiate the differentiation of r4-specific neurons rostrally. Ectopic expression of Hoxb1b alone has been shown to induce an extra pair of Mauthner neurons in r2 (Alexandre et al., 1996), but co-expression of Hoxb1b, Pbx4 and Meis3 appears to be more potent in this capacity, since we observe at least 7 ectopic Mauthner neurons rostrally.

Several reports have demonstrated that Hox, Pbx and Meis binding sites in enhancers of Hox-dependent genes are required for expression (Ferretti et al., 2000; Jacobs et al., 1999; Ryoo et al., 1999). Since Meis, Pbx and Hox can form complexes in vitro (Berthelsen et al., 1998; Ferretti et al., 2000; Jacobs et al., 1999; Ryoo et al., 1999; Vlachakis et al., 2000) and such complexes can be isolated from cell extracts (Ferretti et al., 2000; Shen et al., 1999), it is possible that these proteins function as complexes in vivo. To date, complex formation as a requirement for in vivo function is best supported by over- expression of the Hth N terminus in Drosophila, where it interferes with the function of endogenous Hth, likely by preventing Hth and Exd from interacting (Ryoo et al., 1999). Here we demonstrate that both Hoxb1b and Meis3 require intact Pbx interaction domains for the expression of Hox- dependent genes in the zebrafish, indicating that Hoxb1b and Meis3 need to form complexes with Pbx4 to function in vivo.

What type of complexes do Hoxb1b, Pbx4 and Meis3 form in vivo?

Notably, our experiments do not indicate the composition of Hoxb1b-, Pbx4- and Meis3-containing complexes, and several issues remain to be resolved. First, it is not clear if all complexes contain a Meis family member. We demonstrate that ectopic expression of Hoxb1b by itself induces hoxb1a expression in r2. To perform this function, Hoxb1b needs to interact with an endogenous Pbx protein (most likely Pbx4 as this is the predominant Pbx protein at this stage; Popperl et al., 2000), but does not require exogenous Meis3. While this is consistent with Hoxb1b and Pbx4 acting in the absence of a Meis protein, it leaves open the possibility that an endogenous Meis protein is involved. Indeed, the zebrafish prep1 gene appears to be ubiquitously expressed (N. V. and C. G. S., unpublished) and endogenous Prep1 may interact with Hoxb1b and Pbx4 in our experiments. However, while the Pbx and Hox binding sites appear to be required for in vivo expression of most Hox-dependent genes (Ferretti et al., 2000; Jacobs et al., 1999; Pöpperl et al., 1995), a Meis/Prep1 binding site is only required for some genes (Ferretti et al., 2000). Meis proteins may therefore not always be required (at least not as a DNA binding component) for Pbx and Hox proteins to function in vivo.

Second, different Hox proteins have different effects in vivo, but it is not clear if different Meis family members differ functionally. For instance, if Hoxb1b and Pbx4 require Prep1 to activate hoxb1a expression, the synergistic effect we see following co-expression of Meis3 could be due to Prep1 being limiting in vivo. In this scenario, Prep1 and Meis3 would be functionally equivalent. An alternative explanation to the synergistic effect is that exogenously supplied Meis3 provides a unique function, perhaps by replacing Prep1, thus playing an instructive role. We favor the latter model, primarily because published experiments suggest that Prep1 cannot substitute for Homothorax in Drosophila (Jaw et al., 2000).

Third, although both Hoxb1b and Meis3 appear to require Pbx4 interaction to be functional in vivo, we do not know whether Hoxb1b and Meis3 interact with the same Pbx4 molecule to form a trimeric complex, or whether they interact with separate Pbx4 molecules to form a pair of dimers. However, several pieces of data indicate the formation of trimeric complexes. First, both the hoxb1 and hoxb2 r4 enhancers contain adjacent Hox/Pbx binding sites and a more distant Meis site, but there is no Pbx site near the Meis site (Ferretti et al., 2000; Jacobs et al., 1999). Consistent with this, DNA fragments containing these sequences support formation of trimeric Hox/Pbx/Meis complexes, but not of a pair of dimers, in vitro (Ferretti et al., 2000). Second, a DNA-binding mutant Prep1 forms dimers with Pbx that bind DNA only very weakly (Berthelsen et al., 1998). Therefore, if Meis3, Pbx4 and Hoxb1b acted as a pair of dimers, a DNA-binding mutant of Meis3 (MutMeis3) should not be able to form a functional dimer with Pbx4 and should not have any in vivo activity. However, we find that MutMeis3 still functions in vivo, as does a DNA-binding mutant Hth (Ryoo et al., 1999).

Lastly, in the only other study of in vivo Meis function (Salzberg et al., 1999), misexpression of Xenopus Meis3 by itself had minimal effect on krox20 and hoxb1 expression, but nevertheless mediated anterior deletions in Xenopus. This is in contrast with our analysis, where zebrafish Meis3 requires Pbx4 and Hoxb1b for the transformation of anterior fates. Since lineage labeling was not utilized to analyze the deletions in Xenopus, we do not know if a distinct mechanism is at work, or if some Meis family members may be able to function independently of Pbx and Hox.

Co-expression of Hoxb1b, Pbx4 and Meis3 is sufficient to promote hindbrain differentiation

The effects mediated by Hoxb1b, Pbx4 and Meis3 co- expression are likely to be causally related and to occur in sequence. Since murine hoxb1 and hoxb2 have Pbx, Hox and Meis binding sites in their enhancers (Ferretti et al., 2000; Jacobs et al., 1999) it is likely that zebrafish hoxb1a and hoxb2 are directly induced by Hoxb1b, Pbx4 and Meis3. Ectopic expression of hoxb2 induces krox20 and valentino expression in zebrafish (Yan et al., 1998), suggesting that these genes may be activated subsequently to hoxb2. Thus, expression of Hoxb1b, Pbx4 and Meis3 is sufficient to promote the differentiation of hindbrain fates, particularly r4 fates, and we speculate that they normally perform this function within the caudal hindbrain during zebrafish embryogenesis.

We wish to thank members of the Sagerström lab for helpful discussions, C. Moens for the valentino probe, V. Prince for the hoxb2 probe, Dan Kessler for the pCS2+VP16N plasmid and Jeffrey Nickerson and Paul Furcinitti for assistance with confocal and digital deconvolution microscopy respectively. This work was supported by grant R01NS38183 from the NIH and RPG-00-255-01-DDC from the American Cancer Society.

Abu-Shaar
,
M.
,
Ryoo
,
H. D.
and
Mann
,
R. S.
(
1999
).
Control of the nuclear localization of Extradenticle by competing nuclear import and export signals
.
Genes Dev
.
13
,
935
945
.
Alexandre
,
D.
,
Clarke
,
J. D.
,
Oxtoby
,
E.
,
Yan
,
Y. L.
,
Jowett
,
T.
and
Holder
,
N.
(
1996
).
Ectopic expression of Hoxa-1 in the zebrafish alters the fate of the mandibular arch neural crest and phenocopies a retinoic acid-induced phenotype
.
Development
122
,
735
746
.
Amores
,
A.
,
Force
,
A.
,
Yan
,
Y. L.
,
Joly
,
L.
,
Amemiya
,
C.
,
Fritz
,
A.
,
Ho
,
R. K.
,
Langeland
,
J.
,
Prince
,
V.
,
Wang
,
Y. L.
et al. 
. (
1998
).
Zebrafish hox clusters and vertebrate genome evolution
.
Science
282
,
1711
1714
.
Asahara
,
H.
,
Dutta
,
S.
,
Kao
,
H. Y.
,
Evans
,
R. M.
and
Montminy
,
M.
(
1999
).
Pbx-Hox heterodimers recruit coactivator-corepressor complexes in an isoform-specific manner
.
Mol. Cell Biol
.
19
,
8219
8225
.
Berthelsen
,
J.
,
Kilstrup-Nielsen
,
C.
,
Blasi
,
F.
,
Mavilio
,
F.
and
Zappavigna
,
V.
(
1999
).
The subcellular localization of PBX1 and EXD proteins depends on nuclear import and export signals and is modulated by association with PREP1 and HTH
.
Genes Dev
.
13
,
946
953
.
Berthelsen
,
J.
,
Zappavigna
,
V.
,
Ferretti
,
E.
,
Mavilio
,
F.
and
Blasi
,
F.
(
1998
).
The novel homeoprotein Prep1 modulates Pbx-Hox protein cooperativity
.
EMBO J
.
17
,
1434
1445
.
Blader
,
P.
,
Fischer
,
N.
,
Gradwohl
,
G.
,
Guillemont
,
F.
and
Strahle
,
U.
(
1997
).
The activity of neurogenin1 is controlled by local cues in the zebrafish embryo
.
Development
124
,
4557
4569
.
Chang
,
C. P.
,
Jacobs
,
Y.
,
Nakamura
,
T.
,
Jenkins
,
N. A.
,
Copeland
,
N. G.
and
Cleary
,
M. L.
(
1997
).
Meis proteins are major in vivo binding partners for wild-type but not chimeric Pbx proteins
.
Mol. Cell. Biol
.
17
,
5679
5687
.
Chen
,
J.
,
Zheng
,
X. F.
,
Brown
,
E. J.
and
Schreiber
,
S. L.
(
1995
).
Identification of an 11-kDa FKBP12-rapamycin-binding domain within the 289-kDa FKBP12-rapamycin-associated protein and characterization of a critical serine residue
.
Proc. Natl. Acad. Sci. USA
92
,
4947
4951
.
Di Rocco
,
G.
,
Mavilio
,
F.
and
Zappavigna
,
V.
(
1997
).
Functional dissection of a transcriptionally active, target specific Hox-Pbx complex
.
EMBO J
.
16
,
3644
3654
.
Fekany-Lee
,
K.
,
Gonzalez
,
E.
,
Miller-Bertoglio
,
V.
and
Solnica-Krezel
,
L.
(
2000
).
The homeobox gene bozozok promotes anterior neuroectoderm formation in zebrafish through negative regulation of BMP2/4 and Wnt pathways
.
Development
127
,
2333
2345
.
Ferretti
,
E.
,
Marshall
,
H.
,
Popperl
,
H.
,
Maconochie
,
M.
,
Krumlauf
,
R.
and
Blasi
,
F.
(
2000
).
Segmental expression of Hoxb2 in r4 requires two separate sites that integrate cooperative interactions between Prep1, Pbx and Hox proteins
.
Development
127
,
155
166
.
Harvey
,
R. P.
,
Tabin
,
C. J.
and
Melton
,
D. A.
(
1986
).
Embryonic expression and nuclear localization of Xenopus homeobox (Xhox) gene products
.
EMBO J
.
5
,
1237
1244
.
Hatta
,
K.
(
1992
).
Role of the floor plate in axonal patterning in the zebrafish CNS
.
Neuron
9
,
629
642
.
Jacobs
,
Y.
,
Schnabel
,
C. A.
and
Cleary
,
M. L.
(
1999
).
Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2 hindbrain enhancer activity
.
Mol. Cell Biol
.
19
,
5134
5142
.
Jaw
,
T. J.
,
You
,
L. R.
,
Knoepfler
,
P. S.
,
Yao
,
L. C.
,
Pai
,
C. Y.
,
Tang
,
C. Y.
,
Chang
,
L. P.
,
Berthelsen
,
J.
,
Blasi
,
F.
,
Kamps
,
M. P.
et al. 
. (
2000
).
Direct interaction of two homeoproteins, homothorax and extradenticle, is essential for EXD nuclear localization and function
.
Mech Dev
.
91
,
279
291
.
Kamps
,
M. P.
,
Murre
,
C.
,
Sun
,
S. H.
and
Baltimore
,
D.
(
1990
).
A new homeobox gene contributes the DNA binding domain of the t(1;19) translocation protein in pre-B ALL
.
Cell
60
,
547
555
.
Kessler
,
D. S.
(
1997
).
Siamois is required for formation of Spemann’s organizer
.
Proc. Natl. Acad. Sci. USA
94
,
13017
13022
.
Kimmel
,
C. B.
,
Warga
,
R. M.
and
Schilling
,
T. F.
(
1990
).
Origin and organization of the zebrafish fatemap
.
Development
108
,
581
594
.
Knoepfler
,
P. S.
,
Calvo
,
K. C.
,
Chen
,
H.
,
Antonarakis
,
S. E.
and
Kamps
,
M. P.
(
1997
).
Meis1 and pKnox1 bind DNA cooperatively with Pbx1 utilizing an interaction surface disrupted in oncoprotein E2a-Pbx1
.
Proc. Natl. Acad. Sci. USA
94
,
14553
14558
.
Knoepfler
,
P. S.
and
Kamps
,
M. P.
(
1995
).
The pentapeptide motif of Hox proteins is required for cooperative DNA binding with Pbx1, physically contacts Pbx1, and enhances DNA binding by Pbx1
.
Mol. Cell Biol
.
15
,
5811
5819
.
Krumlauf
,
R.
(
1994
).
Hox genes in vertebrate development
.
Cell
78
,
191
201
.
Li
,
Y.
,
Allende
,
M. L.
,
Finkelstein
,
R.
and
Weinberg
,
E. S.
(
1994
).
Expression of two zebrafish orthodenticle-related genes in the embryonic brain
.
Mech. Dev
.
48
,
229
244
.
Mann
,
R. S.
and
Affolter
,
M.
(
1998
).
Hox proteins meet more partners
.
Curr. Opin. Genet. Dev
.
8
,
423
429
.
Moens
,
C. B.
,
Cordes
,
S. P.
,
Giorgianni
,
M. W.
,
Barsh
,
G. S.
and
Kimmel
,
C. B.
(
1998
).
Equivalence in the genetic control of hindbrain segmentation in fish and mouse
.
Development
125
,
381
391
.
Monica
,
K.
,
Galili
,
N.
,
Nourse
,
J.
,
Saltman
,
D.
and
Cleary
,
M. L.
(
1991
).
PBX2 and PBX3, new homeobox genes with extensive homology to the human proto-oncogene PBX1
.
Mol. Cell. Biol
.
11
,
6149
6157
.
Mori
,
H.
,
Miyazaki
,
Y.
,
Morita
,
T.
,
Nitta
,
H.
and
Mishina
,
M.
(
1994
).
Different spatiotemporal expressions of three otx homeoprotein transcripts durimg zebrafish embryogenesis
.
Mol. Brain Res
.
27
,
221
213
.
Moskow
,
J. J.
,
Bullrich
,
F.
,
Huebner
,
K.
,
Daar
,
I. O.
and
Buchberg
,
A. M.
(
1995
).
Meis1, a PBX-1 related homeobox gene involved in myeloid leukemia in BXH-2 mice
.
Molecular and Cellular Biology
15
,
5434
5443
.
Nakamura
,
T.
,
Jenkins
,
N. A.
and
Copeland
,
N. G.
(
1996
).
Identification of a new family of Pbx-related homeobox genes
.
Oncogene
13
,
2235
2242
.
Nourse
,
J.
,
Mellentin
,
J. D.
,
Galili
,
N.
,
Wilkinson
,
J.
,
Stanbridge
,
E.
,
Smith
,
S. D.
and
Cleary
,
M. L.
(
1990
).
Chromosomal translocation t(1;19) results in synthesis of a homeobox fusion mRNA that codes for a potential chimeric transcription factor
.
Cell
60
,
535
45
.
Oxtoby
,
E.
and
Jowett
,
T.
(
1993
).
Cloning of the zebrafish krox-20 gene (krx20) and its expression during development
.
Nucl. Acids Res
.
21
,
1087
1095
.
Pai
,
C. Y.
,
Kuo
,
T. S.
,
Jaw
,
T. J.
,
Kurant
,
E.
,
Chen
,
C. T.
,
Bessarab
,
D. A.
,
Salzberg
,
A.
and
Sun
,
Y. H.
(
1998
).
The Homothorax homeoprotein activates the nuclear localization of another homeoprotein, extradenticle, and suppresses eye development in Drosophila
.
Genes Dev
.
12
,
435
446
.
Pöpperl
,
H.
,
Bienz
,
M.
,
Studer
,
M.
,
Chan
,
S. K.
,
Aparicio
,
S.
,
Brenner
,
S.
,
Mann
,
R. S.
and
Krumlauf
,
R.
(
1995
).
Segmental expression of Hoxb-1 is controlled by a highly conserved autoregulatory loop dependent upon exd/pbx
.
Cell
81
,
1031
1042
.
Popperl
,
H.
,
Rikhof
,
H.
,
Chang
,
H.
,
Haffter
,
P.
,
Kimmel
,
C. B.
and
Moens
,
C. B.
(
2000
).
Iazarus is a novel pbx gene that globally mediates hox gene function in zebrafish
.
Mol. Cell
.
6
,
255
267
.
Prince
,
V. E.
,
Moens
,
C. B.
,
Kimmel
,
C. B.
and
Ho
,
R. K.
(
1998b
).
Zebrafish hox genes:expression in the hindbrain region of wild-type and mutants of the segmentation gene valentino
.
Development
125
,
393
406
.
Rambaldi
,
I.
,
Kovacs
,
E. N.
and
Featherstone
,
M. S.
(
1994
).
A proline-rich transcriptional activation domain in murine HOXD-4 (HOX-4.2
).
Nucl. Acids Res
.
22
,
376
382
.
Rauskolb
,
C.
,
Peifer
,
M.
and
Wieschaus
,
E.
(
1993
).
extradenticle, a regulator of homeotic gene activity, is a homolog of the homeobox-containing human proto-oncogene pbx1. Cell
74
,
1101
12
.
Rieckhof
,
G. E.
,
Casares
,
F.
,
Ryoo
,
H. D.
,
Abu-Shaar
,
M.
and
Mann
,
R. S.
(
1997
).
Nuclear translocation of Extradenticle requires homothorax, which encodes an Extradenticle-related homeodomain protein
.
Cell
91
,
171
183
.
Ryoo
,
H. D.
,
Marty
,
T.
,
Casares
,
F.
,
Affolter
,
M.
and
Mann
,
R. S.
(
1999
).
Regulation of Hox target genes by a DNA bound Homothorax/Hox/Extradenticle complex
.
Development
126
,
5137
5148
.
Sagerström
,
C. G.
,
Kao
,
B. A.
,
Lane
,
M. E.
and
Sive
,
H.
(
2001
).
Isolation and characterization of posteriorly restricted genes in the zebrafish gastrula
.
Dev. Dyn
. (in press).
Salzberg
,
A.
,
Elias
,
S.
,
Nachaliel
,
N.
,
Bonstein
,
L.
,
Henig
,
C.
and
Frank
,
D.
(
1999
).
A Meis family protein caudalizes neural cell fates in Xenopus
.
Mech. Dev
.
80
,
3
13
.
Schulte-Merker
,
S.
,
van Eeden
,
F.
,
Halpern
,
M. E.
,
Kimmel
,
C. B.
and
Nüsslein-Volhard
,
C.
(
1994
).
no tail (ntl) is the zebrafish homologue of the mouse T (brachyury) gene
.
Development
120
,
1009
1015
.
Shanmugam
,
K.
,
Green
,
N. C.
,
Rambaldi
,
I.
,
Saragovi
,
H. U.
and
Featherstone
,
M. S.
(
1999
).
PBX and MEIS as non-DNA-binding partners in trimeric complexes with HOX proteins
.
Mol. Cell Biol
.
19
,
7577
7588
.
Shen
,
W. F.
,
Rozenfeld
,
S.
,
Kwong
,
A.
,
Kom ves
,
L. G.
,
Lawrence
,
H. J.
and
Largman
,
C.
(
1999
).
HOXA9 forms triple complexes with PBX2 and MEIS1 in myeloid cells
.
Mol. Cell Biol
.
19
,
3051
3061
.
Vlachakis
,
N.
,
Ellstrom
,
D. R.
and
Sagerstrom
,
C. G.
(
2000
).
A novel pbx family member expressed during early zebrafish embryogenesis forms trimeric complexes with Meis3 and Hoxb1b
.
Dev. Dyn
.
217
,
109
119
.
Weinberg
,
E. S.
,
Allende
,
M. L.
,
Kelly
,
C. S.
,
Abdelhamid
,
A.
,
Murakami
,
T.
,
Andermann
,
P.
,
Doerre
,
O. G.
,
Grunwald
,
D. J.
and
Riggleman
,
B.
(
1996
).
Developmental regulation of zebrafish MyoD in wild-type, no tail and spadetail embryos
.
Development
122
,
271
280
.
Woo
,
K.
and
Fraser
,
S. E.
(
1995
).
Order and coherence in the fate map of the zebrafish nervous system
.
Development
121
,
2595
2609
.
Yan
,
Y. L.
,
Jowett
,
T.
and
Postlethwait
,
J. H.
(
1998
).
Ectopic expression of hoxb2 after retinoic acid treatment or mRNA injection: disruption of hindbrain and craniofacial morphogenesis in zebrafish embryos
.
Dev. Dyn
.
213
,
370
385
.
Zhang
,
M.
,
Kim
,
H.-J.
,
Marshall
,
H.
,
Gendron-Maguire
,
M.
,
Lucas
,
A. D.
,
Baron
,
A.
,
Gudas
,
L. J.
,
Gridley
,
T.
,
Krumlauf
,
R.
and
Grippo
,
J. F.
(
1994
).
Ectopic Hoxa-1 induces rhombomere transformation in mouse hindbrain
.
Development
120
,
2431
2442