The cells of the inner cell mass constitute the pluripotent cell population of the early embryo. They have the potential to form all of the tissues of the embryo proper and some extra-embryonic tissues. They can be considered a transient stem cell population for the whole of the embryo, and stem cells maintaining the same capacity can be isolated from these cells. We have isolated, characterised and mutated a novel gene, taube nuss (Tbn), that is essential for the survival of this important cell population. The taube nuss protein sequence (TBN) was highly conserved between human, mouse, Xenopus laevis, Drosophila melanogaster, Caenorhabditis elegans and Arabidopsis thaliana, particularly in a domain that is not present in any published proteins, showing that TBN is the founding member of a completely new class of proteins with an important function in development. The Tbn gene was expressed ubiquitously as early as E2.5 and throughout embryonic development. It was also expressed in adult brain with slightly higher levels in the hippocampus. The Tbn mutant embryos developed normally to the blastocyst stage and contained inner cell masses. They hatched from the zonae pellucidae, implanted and induced decidual reactions, but failed to develop beyond E4.0. At this time the trophoblast cells were viable, but inner cell masses were not detectable. At E3.75, massive TUNEL-positive DNA degradation and chromatin condensation were visible within the inner cell masses, whereas the cell membranes where intact. Caspase 3 was expressed in these cells. In vitro, the inner cell mass of mutant embryos failed to proliferate and died after a short period in culture. These results indicate that the novel protein, taube nuss, is necessary for the survival of the inner cell mass cells and that inner cell mass cells died of apoptosis in the absence of the taube nuss protein. As cell pruning by apoptosis is a recognised developmental process at this stage of development, the taube nuss protein may be one of the factors regulating the extent of programmed cell death at this time point.

The first cell-lineage specification and restriction in mammalian development occurs in preimplantation embryos, when blastocysts form from compacted morulae. They consist of an outer cell population, the trophectoderm, from which the trophoblast compartment of the extra-embryonic tissues develops and an inner cell population, the inner cell mass or embryoblast, from which all tissues of the embryo proper, the yolk sac, the amnion and the allantois, develop. The cells of the inner cell mass are, therefore, a transient pluripotent stem cell population of the embryo proper and some extra-embryonic tissues (reviewed by Hogan et al., 1994). Cells are pruned from this population by programmed cell death (Smith and Wilson, 1971). This presumably occurs as a counterbalance to excessive cell proliferation or to remove cells that started to differentiate into an undesirable direction (Pierce et al., 1989). In wild-type E3.5 embryos up to 10% of inner cell mass cells have been observed to undergo apoptosis, but cell death is not observed in the trophectoderm lineage at this point (reviewed by Sanders and Wride, 1995, and by Pampfer and Donnay, 1999). Electron microscopy, vital dye exclusion and in situ end-labelling studies have shown that the cells dying in the inner cell masses exhibit the typical signs of apoptosis (Copp, 1978; Handyside and Hunter, 1986; Brison and Schultz, 1997).

During hatching and implantation the inner cell mass proliferates. Then the proamniotic cavity is formed, and the cells that formerly formed the inner cell mass are organised into an epithelial structure, the primitive ectoderm or epiblast, which lines the proamniotic cavity. The process of proamniotic cavity formation involves the programmed cells death of inner cell mass cells in the centre of the inner cell mass and selective survival of cells in the periphery of the inner cell mass (Coucouvanis and Martin, 1995). The surviving cells are thought to receive a survival signal from the basement membrane surrounding the inner cell mass, while the cells in the centre die, because they received and executed a death signal. Both processes involving cell death, the pruning of inner cell mass cells and the formation of the proamniotic cavity, require careful regulation of the death process, as some cells are entailed to die, while immediate neighbours are required to survive.

Programmed cell death occurs as a regular mechanism during embryonic development in order to prune proliferating cell population of excess or aberrant cells or to shape tissues. Well-known examples of developmental cell death during mammalian development are the involution of the interdigital webs and of epithelial structures in areas where tissues fuse, e.g. the fusion of the palate (reviewed by Sanders and Wride, 1995; Vaux and Korsmeyer, 1999). Initially, programmed cell death during development was always thought to involve apoptosis. More recently, it has become clear that other forms of programmed cell death that have features in common with necrosis may also occur during development (Chautan et al., 1999).

Apoptosis is characterised by the internal disassembly of the cell, particularly the DNA, while the cell membrane remains intact. Consequently, chromatin and other cellular material is fragmented into cell membrane-enclosed portions that can easily be cleared by neighbouring cells. In this way adverse effects of cell death on neighbouring cells and an inflammatory reaction are avoided. Developmental cell death is thought to be regulated by extracellular death-inducing factors and survival factors. There is some evidence that tumour necrosis factor α and transforming growth factor α may be, respectively, cell death-inducing and survival factor for the inner cell mass cells of blastocysts (Brison and Schultz, 1997; Pampfer et al., 1997). Internally, apoptosis involves an antagonism of pro- and anti-apoptotic factors. Once apoptosis is induced, the activation of a cascade of proteolytic enzymes including caspases (cysteine proteases that cleave their substrate after an aspartic acid residue) ultimately results in the disassembly of the cell (reviewed by Vaux and Korsmeyer, 1999). Caspases are synthesised as inactive proenzymes and require cleavage for their activation. Chromatin condensation and DNA fragmentation, major manifestations of apoptosis, can also occur in a caspase-independent manner (Susin et al., 1999). Some of the genes coding for proteins involved in apoptosis are expressed in preimplantation embryos (Weil et al., 1996; Jurisicova et al., 1998; Exley et al., 1999).

We have isolated a novel mouse gene, taube nuss (Tbn), the founding member of a novel group of proteins, and have generated Tbn mutant mice. These mice exhibit disturbances in the balance between cell death and cell survival in the early embryo, so that the pluripotent inner cell mass cells all die by apoptosis while the trophectoderm cells survive.

Generation of the mutant Tbngt allele

The promoter-less reporter construct pGT1.8geo (kindly provided by W. Skarnes; Skarnes et al., 1995) was electroporated into the parental murine embryonic stem (ES) cell line MPI-II (Voss et al., 1997) as described previously (Voss et al., 1998b).

Cloning and sequencing of the Tbn cDNA and the 5′ junction of pGT1.8geo and the Tbn locus

Total RNA was isolated from ES cells heterozygous for the insertion of pGT1.8geo into the murine genome (clone F5). 5′ rapid amplification of cDNA ends was performed as previously described (Voss et al., 1998a) using oligonucleotides complementary to the lacZ gene of pGT1.8geo as gene-specific primers. RACE products were isolated and sequenced. The sequences specific for the endogenous gene were amplified by PCR, cloned into pGemT (probe 1, Fig. 1A) and used as a probe to screen an ES cell cDNA library. The ES cell cDNA library was generated for this purpose. PolyA+ RNA from wild-type ES cells (MPI-II) was reverse transcribed with random hexamere oligonucleotides and second-strand synthesis was carried out using a cDNA synthesis kit (Pharmacia). After filling-in reaction, ligation to EcoRI/NotI adapters (Pharmacia), size selection on a Sephacryl S400HR column, the cDNA was cloned into the EcoRI site of λpExcell (Pharmacia) and packaged into Gigapack III Gold (Stratagene). E. coli NM522 were transfected with the phages and plated. The cDNA library of 1,000,000 plaques was harvested without further amplification. The average insert size was 2 kb±0.8. 0.17% of the clones contained β-actin cDNA as an insert. Five cDNA clones isolated from this library were sequenced. One clone contained the entire open reading frame, but not the 5′ UTR, which was obtained by 5′ RACE, and only part of the 3′ UTR. The remaining 3′ untranslated sequences were obtained by 3′ RACE using cDNA generated from E12.5 embryos. Three independent PCRs were performed using oligonucleotide primers derived from the coding sequence. Each reaction produced a band of the same size which was cloned into pGemT and sequenced.

Fig. 1.

Tbn mRNA and Southern analysis. (A) Schematic drawing of the Tbn mRNA, sequences coding for two regions of sequence similarity with related proteins (S1 and S2, grey) containing a putative α-helix each (H1 and H2, striped), the proline-rich domain (P, dotted), an area of 4 putative nuclear localization signals (NLS, black) and the position of the gene trap insertion at base 216 (arrowhead) are indicated. The 3′ UTR is shown truncated at base 1153, not showing the remaining 1430 bases. The probes used for northern (probe 1), Southern analysis (probe 1 and 2), and for in situ hybridisation (probe 2) are indicated. (B) Northern analysis of total RNA isolated from adult brain, E12.5 placenta, E12.5 embryo, ES cell and ES cells heterozygous for the gene trap insertion at the Tbn locus probed with a Tbn-specific probe (probe 1 in A). The positions of the 18S (1.9 kb), 28S (4.7 kb), 45S (13 kb) ribosomal RNA, the Tbn mRNA of 2.5 kb and the Tbn/pGT1.8geo fusion mRNA are indicated. The ethidium bromide image of the 18S rRNA on the gel is shown below. (C) Southern analysis of DNA isolated from tail biopsies of offspring of Tbngt/+ intercrosses cut with BamHI and probed with probe 1. The positions of the bands resulting from the wild-type (wt, Tbn+) and the mutant (mt, Tbngt) allele are indicated. Results show two wild-type (wt) and four heterozygous (ht) animals.

Fig. 1.

Tbn mRNA and Southern analysis. (A) Schematic drawing of the Tbn mRNA, sequences coding for two regions of sequence similarity with related proteins (S1 and S2, grey) containing a putative α-helix each (H1 and H2, striped), the proline-rich domain (P, dotted), an area of 4 putative nuclear localization signals (NLS, black) and the position of the gene trap insertion at base 216 (arrowhead) are indicated. The 3′ UTR is shown truncated at base 1153, not showing the remaining 1430 bases. The probes used for northern (probe 1), Southern analysis (probe 1 and 2), and for in situ hybridisation (probe 2) are indicated. (B) Northern analysis of total RNA isolated from adult brain, E12.5 placenta, E12.5 embryo, ES cell and ES cells heterozygous for the gene trap insertion at the Tbn locus probed with a Tbn-specific probe (probe 1 in A). The positions of the 18S (1.9 kb), 28S (4.7 kb), 45S (13 kb) ribosomal RNA, the Tbn mRNA of 2.5 kb and the Tbn/pGT1.8geo fusion mRNA are indicated. The ethidium bromide image of the 18S rRNA on the gel is shown below. (C) Southern analysis of DNA isolated from tail biopsies of offspring of Tbngt/+ intercrosses cut with BamHI and probed with probe 1. The positions of the bands resulting from the wild-type (wt, Tbn+) and the mutant (mt, Tbngt) allele are indicated. Results show two wild-type (wt) and four heterozygous (ht) animals.

DNA was isolated from a tail biopsy of an animal heterozygous for the pGT1.8geo insertion in the Tbn locus. The 5′ junction was amplified by PCR using and a lacZ specific primer (5′ GGCGATCGGTGCGGGCCTCTTCGC 3′) and an Tbn-specific primer (5′ GGAGACACTGACAGAGATGCTGCAGAGC 3′). The PCR product was cloned into pGemT (Promega) and sequenced.

Sequence comparison

The deduced protein sequence was encoded by the longest open reading frame, started with the first ATG, and was in frame with the lacZ ORF. The cDNA and the protein sequence were compared with entries into the EMBL data bases, SWISS-PROT, and GenBank by blast and fasta analysis (Wisconsin Package, Genetics Computer Group). Similarities between protein sequences were analysed using ClustallW (Thompson et al., 1994) and depicted using MacBoxshade (http://www.ch.embnet.org/software/BOX_form.html).

Generation of the mutant Tbngt mouse line

Chimaeras were produced by a technique modified from Nagy and Rossant (1993) omitting the sandwich technique (Voss et al., 1998b). Chimaeras were mated with wild-type females of the mouse strains C57Bl/6 and NMRI to produce animals heterozygous for the Tbngt mutation. Noon of the day on which the vaginal plug was observed was termed day 0.5 of gestation (E0.5).

Genotyping of mice and embryos and Tbn RT-PCR

DNA was isolated from tail biopsies, extra-embryonic membranes of embryos (E9.5 to E15.5) and whole embryos (E8.5). For genotyping of BamHI-digested DNA samples by Southern analysis, probe 1 (Fig. 1A,C) was generated by cloning the Tbn-specific sequences of the 5′?RACE product into pGemT. Tbn RT-PCR was performed using 5′ GG-AGACACTGACAGAGATGCTGCAGAG C 3′ and 5′ ATCTGGTA-GTCAGACACTGGCTCACGG 3′ as primers. Radioactive RT-PCR on RNA isolated from preimplantation embryos was performed as described previously (Nichols et al., 1998).

Whole embryo and histological analysis

Embryos were flushed from their mothers’ uteri, placed in M2, viewed and photographed using a Labovert inverted microscope (Leitz). For histological analysis embryos or whole concepti in their mothers’ uteri were fixed in 4% paraformaldehyde, infiltrated and embedded in paraffin. Serial sections (5-8 μm) were cut, deparaffinised and stained with Haematoxylin and Eosin by standard techniques. Slides were viewed and photographed with differential interference contrast optics using a Zeiss Axiophot microscope. Photographs of serial sections of mutant and control animals were compared in detail.

Northern analysis, in situ hybridisation and β-galactosidase staining

Northern blots were prepared by standard techniques and hybridised with [α-32P]dCTP labelled Tbn-specific probe 1 described above (Fig. 1A). In situ hybridisation was performed essentially as described (Hogan et al., 1994). Briefly, section were deparaffinised, rehydrated through graded alcohol concentrations, incubated for 10 minutes (or 30 minutes for adult brains) at room temperature in 10 mg/ml proteinase K, fixed in 4% paraformaldehyde for 10 minutes, then dehydrated through graded alcohol concentrations. Sections were air dried, then hybridisation solution containing 5×105cpm/ μl in vitro transcribed cRNA probe (probe 2, Fig. 1A) was placed onto the section. Slides were incubated overnight at 56°C and then washed as described (Hogan et al., 1994). Slides were autoradiographed at 4°C for 14 days, developed and counterstained with Haematoxylin. Embryos were stained for β-galactosidase activity as described previously (Voss et al., 1998b). For staining of preimplantation embryos 0.1% BSA was added to all solutions except the staining solution to reduce stickiness, and embryos were fixed for 3 minutes only.

Explant and cell culture

E3.5 embryos of Tbngt/+ heterozygous mutant intercrosses were isolated and plated onto gelatine coated 24-well plates into ES cell derivation medium (Voss et al., 1997). Control cultures were established with embryos that were wild type at the Tbn locus. To E3.5 embryos cultured in the same way, 2 ng/ml recombinant human FGF4 (R&D Systems) and 1 μg/ml heparin were added.

Generation and processing of chimaeric embryos

For chimaeric analysis of the mutant phenotype in vitro, embryos of Tbngt/+ heterozygous mutant intercrosses were recovered in the eight-cell stage, labelled with a lipophilic fluorescent dye (CellTracker CM-DiI, Molecular Probes) and aggregated with wild-type unlabelled embryos, essentially as describe previously (Nagy and Rossant, 1993). The aggregates were cultured for 24 hours in M16 under oil and then viewed and photographed with a fluorescent microscope (Axiophot 2, Zeiss). For chimaeric analysis of the mutant phenotype in vivo, embryos of Tbngt/+ heterozygous mutant intercrosses were recovered at the eight-cell stage and aggregated with tetraploid embryos that were wild type at the Tbn locus, essentially as describe previously (Nagy and Rossant, 1993; Voss et al., 2000). Chimaeric concepti were recovered at E9.5. The embryos were photographed and then used for genotyping by Tbn-specific Southern analysis. The extra-embryonic membranes were used for genotyping.

Myc tagging

The coding sequence of the Tbn cDNA was cloned in frame with six Myc epitopes (Roth et al., 1991) into pCS2+MT and sequenced to confirm the successful cloning. The tagged protein was in vitro translated. The Tbn/6myc containing plasmid was transfected into COS7 or NIH3T3 cells using lipofectamine (Gibco BRL). Five, 8, 10 or 24 hours after transfection the cells were fixed in 4% paraformaldehyde, subjected to Myc immunofluorescence detection using a mouse monoclonal anti-c-Myc (9E10, Santa Cruz, 1:100) and an Alexa 568 goat anti-mouse antibody (Molecular Probes, 1:500), and counterstained with DAPI.

Immunocytochemistry

Zona pellucidae were removed from preimplantation unhatched embryos with acid Tyrode’s solution and hatched embryos were used as such. For FGF4 and OCT4 detection, the embryos were fixed in 2% paraformaldehyde in PBS and incubated with intervening and a final incubations in PBS plus 0.25% gelatine in 0.1% Triton X-100 in PBS, first antibody solution and second, fluorescent antibody solution. One PBS plus gelatine solution also contained 0.1 μg/ml of the fluorescent nuclear stain Hoechst 33258 (Molecular Probes). Then the embryos were mounted with an aqueous mounting medium (Mowiol) and viewed and photographed using a fluorescence microscope (Axiophot 2, Zeiss). For caspase 3 detection, the embryos were first mounted onto object slides, then fixed in acetone, and then treated with the antibody solutions. The first antibodies and dilutions used were a goat anti-human FGF4 (Santa Cruz, 1:50), rabbit anti-murine OCT4 (Palmieri et al., 1994; 1:400), and rabbit anti-active human caspase 3 (Pharmingen, 1:100). The second antibodies used were Alexa 568 donkey anti-goat IgG and Alexa 568 goat anti-rabbit IgG (both Molecular Probes, 1:1000). In our hands, the anti-active caspase 3 antibody showed strong binding to cells that were also exhibiting chromatin condensation. However, staining of all cells of the preimplantation embryo was visible at a lower level.

TUNEL and Trypan Blue exclusion test

The zona pellucidae were removed from E3.75 embryos recovered from Tbngt/+ heterozygous mutant intercrosses or wild-type intercrosses. The embryos were fixed for 10 minutes in 1% paraformaldehyde in PBS, washed in PBS and dried onto object slides. On the slides, they were processed with intervening PBS washes through 0.1% Triton X-100 15 minutes, then equilibration buffer and terminal transferase reaction, incorporating digoxigenin-labelled deoxynucleotide and fluorescein-labelled anti-digoxigenin antibody (all ApoTag in situ apoptosis detection kit, Oncor Appligene). As positive controls, embryos were treated with 0.5 μg/ml DNase I after the permeabilisation step. The slides were covered with an aqueous mounting medium (Mowiol) to which 0.5 μg/ml Hoechst 33258 were added. The embryos were viewed and photographed using a fluorescence microscope (Axiophot 2, Zeiss). For Trypan Blue exclusion, embryos were recovered and incubated for 10 minutes in 0.4% Trypan Blue in M16 culture medium, then washed in M2 and viewed immediately under an inverted microscope (Labovert, Leitz). As positive controls, wild-type embryos were killed using sodium azide.

Statistics

Number of cells in morphologically abnormal and normal embryos obtained were compared by Student’s t-test. Results are given as mean±standard deviation.

Isolation and cloning of taube nuss and generation of the mutant allele

In a gene trap screen for genes that are important in embryonic development (Voss et al., 1998b) we isolated a novel murine gene which we called taube nuss, Tbn (empty nut). The 5′ end of the Tbn cDNA was cloned by 5′ RACE using oligonucleotides specific for sequences of the gene trap construct. RACE products of about 450 bases were isolated and sequencing revealed no significant similarity to published sequences in the databases. Using the sequences specific for the endogenous gene, the Tbn sequence 3′ of the gene trap insertion was cloned from a random primed cDNA library made for this purpose from ES cells. The resulting Tbn cDNA clones spanned 1594 bases of the 2.5 kb cDNA and contained the entire open reading frame. The 5′ UTR and part of the 3′ UTR were cloned by 5′ and 3′ RACE. The Tbn mRNA was 2583 bases in size (Fig. 1A,B; GenBank Accession Number, AF222802). The 5′ UTR was 20 bases, the 3′ UTR 1638 bases long. The open reading frame of 924 bases started at the first ATG which was a non-Kozak sequence (Kozak, 1989). This open reading frame coded for a protein of 308 amino acids. The deduced protein contained two regions predicted to be α-helices (King and Sternberg, 1996) between amino acids 60 and 70, and 170 to 192; four putative nuclear localisation signals (NLS, Psort II, proteomics tools, SwissProt), i.e. two four-residue patterns at amino acids 297 and 302, and two seven-residue patterns at amino acids 295 and 299; and a proline-rich domain between amino acids 120 and 166 (Fig. 1A).

The gene trap insertion occurred at base 216 with respect to the cDNA that disrupted the protein-coding region after the first 20%, i.e. at amino acids 66 (Fig. 1A). With the gene trap construct we inserted a lacZ reporter/neomycin phosphotransferase selector gene into the Tbn locus. A fusion mRNA of the predicted size of about 4.7 kb was detectable in RNA isolated from ES cells heterozygous for the gene trap insertion at the Tbn locus (Fig. 1B). The 5′ genomic junction between Tbn and pGT1.8geo apparently fused intron sequences of the Tbn locus to intron sequences in the en2 splice acceptor of pGT1.8geo. The sequence at the fusion is 5′ ATCACCACCCCCAATGCCCAACACTTGTATGG 3′ with the Tbn sequences underlined. Southern analysis using probe 2 (Fig. 1A) showed that the 3′ region of the endogenous locus was intact (data not shown). Use of the splice acceptor and polyadenylation signal of the gene trap construct resulted in a protein truncated in the middle of the first region of similarity (S1) with related proteins (described below, Fig. 2) in the middle of the first putative α-helix and fused to a β-galactosidase/neomycin phosphotransferase fusion protein. This fusion protein lacked one half of the first region of sequence similarity of TBN and related proteins, the entire second region of similarity, half of the first and all of the second putative α-helix, the proline-rich domain, and the putative nuclear localization signal. As the first region of similarity is 100% conserved between human and mouse, and 51% conserved between fly and mouse, it appears to be one of the functional domains of the protein. Since this region is disrupted, a truncated protein would not be likely to confer residual function or a gain of function. The heterozygous animals developed and lived normally indicating that fusion protein generated from one mutant allele had no adverse effect. Owing to the early lethality of the Tbngt mutation we are unable to establish if low levels of wild-type RNA were produced from the mutant allele as discussed previously (Voss et al., 1998a). We called the fusion protein containing the first 66 amino acids of TBN, TBN66/β-gal/neo.

Fig. 2.

Sequences comparison of TBN and related proteins. (A) Amino acid sequence comparison of the deduced TBN protein (TBN_Mmusculus) and an unpublished D. melanogaster protein (PRODOS_Dmelanogaster), both full length. Identical amino acid residues are shown in red, shaded black, similar residues are shown in grey, shaded grey, and different residues are not shaded. (B,C) Amino acid sequence comparison of two regions of particular sequence similarity (S1 and S2) between TBN and related proteins. (B) Similarity region 1 (S1) of TBN (TBN_S1), the deduced protein sequence of a human EST (Human_S1, GenBank Accession Number, AA641254), the deduced protein of a partial X. laevis cDNA (Xlaevis_S1, AC#AW199998), PRODOS (PRODOS_S1, GenBank Accession Number, Y15513), a hypothetical protein deduced from sequences of C. elegans chromosome II (Celegans_S1, GenBank Accession Number, Z46934) and a hypothetical protein deduced from genomic sequences of chromosome 4 of A. thaliana (Athaliana_S1, GenBank Accession Number, CAB36711). The percentage of sequence identity is shown in the lower half, and the percentage of sequence similarity in the upper half of the table inserted. (C) Similarity region 2 (S2) of TBN (TBN_S2), S2 of the X. laevis protein, S2 of PRODOS, S2 of the same C. elegans protein and of the same A. thaliana protein shown in B. The human sequence did not extent far enough 3′ to yield information about the human S2. Note that the human protein and TBN are 100% identical in S1. TBN and the Xenopus protein are more than 90% identical in S1 and S2. The degree of sequence identity in mouse and Arabidopsis in S2 is higher than that of mouse and Caenorhabditis.

Fig. 2.

Sequences comparison of TBN and related proteins. (A) Amino acid sequence comparison of the deduced TBN protein (TBN_Mmusculus) and an unpublished D. melanogaster protein (PRODOS_Dmelanogaster), both full length. Identical amino acid residues are shown in red, shaded black, similar residues are shown in grey, shaded grey, and different residues are not shaded. (B,C) Amino acid sequence comparison of two regions of particular sequence similarity (S1 and S2) between TBN and related proteins. (B) Similarity region 1 (S1) of TBN (TBN_S1), the deduced protein sequence of a human EST (Human_S1, GenBank Accession Number, AA641254), the deduced protein of a partial X. laevis cDNA (Xlaevis_S1, AC#AW199998), PRODOS (PRODOS_S1, GenBank Accession Number, Y15513), a hypothetical protein deduced from sequences of C. elegans chromosome II (Celegans_S1, GenBank Accession Number, Z46934) and a hypothetical protein deduced from genomic sequences of chromosome 4 of A. thaliana (Athaliana_S1, GenBank Accession Number, CAB36711). The percentage of sequence identity is shown in the lower half, and the percentage of sequence similarity in the upper half of the table inserted. (C) Similarity region 2 (S2) of TBN (TBN_S2), S2 of the X. laevis protein, S2 of PRODOS, S2 of the same C. elegans protein and of the same A. thaliana protein shown in B. The human sequence did not extent far enough 3′ to yield information about the human S2. Note that the human protein and TBN are 100% identical in S1. TBN and the Xenopus protein are more than 90% identical in S1 and S2. The degree of sequence identity in mouse and Arabidopsis in S2 is higher than that of mouse and Caenorhabditis.

TBN-related proteins

The cDNA sequence and the deduced protein sequence had no similarities to published sequences, but the TBN protein sequence showed 45% sequence similarity to an unpublished SWISSPROT database entry, the PRODOS protein of D. melanogaster (GenBank Accession Number, Y15513), 32% sequence similarity to five non-continuous neighbouring regions on chromosome II of C. elegans (GenBank Accession Number, Z46934), and 28% sequence similarity to a hypothetical protein on chromosome 4 of A. thaliana (GenBank Accession Number, CAB36711). In addition to the sequences described here, several human and mouse ESTs were found to be similar to the Tbn cDNA. Finally an incomplete cDNA of X. laevis (GenBank Accession Number, AW199998) was found to encode a protein very similar to TBN. However, as none of these ESTs was a full-length sequence, they were not included in Fig. 2A. The two regions of highest similarity (S1 and S2) between the TBN-related proteins are depicted in Fig. 2B,C. Within these two regions, S1 and S2, TBN showed 100% sequence identity to a protein deduced from a human EST, 97% and 94% sequence similarity to the deduced Xenopus protein, 66% and 77% to PRODOS, 51% and 44% to the Caenorhabditis protein, and 50% and 47% to the Arabidopsis protein, respectively. Particularly conserved was a domain within the second similarity region in position 138 to 188 in our diagram (Fig. 2A, amino acids 1 to 50 in Fig. 2C), which we called the PDPH domain. Within this region the amino acids PDPH, two preceding prolines, and carboxy-terminal of the PDPH domain, a tyrosine, a threonine, an arginine and a leucine residue were conserved 100% between vertebrate, insect, worm and plant, both in amino acid identity and spacing. The sequences of all proteins were used to predict a putative common secondary structure. Both similarity domains were predicted to contain an α-helix each (H1 and H2; King and Sternberg, 1996). α-helices in these regions were also predicted by all other algorithms used to predict secondary structure. The PDPH domain at the beginning of the second similarity domain was predicted to form random coils. In addition, the mouse, Drosophila, Caenorhabditis and the Arabidopsis proteins were predicted to contain nuclear localization signals at the C terminus, in a region where the primary structure contains only a few similar amino acid residues. The other sequences did not extend far enough C-terminally to include this region. At its N terminus, TBN showed similarity to several transcription factors and histones, suggesting that this might be a DNA-binding domain. In contrast, PRODOS and the two hypothetical proteins did not contain such sequences.

Searches through all available databases did not yield any other proteins with the PDPH domain. Therefore, we conclude that the TBN-related proteins are distinct from all previously described protein families.

Expression pattern of taube nuss

Northern analysis showed low levels of Tbn mRNA in ES cells and E12.5 embryo, and even lower levels in E12.5 placenta and adult brain. The northern blot shown in Fig. 1B was exposed for 14 days. Low β-galactosidase activity was first detected in compacted morulae at E2.5 when all blastomeres were staining uniformly (Fig. 3A). Comparison of β-galactosidase staining and Tbn-specific in situ hybridisation showed that the reporter activity generally reflected the endogenous expression pattern (Fig. 3, compare C with F). At E3.5 the inner cell mass stained more strongly than the trophectoderm (Fig. 5A). At E6.5, 7.5 and 8.5, uniform low level Tbn expression and β-galactosidase activity were observed throughout all tissues of the embryos (E6.5 shown in Fig. 3B, E8.5 shown in Fig. 3C,E). All radioactive in situ hybridisations shown in Fig. 3 were exposed for 2 weeks. The level of expression of Tbn was low, but could be distinguished from background (compare Fig. 3E with 3F). From E9.5 onwards, somewhat higher level of β-galactosidase activity were observed in the developing heart (E11.5 shown in Fig. 3G), which did not reflect an increase in mRNA levels (compare Fig. 3G with 3H). Tbn mRNA was detectable at a low levels in adult brain (Fig. 1B) and β-galactosidase activity was observed in adult brain primarily in the hippocampus and not in tissues outside the brain. In situ hybridisation of adult brain showed low level expression throughout the brain and slightly higher expression in the hippocampus (Fig. 3J). From this expression analysis we concluded that the Tbn gene was expressed ubiquitously at very low levels throughout embryonic development. Some tissues like the inner cell mass, the developing heart and the adult hippocampus appeared to generate higher levels of the TBN66/β-gal/neo fusion protein, possibly reflecting differences in turnover in these tissues.

Fig. 3.

Expression pattern of Tbn. Embryos recovered from matings involving 1 or 2 Tbngt/+ heterozygous parents stained for activity of the β-galactosidase reporter gene (A,C,G), or paraffin sections of wild-type embryos (B,D-F,H,I) or adult brain (J,K) hybridised in situ with a Tbn-specific cRNA probe (probe 2 in Fig. 1A) or a sense control probe (F). Bright-field images (B,D,I,K) and dark-field images (E,F,H,J). (A) E2.5 embryos, (B) E6.5 embryo, (C) E8.5 embryo, (D,E) E8.5, Tbn-specific probe, (F) E8.5, sense control, (G) E11.5 embryo, (H,I) E11.5, Tbn-specific probe, (J,K) Adult brain, dentate gyrus and hippocampus, Tbn-specific probe. Note the uniform expression of the Tbn gene as judged by in situ hybridisation, which was distinguishable from background (compare E with F). In contrast, the β-galactosidase activity was not as uniform. It was higher in E11.5 heart (G). Asterisk marks blood, which causes nonspecific background in dark field, arrow marks β-galactosidase-positive embryos. al, allantois; dg dentate gyrus; drg, dorsal root ganglia; e, embryonic ectoderm; ee, extra-embryonic ectoderm; fb, forebrain; hb, hindbrain; he, heart, hf, headfolds; hi, hippocampus; li, liver; pc, proamniotic cavity; so, somites. Scale bars: 63 μm (A), 35 μm (B), 450 μm (C), 440 μm (D-F), 1.5 mm (G-I), 430 μm (J,K).

Fig. 3.

Expression pattern of Tbn. Embryos recovered from matings involving 1 or 2 Tbngt/+ heterozygous parents stained for activity of the β-galactosidase reporter gene (A,C,G), or paraffin sections of wild-type embryos (B,D-F,H,I) or adult brain (J,K) hybridised in situ with a Tbn-specific cRNA probe (probe 2 in Fig. 1A) or a sense control probe (F). Bright-field images (B,D,I,K) and dark-field images (E,F,H,J). (A) E2.5 embryos, (B) E6.5 embryo, (C) E8.5 embryo, (D,E) E8.5, Tbn-specific probe, (F) E8.5, sense control, (G) E11.5 embryo, (H,I) E11.5, Tbn-specific probe, (J,K) Adult brain, dentate gyrus and hippocampus, Tbn-specific probe. Note the uniform expression of the Tbn gene as judged by in situ hybridisation, which was distinguishable from background (compare E with F). In contrast, the β-galactosidase activity was not as uniform. It was higher in E11.5 heart (G). Asterisk marks blood, which causes nonspecific background in dark field, arrow marks β-galactosidase-positive embryos. al, allantois; dg dentate gyrus; drg, dorsal root ganglia; e, embryonic ectoderm; ee, extra-embryonic ectoderm; fb, forebrain; hb, hindbrain; he, heart, hf, headfolds; hi, hippocampus; li, liver; pc, proamniotic cavity; so, somites. Scale bars: 63 μm (A), 35 μm (B), 450 μm (C), 440 μm (D-F), 1.5 mm (G-I), 430 μm (J,K).

Subcellular localization of the taube nuss protein

Tbngt/+ ES cells were stained for β-galactosidase activity. The reporter gene activity was detected in the cytoplasm of most cells and in the nucleus of some cells (Fig. 4A). Nuclear localization of the TBN66/β-gal/neo fusion protein appeared to be correlated with specific cell types growing in monolayers, whereas cytoplasmic localization occurred in cells growing non-contact inhibited. This finding was unexpected, as the TBN66/β-gal/neo fusion protein did not contain the putative nuclear localization signal. As the β-gal/neo fusion protein alone was not transported into cell nuclei, the first 66 amino acids of TBN must have directed transport of the fusion protein into the nuclei possibly by association with a nuclear protein. To investigate where the full-length TBN protein localized, we cloned the protein coding region of Tbn in frame with a six Myc epitopes tag and transfected the fusion construct into COS7 or NIH3T3 cells. As was the case with the TBN66/β-gal/neo, the TBN/6MYC fusion protein was found in the nucleus in some COS7 cells and in the cytoplasm in others (Fig. 4B,D). In NIH3T3 cells TBN/6MYC was predominantly localized in the cytoplasm (data not shown).

Fig. 4.

Subcellular localization of TBN protein. (A) β-galactosidase staining of Tbngt/+ ES cells. (B,D,F) Myc immunocytochemistry of COS7 cells transfected with a construct coding for a TBN/6MYC fusion protein (B,D) or the 6MYC tags alone (F). (C,E,G) nuclear stain DAPI. Note the localization of the Myc immunofluorescence to the nuclei (arrowhead) or the cytoplasm (arrow) in B, and the nuclei in D and the cytoplasm in F. The TBN66/β-gal/neo fusion protein was found in the nucleus of some cells (arrow, A) and in the cytoplasm of others (A). Scale bars: 30 μm (A), 24 μm (B,C,F,G), 15 μm (D,E).

Fig. 4.

Subcellular localization of TBN protein. (A) β-galactosidase staining of Tbngt/+ ES cells. (B,D,F) Myc immunocytochemistry of COS7 cells transfected with a construct coding for a TBN/6MYC fusion protein (B,D) or the 6MYC tags alone (F). (C,E,G) nuclear stain DAPI. Note the localization of the Myc immunofluorescence to the nuclei (arrowhead) or the cytoplasm (arrow) in B, and the nuclei in D and the cytoplasm in F. The TBN66/β-gal/neo fusion protein was found in the nucleus of some cells (arrow, A) and in the cytoplasm of others (A). Scale bars: 30 μm (A), 24 μm (B,C,F,G), 15 μm (D,E).

We concluded from these results that TBN was primarily localized in the cytoplasm and transported from the cytoplasm to the nucleus in some cells, possibly depending on the functional or developmental state of the cell.

The Tbngt/gt mutant phenotype in vivo

The Tbngt allele was transmitted through the male (n=50) and the female (n=50) germ line in a 1 to 1 ratio, with the wild-type allele indicating that both, Tbngt spermatozoa and Tbngt oocytes developed normally, were viable, capable of fertilisation and able to contribute to the formation of heterozygous animals. The Tbngt/+ heterozygous animals were morphologically normal. Their differential blood cell counts and blood chemistry, including their blood glucose levels were normal.

A total of 183 offspring of heterozygous intercrosses were analysed for the distribution of the Tbngt allele. Homozygous animals or embryos were not detected by Tbn-specific Southern analysis (Fig. 1C) in 89 offspring of Tbngt/+ heterozygous intercrosses at 3 weeks of age, E15.5, E12.5, E9.5 and E8.5 (Table 1). At E6.5 and E7.5, no embryos staining twice the intensity for β-galactosidase activity were observed (n=31). At E2.5 and E3.5 21% of the embryos exhibited double the intensity of β-galactosidase staining as heterozygous embryos (Fig. 5A, n=63). At E4.0 and E4.5, six of 29 embryos were devoid of an inner cell mass (Fig. 5, compare B with C). At E5.0 and E5.5 eight of 23 implantation sites were smaller and did not contain structures resembling an embryo proper (Fig. 5, compare D with E). Furthermore, at E5.5 they were fragile and ruptured easily (Fig. 5, compare F with G). From this we concluded that, although an inner cell mass was present in Tbngt/gt homozygous embryos at E3.5, it failed to develop beyond E3.5 in vivo. In contrast, trophoblast cells devoid of an inner cell mass were visible at E4.0 and elicited a decidual response. No differences in the mutant phenotype were observed on a mixed genetic background (inbred 129Sv, C57Bl6, and outbred NMRI) compared with a genetic background enriched for the inbred strain C57Bl6.

Table 1.

Distribution of the mutant Tbngt allele among offspring of heterozygous intercrosses

Distribution of the mutant Tbngt allele among offspring of heterozygous intercrosses
Distribution of the mutant Tbngt allele among offspring of heterozygous intercrosses
Fig. 5.

Phenotype of Tbngt/gt mutant embryos. (A) β-galactosidase staining of E3.5 embryos recovered from Tbngt/+ heterozygous intercrosses. The arrows point to two embryos showing twice the intensity of β-galactosidase staining as heterozygous embryos. These embryos were considered homozygous. (B-G) Haematoxylin and Eosin stained sections of uteri (B,C, E4.0; D,E, E5.0) or deciduae (F,G, E5.5) of Tbngt/+ heterozygous intercrosses. Mutant morphology is shown in B,D,F; normal morphology is shown in C,E,G. Note that the strongly staining homozygous embryos in A exhibit normal E3.5 morphology including inner cell masses. In contrast, at E4.0 embryos without an inner cell mass were observed (B), although trophoblast cells are present. At E5.0 no structure resembling an embryo proper could be detected and trophoblast cells had collapsed (compare D with E). At E5.5 no embryo was visible (compare F with G). e, ectoderm; ec, ectoplacental cone; ee, extra-embryonic ectoderm; icm, inner cell mass; te, trophectoderm. Scale bars: 64 μm (A), 20 μm (B,C), 50 μm (D,E), 45 μm (F,G).

Fig. 5.

Phenotype of Tbngt/gt mutant embryos. (A) β-galactosidase staining of E3.5 embryos recovered from Tbngt/+ heterozygous intercrosses. The arrows point to two embryos showing twice the intensity of β-galactosidase staining as heterozygous embryos. These embryos were considered homozygous. (B-G) Haematoxylin and Eosin stained sections of uteri (B,C, E4.0; D,E, E5.0) or deciduae (F,G, E5.5) of Tbngt/+ heterozygous intercrosses. Mutant morphology is shown in B,D,F; normal morphology is shown in C,E,G. Note that the strongly staining homozygous embryos in A exhibit normal E3.5 morphology including inner cell masses. In contrast, at E4.0 embryos without an inner cell mass were observed (B), although trophoblast cells are present. At E5.0 no structure resembling an embryo proper could be detected and trophoblast cells had collapsed (compare D with E). At E5.5 no embryo was visible (compare F with G). e, ectoderm; ec, ectoplacental cone; ee, extra-embryonic ectoderm; icm, inner cell mass; te, trophectoderm. Scale bars: 64 μm (A), 20 μm (B,C), 50 μm (D,E), 45 μm (F,G).

Chimaeric analysis of the Tbn mutant phenotype

To investigate if Tbngt/gt cells were capable of a normal interaction with wild-type cells, E2.5 embryos recovered from Tbngt/+ heterozygous intercrosses were labelled with the fluorescent tracer DiI and aggregated 1:1 with unlabelled wild-type E2.5 embryos (n=35, Fig. 6A). After 24 hours of in vitro culture, 98% of the aggregates had formed chimaeric blastocysts, exhibiting thorough mixing of the two aggregation partners (Fig. 6B,C). The remaining 2% had failed to aggregate so that both embryos formed blastocysts independently. From this we concluded that at E2.5 and E3.5 Tbngt/gt cells were not developmentally compromised and did not segregate from wild-type cells.

Fig. 6.

The development of mutant embryos after aggregation with wild-type embryos and in explant cultures of E3.5 embryos. (A-C) embryos from Tbngt/+ heterozygous intercrosses were recovered at E2.5, labelled with DiI and aggregated with unlabelled wild-type embryos. (A) Schematic drawing of the experimental procedure; (B) fluorescence image and (C) bright-field image of a chimaeric embryo exhibiting the morphology seen in 98% of the cases. The genotype of the aggregation partner derived from the heterozygous intercrosses was not assessed. The uniform result suggested no differences between mutants and controls in this assay. Note the thorough mixing of labelled and unlabelled cells that was observed in all cases. (D-F) Embryos from Tbngt/+ heterozygous intercrosses were recovered at E3.5 and cultured in ES cell derivation medium. (D) Experimental approach. Normal (E) and mutant (F) morphology, both after 3 days in culture. Note the prominent inner cell mass outgrowth on a patch of trophoblast cells in E, the lack of an inner cell mass outgrowth and dead or dying cells in F, whereas the trophoblast cells are comparable with those in E. Scale bars: 25 μm (B,C), 100 μm (E,F).

Fig. 6.

The development of mutant embryos after aggregation with wild-type embryos and in explant cultures of E3.5 embryos. (A-C) embryos from Tbngt/+ heterozygous intercrosses were recovered at E2.5, labelled with DiI and aggregated with unlabelled wild-type embryos. (A) Schematic drawing of the experimental procedure; (B) fluorescence image and (C) bright-field image of a chimaeric embryo exhibiting the morphology seen in 98% of the cases. The genotype of the aggregation partner derived from the heterozygous intercrosses was not assessed. The uniform result suggested no differences between mutants and controls in this assay. Note the thorough mixing of labelled and unlabelled cells that was observed in all cases. (D-F) Embryos from Tbngt/+ heterozygous intercrosses were recovered at E3.5 and cultured in ES cell derivation medium. (D) Experimental approach. Normal (E) and mutant (F) morphology, both after 3 days in culture. Note the prominent inner cell mass outgrowth on a patch of trophoblast cells in E, the lack of an inner cell mass outgrowth and dead or dying cells in F, whereas the trophoblast cells are comparable with those in E. Scale bars: 25 μm (B,C), 100 μm (E,F).

To investigate, if the death of the inner cell mass cells was only secondary to a defect in the trophectoderm, we generated chimeric concepti consisting of 91 embryos recovered from heterozygous intercrosses and 91 tetraploid embryos that were wild type at the Tbn locus. Tetraploid embryos, with rare exceptions, are incapable of forming the embryo proper, but are capable of forming the extra-embryonic tissues. In a chimaeric embryo proper, 15% or less of the cells are of tetraploid origin (Nagy and Rossant, 1993), whereas tetraploid cells can rescue lethal functional insufficiencies of the trophoblast (Guillemot et al., 1994). If the Tbn mutant trophoblast was the primary site of the defect we would expect to be able to generate homozygous E9.5 embryos, if we supplied them with tetraploid trophoblast. We recovered 25 embryos after tetraploid aggregation. None of these, or their yolk sacs were homozygous for the Tbngt allele. Heterozygous and wild type were present in a ratio of about 2:1 (16 and 9, respectively). We concluded from this that trophoblast that is wild type at the Tbn locus is unable to rescue the Tbngt/gt mutant phenotype.

The Tbngt/gt mutant phenotype in vitro

E3.5 embryos recovered from Tbn heterozygous Tbngt/+ intercrosses were cultured in ES cell derivation medium (n=97, Fig. 6D). All 97 embryos were either blastocysts at the time of recovery or developed to blastocysts within 12 hours of culture. They all hatched from the zona pellucida and attached to the substrate. 75 embryos (77%) formed prominent inner cell mass outgrowth on a flat patch of trophectoderm cells typical for such cultures (Fig. 6E). The remaining 22 (23%) failed to form an inner cell mass outgrowth. Instead, the inner cell mass cells initially present from the E3.5 embryos plated died over a period of 3 days in culture, rounded up and detached from the flat patch of trophectoderm present in all cultures (Fig. 6F). Addition of FGF4 to the culture medium in similar cultures did not result in cell proliferation from Tbn mutant embryos. In cultures of control embryos performed in parallel, all blastocysts formed inner cell mass outgrowths (n=189). Southern analysis showed that the viable inner cell mass outgrowths were either heterozygous for the gene trap insertion or wild type at the Tbn locus. Heterozygotes and wild type were present in a ratio of about 2:1 among the viable cultures (n=63, 40 and 23, respectively). From these findings in vitro and from the observed phenotypic abnormalities in vivo we concluded that TBN is essential for the survival of the pluripotent inner cell mass cells, but not for the survival of trophectoderm cells.

Expression of FGF4 and OCT4 in Tbn mutant embryos and Tbn expression in Oct4 mutant embryos

The Tbn mutant phenotype was similar to that found in embryos lacking the POU domain transcription factor OCT4 (POU5F1 – Mouse Genome Informatics), which fail to form an inner cell mass. Oct4 mutants show a reduction in Fgf4 expression. Therefore, we investigated if the FGF4 and the OCT4 proteins were present at normal levels in embryos of Tbngt/+ heterozygous intercrosses. In this experiment we looked at a mixed population of embryos that were homozygous, heterozygous or wild type for the Tbn mutation. At E3.5 we did not observe any changes in immunostaining for either FGF4 (Fig. 7C) or OCT4 (Fig. 8C). In contrast, at E4.0 one quarter of the embryos showed a reduction in both FGF4 (Fig. 7, compare I with F) and Oct4 (Fig. 8, compare I with F) immunoreactivity. However, the levels of immunoreactivities were normal at E3.5, and the major site of FGF4 and OCT4 production, namely the inner cell mass, was almost absent from the E4.0 embryos (see Fig. 7, compare H with E; and Fig. 8, compare H with E). Therefore, we conclude that the lack of staining is not due to a regulatory link between Tbn and Oct4 or Fgf4, but due to the rather substantial reduction in the number of cells producing these factors.

Fig. 7.

FGF4 immunocytochemistry of E3.5 and E4.0 embryos of Tbngt/+ heterozygous intercrosses. (A,D,G) Phase contrast, (B,E,H) nuclear stain Hoechst 33258 and (C,F,I) FGF4 immunofluorescence image of the same embryos. Mutant and control embryos were indistinguishable and stained strongly for FGF4 at E3.5 (C). (D-F) Normal morphology and FGF4 staining at E4.0. (G-I) Mutant morphology and FGF4 staining at E4.0. Note that the inner cell mass is clearly visible as a densely packed group of cells in B and E, which stains strongly for FGF4 in the cytoplasm, the lack of most of the inner cell mass in H and the reduced FGF4 staining in I. Scale bars: 27 μm.

Fig. 7.

FGF4 immunocytochemistry of E3.5 and E4.0 embryos of Tbngt/+ heterozygous intercrosses. (A,D,G) Phase contrast, (B,E,H) nuclear stain Hoechst 33258 and (C,F,I) FGF4 immunofluorescence image of the same embryos. Mutant and control embryos were indistinguishable and stained strongly for FGF4 at E3.5 (C). (D-F) Normal morphology and FGF4 staining at E4.0. (G-I) Mutant morphology and FGF4 staining at E4.0. Note that the inner cell mass is clearly visible as a densely packed group of cells in B and E, which stains strongly for FGF4 in the cytoplasm, the lack of most of the inner cell mass in H and the reduced FGF4 staining in I. Scale bars: 27 μm.

Fig. 8.

OCT4 immunocytochemistry of E3.5 and E4.0 embryos of Tbngt/+ heterozygous intercrosses. (A,D,G) phase contrast, (B,E,H) nuclear stain Hoechst 33258, and (C,F,I) Oct4 immunofluorescence image of the same embryos Mutant and control embryos stained strongly for OCT4 at E3.5 and were indistinguishable (A-C). (D-F) Normal morphology and OCT4 staining at E4.0. (G-I) Mutant morphology and OCT4 staining at E4.0. Note that the inner cell mass is clearly visible as a densely packed group of cells in B and E, which stains strongly for nuclear OCT4, the lack of most of the inner cell mass in H and the reduced Oct4 staining in I. Scale bars: 24 μm.

Fig. 8.

OCT4 immunocytochemistry of E3.5 and E4.0 embryos of Tbngt/+ heterozygous intercrosses. (A,D,G) phase contrast, (B,E,H) nuclear stain Hoechst 33258, and (C,F,I) Oct4 immunofluorescence image of the same embryos Mutant and control embryos stained strongly for OCT4 at E3.5 and were indistinguishable (A-C). (D-F) Normal morphology and OCT4 staining at E4.0. (G-I) Mutant morphology and OCT4 staining at E4.0. Note that the inner cell mass is clearly visible as a densely packed group of cells in B and E, which stains strongly for nuclear OCT4, the lack of most of the inner cell mass in H and the reduced Oct4 staining in I. Scale bars: 24 μm.

In order to investigate if Tbn expression was regulated by OCT4 we analysed expression of Tbn in E3.5 embryos of Oct4+/-heterozygous intercrosses by radioactive RT-PCR. We amplified β-actin mRNA in the same reaction (n=76). We observed that Oct4 mutant embryos expressed Tbn. Those Oct4 mutant embryos that already appeared retarded in development at E3.5 showed reduced levels of Tbn mRNA. However, as the changes in morphology were observed at the same time as the reduction in Tbn mRNA it was not likely that OCT4 regulated Tbn. The potential presence of maternal Tbn mRNA complicates the analysis of a possible regulatory interplay between TBN and OCT4.

The Tbn mutant inner cell mass cells die of apoptosis

To elucidate the mode of death of the inner cell mass cells of Tbn mutant embryos we performed terminal deoxynucleotide transferase-mediated dUTP-digoxigenin nick-end labelling (TUNEL) on E3.75 embryos recovered from Tbngt/+ heterozygous intercrosses. In this experiment, we looked at a mixed population of embryos that were homozygous, heterozygous or wild type for the Tbn mutation. We observed an increase in TUNEL-positive cells in 22 of 32 embryos, as compared with embryos recovered from intercrosses of animals wild type at the Tbn locus (n=36). 90% of the embryos from wild-type intercrosses had between zero and three TUNEL-positive cells. Ten embryos from heterozygous mutant intercrosses had between zero and three, 15 had five to nine and seven had 11 to 15 TUNEL-positive cells (Fig. 9F versus 9C; Fig. 10). We interpret the three populations showing zero to three, five to nine and 11 to 15 apoptotic cells per embryo to represent wild-type, heterozygous, and homozygous mutant embryos. The putative group of heterozygous embryos (with five to nine apoptotic cells per embryo) showed the tendency of an increase in rate of mitosis (2.8-fold), which possibly compensated for the increase in apoptosis. The positive fluorescence by TUNEL coincided with condensed chromatin visualised by Hoechst 33258 staining. A total of 43 embryos recovered from heterozygous mutant intercrosses were examined for condensed chromatin using the Hoechst stain between E3.5 and E4.0. While the rate of cells with visible chromatin condensation was normal at E3.5, at E4.0 three of 14 embryos did not contain a visible inner cell mass, exhibited massive cell death and only had half the number of total cells of the controls (66±9.7 versus 136±13.1; P≤0.01). Furthermore, fragmentation of cells into membrane-enclosed bodies containing DNA, resembling apoptotic bodies, was observed.

Fig. 9.

TUNEL and activated caspase 3 immunocytochemistry of E3.75 embryos of Tbngt/+ heterozygous intercrosses. (A,D,G) phase contrast, (B,E,H) nuclear stain Hoechst 33258 and (C,F) TUNEL of the embryos in A,B and D,E, respectively. (I) caspase 3 immunofluorescence image of the embryo in G,H. Note the presence of cells staining prominently by TUNEL in F. A cell with condensed chromatin is indicated with an arrow in H. The same cell stained strongly for activated caspase 3 in I (arrow). Scale bars: 15 μm.

Fig. 9.

TUNEL and activated caspase 3 immunocytochemistry of E3.75 embryos of Tbngt/+ heterozygous intercrosses. (A,D,G) phase contrast, (B,E,H) nuclear stain Hoechst 33258 and (C,F) TUNEL of the embryos in A,B and D,E, respectively. (I) caspase 3 immunofluorescence image of the embryo in G,H. Note the presence of cells staining prominently by TUNEL in F. A cell with condensed chromatin is indicated with an arrow in H. The same cell stained strongly for activated caspase 3 in I (arrow). Scale bars: 15 μm.

Fig. 10.

Numerical distribution of TUNEL-positive cells among Tbn mutant embryos. Numbers of TUNEL-positive cells in 32 embryos recovered at E3.75 from Tbngt/+ heterozygous intercrosses (black) and 36 embryos of wild-type matings (grey). Note that the majority (90%) of wild type embryos had 0 to 3 TUNEL positive cells, whereas the embryos of mutant crosses segregated into three groups, 0 to 3, 5 to 9, and 11 to 15 TUNEL-positive cells per embryo.

Fig. 10.

Numerical distribution of TUNEL-positive cells among Tbn mutant embryos. Numbers of TUNEL-positive cells in 32 embryos recovered at E3.75 from Tbngt/+ heterozygous intercrosses (black) and 36 embryos of wild-type matings (grey). Note that the majority (90%) of wild type embryos had 0 to 3 TUNEL positive cells, whereas the embryos of mutant crosses segregated into three groups, 0 to 3, 5 to 9, and 11 to 15 TUNEL-positive cells per embryo.

To investigate if the Tbn mutant embryos fulfilled other criteria of death by apoptosis we examined the integrity of the cell membrane by Trypan Blue exclusion and found that at E3.75 the mutant embryos excluded the dye as did the wild-type controls (data not shown).

To examine the apoptotic pathway involved in the death of the Tbn mutant inner cell mass cells, we stained E3.75 embryos recovered from Tbngt/+ heterozygous intercrosses with an antibody (67341A; Pharmingen) that preferentially recognises the activated form of caspase 3. We clearly detected caspase 3-positive cells and strong staining coincided with cells showing chromatin condensation (Fig. 9H,I). In addition, we also saw low levels of immunoreactivity in all other cells. This suggests that caspase 3 is activated in E3.75 embryos and that Tbn mutant embryos may die by apoptosis using a caspase 3-mediated pathway.

In this study we reported the isolation and characterization of a novel gene, taube nuss, and its loss-of-function phenotype in mice. The TBN66/β-gal/neo and TBN/6MYC fusion proteins appeared to be primarily localized in the cytoplasm, although nuclear translocation was observed in specific cell types in vitro. As the TBN66/β-gal/neo fusion protein had lost its nuclear localization signal, nuclear translocation did not appear to be dependent on the putative nuclear localization signal. It may potentially occur through interaction with another protein. TBN was essential for early embryonic development, specifically for the survival of the inner cell mass of E3.75 blastocysts. The inner cell mass cells of mutant embryos died of apoptosis. As inner cell mass cells are a transient pluripotent stem cell population for the embryo proper and some extra-embryonic tissues, an interesting possibility is that TBN might also be important for the survival of other stem cell populations later in development. However, the early embryonic lethality precluded the study of a requirement of TBN at later stages. TBN mutant cells participated in the formation of chimaeric preimplantation embryos. The observation that aggregation with tetraploid wild-type embryos did not rescue the mutant phenotype indicates that the defect resides in the inner cell mass and not in the trophoblast.

Only two proteins, OCT4 and FGF4, have so far been identified as being essential for the development of the inner cell mass. The Oct4 mutant embryos fail to develop an inner cell mass beyond E3.5. However, the Oct4 mutant embryo cells are able to survive in culture when supplemented with FGF4 and to give rise to extra-embryonic ectoderm-like cells (Nichols et al., 1998). In contrast, the Tbn mutant inner cell mass cells did not survive under the same culture conditions. At E3.5 the Tbn mutant embryos were morphologically indistinguishable from control embryos, whereas the Oct4 mutant embryos already appeared to be delayed in development as they rarely formed expanded blastocysts. This indicates that either the OCT4 protein is required earlier than the TBN protein or that the maternal mRNA and/or protein of Tbn is longer lived than maternal Oct4 mRNA or protein. OCT4 protein is expressed normally in Tbn mutant embryos at E3.5, indicating that TBN is not required for Oct4 expression and, as TBN is expressed in Oct4 mutants, this suggests there may not be a functional relationship between the two proteins. OCT4 appears to be necessary for the maintenance and, probably, also for the establishment of the inner cell mass lineage, but not for cell survival. In contrast, TBN is essential for the survival of the inner cell mass cells. Oct4 mutant embryos were found to express a reduced amount of Fgf4 mRNA. Fgf4 mutant embryos, similar to Oct4 and the Tbn mutants, fail to develop an embryo proper. However, some of the Fgf4 mutant embryos show small disorganised embryonic compartments at E5.5 (Feldman et al., 1995). Some Fgf4 mutant embryos exhibited some proliferation of the inner cell masses in vitro even if severely impaired, whereas Tbn mutant inner cell masses died in culture. This indicates that either FGF4 is essential for the embryo proper about a day later than TBN or that maternal FGF4 is available longer than maternal TBN. FGF4 is expressed in Tbn mutant mice, showing that TBN is not required for FGF4 expression.

Apoptosis has been reported previously to occur at a frequency of 10% or less of the cells in the inner cell masses of blastocysts (Smith and Wilson, 1971; Copp, 1978; Handyside and Hunter, 1986; Pierce et al., 1989; Brison and Schultz, 1997). Criteria used to judge apoptosis in blastocyst cells are chromatin condensation and DNA fragmentation. Chromatin condensation and DNA fragmentation can occur via a caspase-dependent or a caspase-independent pathway (Susin et al., 1999). In the caspase-dependent pathway, caspase 3 is one of last the effector components. It inactivates the inhibitor of caspase activated DNase (ICAD), which leads to an activation of caspase-activated DNase (CAD) and the fragmentation of DNA (Enari et al., 1998). Caspase 3 also activates acinus which results in chromatin condensation (Sahara et al., 1999). We show here that at least some of the dying cells appear to contain activated caspase 3. Therefore, apoptosis occurring in the inner cell mass may involve activation of caspase 3. Consequently, the caspase-dependent pathway of apoptosis occurs in blastocysts. This, however, does not rule out other pathways of cell death also being important.

As the Tbn mutant inner cell masses died by apoptosis the question arises of whether TBN is directly involved in the regulation of apoptosis or if these embryos die of apoptosis as a consequence of some severe defect directly caused by the absence of TBN, for example, a metabolic defect. As TBN mutant trophectoderm cells survive in culture for at least one week after the death of the inner cell masses, we can exclude the possibility that TBN is essential for some general cell function. We cannot exclude the possibility that TBN is essential for a process specific for the inner cell mass lineage and not required in the trophoblast lineage. Increased incidents of apoptosis in the inner cell mass have been reported in blastocysts that developed under suboptimal conditions, for example in blastocysts isolated from diabetic rats (Pampfer et al., 1997) or cultured in vitro (Brison and Schultz, 1997).

Alternatively, TBN could be a negative regulator of apoptosis. As noted above, apoptosis occurs as a normal part of preimplantation embryonic development (Smith and Wilson, 1971; Copp, 1978; Handyside and Hunter, 1986). If apoptosis occurs in some cells and not in others, there is presumably a mechanism that protects those cells that do not undergo apoptosis. TBN could possible be involved in such a mechanism. Amino acid sequence comparison did not reveal any similarity of TBN or the TBN-related proteins to known anti-apoptotic proteins of the Bcl2 family, the inhibitors of apoptosis (IAP, Duckett et al., 1996) or the ICADs. Therefore, in the case of an involvement of TBN in the regulation of apoptosis, the TBN-related proteins would constitute a new group of proteins involved in this important process. It is noteworthy in this context that those of the known anti-apoptotic proteins that have been studied in mutant mice do not appear to be required for the regulation of apoptosis in early stages of development in blastocysts or during the formation of the proamniotic cavity. Deletion of Bcl2 is compatible with life after birth at least for some time (Veis et al., 1993). Bclx/ mutant embryos die at E13 and exhibit massive cell death in neural tissues (Motoyama et al., 1995). Bclw-/-mutant mice are viable, but show fertility defects (Print et al., 1998; Ross et al., 1998). If TBN was involved in the regulation of apoptosis, Tbn would so far be the first gene to be necessary to avoid apoptosis in development.

Interestingly, activity of the reporter gene was high not only in the inner cell mass, where TBN protein is clearly required for cell survival, but also in the developing heart. Programmed cell death occurs in the developing heart and is though to be a mechanism of shaping this organ. The dying cells exhibit apoptotic morphology (reviewed by Sanders and Wride, 1995). An intriguing idea is that TBN may be involved in the regulation of this process.

In conclusion, we report here the identification of a novel gene, Tbn, essential for the survival of the inner cell mass cells of murine blastocysts. TBN is the founding member of a new group of proteins which show domains highly conserved between chordata, arthropoda, nematoda and streptophyta, suggesting a similar importance of the TBN-related proteins in these phyla.

We gratefully appreciate the excellent technical assistance of Marion Stäger, Victor Diaz, Gudrun Weinrich and Andrea Conrad. We thank W. Skarnes for providing pGT1.8geo. A. K. V. was supported by a fellowship of the Deutsche Forschungsgemeinschaft. T. T. was supported by an EMBO fellowship. This research was funded by AmGen Inc. and the Max Planck Society.

Brison
,
D. R.
and
Schultz
,
R. M.
(
1997
).
Apoptosis during mouse blastocyst formation: evidence for a role for survival factors including transforming growth factor alpha
.
Biol. Reprod
.
56
,
1088
1096
.
Chautan
,
M.
,
Chazal
,
G.
,
Cecconi
,
F.
,
Gruss
,
P.
and
Goldstein
,
P.
(
1999
).
Interdigital cell death can occur through a necrotic and caspase-independent pathway
.
Curr. Biol
.
9
,
967
970
.
Copp
,
A. J.
(
1978
).
Interaction between inner cell mass and trophectoderm of the mouse blastocyst. I. A study of cellular proliferation
.
J. Embryol. Exp. Morphol
.
48
,
109
125
.
Coucouvanis
,
E.
and
Martin
,
G. R.
(
1995
).
Signals for death and survival: a two-step mechanism for cavitation in the vertebrate embryo
.
Cell
83
,
279
287
.
Duckett
,
C. S.
,
Nava
,
V. E.
,
Gedrich
,
R. W.
,
Clem
,
R. J.
,
Van Dongen
,
J. L.
,
Gilfillan
,
M. C.
,
Shiels
,
H.
,
Hardwick
,
J. M.
and
Thompson
,
C. B.
(
1996
).
A conserved family of cellular genes related to the baculovirus iap gene and encoding apoptosis inhibitors
.
EMBO J
.
15
,
2685
2694
.
Enari
,
M.
,
Sakahira
,
H.
,
Yokoyama
,
H.
,
Okawa
,
K.
,
Iwamatsu
,
A.
and
Nagata
,
S.
(
1998
).
A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD
.
Nature
391
,
43
50
.
Exley
,
G. E.
,
Tang
,
C.
,
McElhinny
,
A. S.
and
Warner
,
C. M.
(
1999
).
Expression of caspase and BCL-2 apoptotic family members in mouse preimplantation embryos
.
Biol. Reprod
.
61
,
231
239
.
Feldman
,
B.
,
Poueymirou
,
W.
,
Papaioannou
,
V. E.
,
DeChiara
,
T. M.
and
Goldfarb
,
M.
(
1995
).
Requirement of FGF-4 for postimplantation mouse development
.
Science
267
,
246
249
.
Guillemot
,
F.
,
Nagy
,
A.
,
Auerbach
,
A.
,
Rossant
,
J.
and
Joyner
,
A. L.
(
1994
).
Essential role of Mash-2 in extraembryonic development
.
Nature
371
,
333
336
.
Handyside
,
A. H.
and
Hunter
,
S.
(
1986
).
Cell division and death in the mouse blastocyst before implantation
.
Wilhelm Roux’s Arch. Dev. Biol
.
195
,
519
526
.
Hogan
,
B.
,
Beddington
,
R.
,
Constantini
,
F.
and
Lacy
,
E.
(
1994
).
Manipulating the Mouse Embryo: A Laboratory Manual
.
New York
:
Cold Spring Harbor Laboratory Press
.
Jurisicova
,
A.
,
Latham
,
K. E.
,
Casper
,
R. F.
and
Varmuza
,
S. L.
(
1998
).
Expression and regulation of genes associated with cell death during murine preimplantation embryo development
.
Mol. Reprod. Dev
.
51
,
243
253
.
King
,
R. D.
and
Sternberg
,
M. J.
(
1996
).
Identification and application of the concepts important for accurate and reliable protein secondary structure prediction
.
Protein Sci
.
5
,
2298
2310
.
Kozak
,
M.
(
1989
).
The scanning model for translation: an update
.
J. Cell Biol
.
108
,
229
241
.
Motoyama
,
N.
,
Wang
,
F.
,
Roth
,
K. A.
,
Sawa
,
H.
,
Nakayama
,
K.
,
Negishi
,
I.
,
Senju
,
S.
,
Zhang
,
Q.
,
Fujii
,
S.
and et al. 
. (
1995
).
Massive cell death of immature hematopoietic cells and neurons in Bcl-x-deficient mice
.
Science
267
,
1506
1510
.
Nagy
,
A.
and
Rossant
,
J.
(
1993
).
Production of completely ES cell-derived fetuses
. In
Gene Targeting. A Practical Approach
(ed.
A. L.
Joyner
), pp.
147
-
178
. Oxford: IRL press.
Nichols
,
J.
,
Zevnik
,
B.
,
Anastassiadis
,
K.
,
Niwa
,
H.
,
Klewe-Nebenius
,
D.
,
Chambers
,
I.
,
Scholer
,
H.
and
Smith
,
A.
(
1998
).
Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4
.
Cell
95
,
379
91
.
Palmieri
,
S.
,
Peter
,
W.
,
Hess
,
H.
and
Schöler
,
H.
(
1994
).
Oct-4 transcription factor is differentially expressed in the mouse embryo during establishment of the first two extraembryonic cell lineages involved in implantation
.
Dev. Biol
.
166
,
259
267
.
Pampfer
,
S.
and
Donnay
,
I.
(
1999
).
Apoptosis at the time of embryo implantation in mouse and rat
.
Cell Death Differ
.
6
,
533
545
.
Pampfer
,
S.
,
Vanderheyden
,
I.
,
McCracken
,
J. E.
,
Vesela
,
J.
and
De Hertogh
,
R.
(
1997
).
Increased cell death in rat blastocysts exposed to maternal diabetes in utero and to high glucose or tumor necrosis factor-alpha in vitro
.
Development
124
,
4827
4836
.
Pierce
,
G. B.
,
Lewellyn
,
A. L.
and
Parchment
,
R. E.
(
1989
).
Mechanism of programmed cell death in the blastocyst
.
Proc. Natl. Acad. Sci. USA
86
,
3654
3658
.
Print
,
C. G.
,
Loveland
,
K. L.
,
Gibson
,
L.
,
Meehan
,
T.
,
Stylianou
,
A.
,
Wreford
,
N.
,
de Kretser
,
D.
,
Metcalf
,
D.
,
Kontgen
,
F.
,
Adams
,
J. M.
and
Cory
,
S.
(
1998
).
Apoptosis regulator bcl-w is essential for spermatogenesis but appears otherwise redundant
.
Proc. Natl. Acad. Sci. USA
95
,
12424
31
.
Ross
,
A. J.
,
Waymire
,
K. G.
,
Moss
,
J. E.
,
Parlow
,
A. F.
,
Skinner
,
M. K.
,
Russell
,
L. D.
and
MacGregor
,
G. R.
(
1998
).
Testicular degeneration in Bclw-deficient mice
.
Nat. Genet
.
18
,
251
256
.
Roth
,
M. B.
,
Zahler
,
A. M.
and
Stolk
,
J. A.
(
1991
).
A conserved family of nuclear phosphoproteins localized to sites of polymerase II transcription
.
J. Cell Biol
.
115
,
587
96
.
Sahara
,
S.
,
Aoto
,
M.
,
Eguchi
,
Y.
,
Imamoto
,
N.
,
Yoneda
,
Y.
and
Tsujimoto
,
Y.
(
1999
).
Acinus is a caspase-3-activated protein required for apoptotic chromatin condensation
.
Nature
401
,
168
173
.
Sanders
,
E. J.
and
Wride
,
M. A.
(
1995
).
Programmed cell death in development
.
Int. Rev. Cytol
.
163
,
105
173
.
Skarnes
,
W. C.
,
Moss
,
J. E.
,
Hurtley
,
S. M.
and
Beddington
,
R. S.
(
1995
).
Capturing genes encoding membrane and secreted proteins important for development
.
Proc. Natl. Acad. Sci. USA
92
,
6592
6596
.
Smith
,
M. S.
and
Wilson
,
I. B.
(
1971
).
Histochemical observations on early implantation in the mouse
.
J. Embryol. Exp. Morphol
.
25
,
165
174
.
Susin
,
S. A.
,
Lorenzo
,
H. K.
,
Zamzami
,
N.
,
Marzo
,
I.
,
Snow
,
B. E.
,
Brothers
,
G. M.
,
Mangion
,
J.
,
Jacotot
,
E.
,
Costantini
,
P.
,
Loeffler
,
M.
et al.  (
1999
).
Molecular characterization of mitochondrial apoptosis-inducing factor
.
Nature
397
,
441
446
.
Thompson
,
J. D.
,
Higgins
,
D. G.
and
Gibson
,
T. J.
(
1994
).
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice
.
Nucleic Acids Res
.
22
,
4673
4680
.
Vaux
,
D. L.
and
Korsmeyer
,
S. J.
(
1999
).
Cell death in development
.
Cell
96
,
245
254
.
Veis
,
D. J.
,
Sorenson
,
C. M.
,
Shutter
,
J. R.
and
Korsmeyer
,
S. J.
(
1993
).
Bcl-2-deficient mice demonstrate fulminant lymphoid apoptosis, polycystic kidneys, and hypopigmented hair
.
Cell
75
,
229
240
.
Voss
,
A. K.
,
Thomas
,
T.
and
Gruss
,
P.
(
1997
).
Germ line chimeras from female ES cells
.
Exp. Cell Res
.
230
,
45
49
.
Voss
,
A. K.
,
Thomas
,
T.
and
Gruss
,
P.
(
1998a
).
Compensation for a gene trap mutation in the microtubule associated protein 4 locus by alternative polyadenylation and alternative splicing
.
Dev. Dyn
.
212
,
258
266
.
Voss
,
A. K.
,
Thomas
,
T.
and
Gruss
,
P.
(
1998b
).
Efficieny assessment of the gene trap aproach
.
Dev. Dyn
.
212
,
171
180
.
Voss
,
A. K.
,
Thomas
,
T.
and
Gruss
,
P.
(
2000
).
Mice lacking HSP90beta fail to develop a placental labyrinth
.
Development
127
,
1
11
.
Weil
,
M.
,
Jacobson
,
M. D.
,
Coles
,
H. S.
,
Davies
,
T. J.
,
Gardner
,
R. L.
,
Raff
,
K. D.
and
Raff
,
M. C.
(
1996
).
Constitutive expression of the machinery for programmed cell death
.
J. Cell Biol
.
133
,
1053
1059
.