Organogenesis in plants occurs at the shoot apical meristem, a group of indeterminate stem cells that are organized during embryogenesis. Regulated initiation of leaves or flowers from the shoot meristem gives rise to the familiar geometric patterns observed throughout the plant kingdom. The mechanism by which these patterns, termed phyllotaxies, are generated, remains unclear. Maize plants initiate leaves singly, alternating from one side to the other in a regular pattern. Here we describe a recessive maize mutant, abphyl1, that initiates leaves in opposite pairs, in a pattern termed decussate phyllotaxy. The decussate shoot meristems are larger than normal throughout development, though the general structure and organization of the meristem is not altered. abph1 mutants are first distinguished during embryogenesis, prior to true leaf initiation, by a larger shoot meristem and coincident larger expression domain of the homeobox gene knotted1. Therefore, the abph1 gene regulates morphogenesis in the embryo, and plays a role in determining the phyllotaxy of the shoot.

Leaves are initiated on the flanks of the shoot apical meristem, a group of indeterminate stem cells at the growing tip of the shoot (Meyerowitz, 1997; Sussex, 1989). Shoot meristems have a layered structure which is maintained by the propensity of cells to divide within the layer. Independent of this level of organization is the classification of zones in the meristem that differ both structurally and functionally. In the central zone, cells are less densely cytoplasmic and divide relatively infrequently, this zone serves to maintain the meristem as an indeterminate structure. In the peripheral zone on the flank of the meristem, the rate of cell division increases as cells are incorporated into primordia.

Leaf primordia normally arise in regular geometric arrays that are determined by a combination of genetic, environmental and developmental factors (Marc and Hackett, 1991; Schwabe, 1984; Steeves and Sussex, 1989). Leaf arrangements can be classified as one of two types. In whorled phyllotaxy, discrete leaf initiation cycles occupy the whole circumference of the meristem and produce a set number of leaf primordia per whorl. When a single leaf is initiated per whorl, the pattern is alternate or distichous, and when two leaves are initiated per whorl the pattern is termed opposite and decussate. The other type of leaf arrangement is spiral, in which initiation events generate single primordia that do not occupy the whole meristem circumference, and are separated by an angle of approximately 137 ° from the previous primordium. Although we understand little about how these different patterns are generated, our understanding of the regulation of shoot meristem activity in general has advanced rapidly in recent years by genetic analysis in Arabidopsis, maize and other model systems.

Genes that are required for vegetative shoot meristem initiation and/or maintenance include the homeobox gene knotted1 in maize (Kerstetter et al., 1997), and its Arabidopsis homolog SHOOTMERISTEMLESS (Long et al., 1996), ZWILLE (Moussian et al., 1998), NO APICAL MERISTEM (Souer et al., 1996) and WUSCHEL (Laux et al., 1996). Mutations in the CLAVATA loci have opposing phenotypes in that they result in enlargement of the shoot meristem, and the clv1 or clv3 and stm mutations dominantly suppress each other, suggesting a balanced quantitative relationship between the gene products (Clark et al., 1996). This observation led to a model proposing that STM promotes meristem cell fate and CLV promotes the incorporation of cells into primordia, such that a balance of these gene products is required for normal meristem function (Clark et al., 1997). CLV1 encodes a putative leucine rich repeat receptor kinase (Clark et al., 1997). Arabidopsis leaves are arranged in a spiral phyllotaxy, but some clv mutants, as well as a number of other Arabidopsis mutants, have altered patterns of leaf initiation. In these mutants there is sporadic or irregular leaf initiation rather than a shift to a different phyllotactic pattern (Leyser and Furner, 1992; Medford et al., 1992; Clark et al., 1993, 1995).

The mechanisms that regulate the positioning of primordia in discrete phyllotactic patterns have been studied most intensively through surgical experiments (reviewed in (Medford, 1992; Sussex, 1989). These studies suggest that positioning of primordia is determined by morphogenetic fields in the apex, containing inhibitory signals emanating from the central zone of the meristem as well as from preexisting primordia. According to this model, primordia are positioned at a point that is furthest from the apex and from existing primordia. An alternative view is that biophysical forces in the apex determine organ initiation sites (reviewed by Green, 1987). Support for the latter has come from recent studies showing that application of expansin, a protein that promotes cell wall expansion, to the shoot apex causes localized outgrowths and in some cases can alter the phyllotactic pattern in tomato apices (Fleming et al., 1997; Reinhardt et al., 1998). The models for phyllotactic pattern are generally used to explain the propagation of established patterns, and with a few exceptions do not explain how phyllotaxy arises de novo (Green, 1994).

In maize, as in all grasses, leaves are initiated singly in an alternate or distichous phyllotaxy (Fig. 1A) (Arber, 1925; Barnard, 1964). Variants of maize with altered patterns of leaf initiation have been described, though the inheritance of these characters was non Mendelian, and this phenomenon was therefore termed the abphyl (for aberrant phyllotaxy) syndrome (Greyson and Walden, 1972; Greyson et al., 1978). In this paper we report a new recessive mutation of maize, abphyl1 (abph1), that leads to the initiation of leaves in opposite and decussate phyllotaxy. Decussate phyllotaxy is commonly found in other plant species in the Dicotyledon group, but never in the grasses which are in the Monocotyledon group.

Fig. 1.

Altered phyllotaxy in maize plants carrying the abph1 mutation. (A-C) Seedling phenotypes. (A) a normal maize seedling has alternate or distichous phyllotaxy, with leaves being initiated singly and opposite to the previous leaf. (B) A seedling carrying the abph1 mutation that has decussate phyllotaxy, with leaves initiated in opposite pairs. (C) An abph1 seedling reverting from decussate to normal phyllotaxy. Note the presence of a pair of fused leaves (arrows) between a node initiating two opposite leaves and a node initiating a single leaf. (D-F) First leaf phenotypes; (D) a normal first leaf with a single prominent midvein; (E) a decussate pair of first leaves from an abph1 seedling; (F) a first leaf showing two midveins (arrowed) from a mild phenotype abph1 seedling. Note that decussate abph1 seedlings can also have first leaves that are partially fused (as shown in B). (G) Adult plant phenotypes, normal plant on the left, decussate abph1 plant on the right. The normal plant has alternate phyllotaxy and a single prominent ear shoot (visible by the brown color of the ear silks). The decussate plant has two opposite ear shoots, as well as opposite and decussate leaves at every node and the first tassel (male inflorescence) branches are also decussate. Leaves in a decussate pair always have the same width and length, however the perspective of the photograph can give the false impression that one is shorter.

Fig. 1.

Altered phyllotaxy in maize plants carrying the abph1 mutation. (A-C) Seedling phenotypes. (A) a normal maize seedling has alternate or distichous phyllotaxy, with leaves being initiated singly and opposite to the previous leaf. (B) A seedling carrying the abph1 mutation that has decussate phyllotaxy, with leaves initiated in opposite pairs. (C) An abph1 seedling reverting from decussate to normal phyllotaxy. Note the presence of a pair of fused leaves (arrows) between a node initiating two opposite leaves and a node initiating a single leaf. (D-F) First leaf phenotypes; (D) a normal first leaf with a single prominent midvein; (E) a decussate pair of first leaves from an abph1 seedling; (F) a first leaf showing two midveins (arrowed) from a mild phenotype abph1 seedling. Note that decussate abph1 seedlings can also have first leaves that are partially fused (as shown in B). (G) Adult plant phenotypes, normal plant on the left, decussate abph1 plant on the right. The normal plant has alternate phyllotaxy and a single prominent ear shoot (visible by the brown color of the ear silks). The decussate plant has two opposite ear shoots, as well as opposite and decussate leaves at every node and the first tassel (male inflorescence) branches are also decussate. Leaves in a decussate pair always have the same width and length, however the perspective of the photograph can give the false impression that one is shorter.

Plant growth and mapping of abph1

Seed from plants showing opposite leaf phenotypes were originally obtained as a gift from Dr M. Menzi, Swiss Federal Research Station for Agronomy, Zurich-Reckenholz. The heritability of the opposite leaf phenotype had not been characterized in detail. Seedlings and plants for meristem and leaf measurements were from lines introgressed for two generations into the B73 inbred line, and were grown in the greenhouse under controlled conditions.

For mapping, DNA was prepared from tissue pools from 25 mutants (homozygotes) or wild-type siblings (heterozygotes) from back cross populations segregating in different inbred lines, digested with a range of restriction enzymes and subjected to Southern analysis using maize RFLP probes. Initially, linkage of the mutation was mapped to two RFLP markers on the short arm of chromosome 2, UMC 6 and UMC 131. Subsequent mapping using DNA prepared from individual mutant or normal sib plants placed the abph1 gene very close (0 recombinants/60) to the RFLP probe UMC 34. (http://www.agron.missouri.edu/).

Scanning electron microscopy

Two-week-old seedlings were dissected by carefully removing the leaves and leaf primordia until the shoot meristem was visible. Impression casts were made using dental impression medium (Exaflex, GC Dental Industrial Corp.). Once set, the casts were removed and filled with 2 ton epoxy resin (ACE Hardware) which was left to set overnight. The resin replicas were removed, mounted on stubs and sputter coated before viewing in the SEM. The replica technique was not suitable for small embryos, so these were dissected out from the seed and fixed in 4% glutaraldehyde (Sigma) in phosphate-buffered saline (PBS) then dehydrated through an ethanol series, desiccated in a critical point dryer, mounted on stubs and coated and observed in the SEM.

Meristem measurements

For shoot meristem measurements, longitudinal slices about 1 mm thick were cut from shoot apices of 2-week-old seedlings and fixed in FAA (10% formalin, 45% ethanol, 5% acetic acid) overnight, dehydrated through an ethanol series to 100% ethanol and passed into methyl salicylate (2 parts ethanol: 1 part methyl salicylate, 1 part ethanol: 2 parts methyl salicylate, 100% methyl salicylate, twice, 1 hour each change) followed by direct observation of the meristem using Nomarski optics and measurement with the aid of a reticle. The width of the meristem dome just above the most recently initiated leaf primordium was measured. Root apices were measured following fixation, embedding in paraffin and sectioning; the width of the quiescent center was measured (Feldman, 1993). Inflorescence meristem diameters were measured in the SEM from replica casts.

In situ hybridization

This was performed as previously described for sections (Jackson et al., 1994). The cyclin 1b probe (Renaudin et al., 1994) was transcribed from a PCR fragment that was generated using two gene specific primers, TGTAATACGACTCACTATAGGGCGGTCTGTAGAATGTGT, and TGTCCCGTGTCTTTTCAAGG, that amplified approximately 650 bp at the 5′ end of the cDNA and did not contain the conserved cyclin box (Renaudin et al., 1994). The downstream primer was tailed with the T7 polymerase primer sequence to allow direct in vitro transcription of the PCR product.

For whole-mount in situ hybridization, pollinated ears were harvested at set days after pollination and the embryos were dissected out and were pricked on the scutellum side with a fine tungsten needle to aid probe and antibody penetration (embryos which were not pricked only rarely gave good hybridization signals) then fixed for 2-4 hours in freshly depolymerised 4% formaldehyde (Sigma) in PBS. The whole-mount procedure following fixation was as described by Rosen and Beddington (1993). Embryos probed with control sense strand probes gave no signal (not shown).

The abph1 mutation causes alterations in vegetative phyllotaxy and segregates as a single recessive locus

The abph1 trait arose spontaneously and seed was given to us by M. Menzi of the Swiss Federal Research Station for Agronomy, Zurich-Reckenholz. The phenotypic analysis was performed on segregating populations from plants back crossed twice into the B73 maize inbred line (Pioneer Hi-Bred International). Similar segregation ratios and phenotypes were observed in other genetic backgrounds (data not shown). Approximately 50% of abph1 mutant seedlings had altered phyllotaxy in the first nodes compared to normal seedlings, and the majority of these seedlings were decussate (Table 1, Fig 1B). Decussate plants initiated two fertile ears (female inflorescence shoots) at a single node, in contrast to normal plants which initiate only one ear per node (Fig. 1G). The lower branches of the tassel, or male inflorescence, also showed decussate phyllotaxy in abph1 plants, whereas in normal plants the first tassel branches were initiated singly (Fig 1G). The number of nodes initiated by decussate abph1 plants was the same as in their normal siblings, therefore doubling the total number of leaves per plant. Closer observation of older abph1 decussate shoots revealed that the opposite pair of leaves was indeed inserted at the same node rather than the plants having an alternation of long and short internodes that could give the false impression of decussate phyllotaxy.

Table 1.
Frequencies of different abph1 seedling phenotypes in back cross populations
graphic
graphic

Some decussate seedlings spontaneously reverted to normal, distichous phyllotaxy. This change in phyllotaxy, however, was not abrupt. Rather, an intermediate node with a pair of adjacent, fused leaves was usually observed between the decussate and distichous nodes (Fig. 1C). Other mutant seedlings showed a mild phenotype consisting of a wide first leaf with two midribs, followed by normal phylotaxy in subsequent nodes (Fig. 1F). The twin midrib leaves were often split down the middle between the midribs, suggesting that in fact they represented two leaves that had partially fused along their margin. We interpret the ‘twin midrib’ leaves and partially fused leaves observed in mild and reverting plants, respectively, as resulting from the simultaneous initiation of two leaf primordia that fused because they were initiated adjacent to each other rather than opposite. Once the phyllotaxy reverted from decussate to normal, it remained normal for the rest of the life of the plant; we never observed a plant that switched from alternate back to decussate phyllotaxy.

Other phenotypes observed at a much lower frequency included ‘twin shoots’ and ‘twisted plants’ (Table 1). The twin shoots occurred when a decussate shoot appeared to split in two, and this was always accompanied by a reversion to normal phyllotaxy in both new shoots. We also observed occasional stunted, twisted plants that appeared to have spiral phyllotaxy (not shown).

To follow the heritability of these traits, decussate abphyl plants were crossed into a range of standard maize inbred lines. Self pollination revealed that the abphyl phenotype segregated as a single locus recessive trait. abph1 was mapped using bulked segregant analysis (Michelmore et al., 1991) to chromosome 2S, bin 04. This map location has been confirmed by linkage to other known mutations on chromosome 2S (data not shown).

abph1 seedlings showed a range of phenotypes, described above, and we showed that all of these are due to the same mutation. First, self or test crossing of plants from any phenotypic class gave progeny that showed the full range of phenotypes associated with the abph1 mutation, in similar ratios (data not shown). Second, plants from the different phenotypic classes were all homozygous for a restriction fragment length polymorphism closely linked to abph1. These findings indicated that the different phenotypes were manifestations of the same mutation, and also that the mild and revertant phenotypes were not the result of a heritable reversion event at the abph1 locus.

In addition to the change in phyllotaxy, decussate abph1 plants had narrower leaves compared to their normal siblings. We measured the width of each fully expanded leaf from eight plants of each class; abph1 decussate phenotype, abph1 revertant phenotype and normal sib. As shown in Fig. 2, the width of each leaf blade in decussate plants was significantly narrower than their normal siblings, however the shape of the curve plotted through the mean width of successive leaves was similar for each class (Fig. 2). The narrower leaves of decussate plants had normal marginal saw tooth hairs (Scanlon et al., 1996), and therefore did not lack a marginal domain. Rather, they had fewer lateral veins, whose spacing was not significantly different from their normal siblings (not shown). In abph1 plants which reverted to normal phyllotaxy, the leaf width also was close to normal, especially in later nodes, at the stage where the shoot meristem size of these seedlings was found to be indistinguishable from that of their normal siblings (Table 2).

Table 2.
Meristem sizes in abph1 and normal siblings
graphic
graphic
Fig. 2.

Leaf width measurements of normal and abph1 plants. The mean width of each fully expanded leaf from leaf 2 to the last initiated leaf is plotted. The width of every leaf blade from eight plants in each class was measured at the mid point of the blade. Error bars represent the standard error.

Fig. 2.

Leaf width measurements of normal and abph1 plants. The mean width of each fully expanded leaf from leaf 2 to the last initiated leaf is plotted. The width of every leaf blade from eight plants in each class was measured at the mid point of the blade. Error bars represent the standard error.

Decussate abph1 seedlings have a larger shoot meristem and altered expression of knotted1

To visualize the pattern of leaf initiation at the shoot meristem, we used replica scanning electron microscopy (SEM) (Williams and Green, 1988). In the normal maize vegetative apex, leaf primordia are initiated singly on the flank of the shoot meristem, each one opposite the previous leaf. As the leaf primordium enlarges, its base spreads to fully encircle the apex (Fig. 3A). In a decussate abph1 apex, leaves were initiated in perfectly matched opposite pairs, and each leaf primordium wrapped around the apex only halfway (Fig. 3B). Occasionally, the apex of a seedling with opposite and decussate phyllotaxy was found to be reverting to normal phyllotaxy when dissected to the meristem. In this case, one or two nodes after the last decussate node consisted of leaf primordia that were forked at their tips (Fig. 3C). We assume that these primordia resulted from a pair of leaves that were initiated adjacent to each other rather than opposite, causing them to fuse along one edge. These primordia likely gave rise to the partially fused leaves seen at maturity in plants undergoing phyllotactic reversion. abph1 shoot apices from seedlings of the mild phenotypic class, or from seedlings that had already reverted to normal phyllotaxy appeared morphologically normal (not shown).

Fig. 3.

Initiation of the altered phyllotaxy in abph1 plants by the shoot apical meristem. (A-C) Scanning electron micrographs of replica casts of normal (A), and abph1 (B,C) apices from two-week-old seedlings. (A)Normal shoot apex showing the shoot apical meristem (the central dome of tissue) and P2 and P3 leaf primordia (the most recently initiated primordium, the P1, is obscured). (B) A decussate abph1 shoot apex showing the pair of P3 leaves which are perfectly matched. Only one P2 leaf is visible; the other one is behind the meristem. The ridge of tissue just above the P2 primordium corresponds to the abutted margins of the P1 primordia. (C) An abph1 shoot apex that is reverting from decussate to normal phyllotaxy. All the leaves dissected from this seedling were opposite and decussate, though at the meristem the phyllotaxy had switched to alternate, and the leaf primordia had split tips (asterisks). Scale bar, 100 μm. (D,E) Sections through shoot apices hybridized in situ to the kn1 probe. (D) A normal shoot apex shows down regulation of kn1 expression in a group of cells on the flank of the meristem opposite the most recently initiated leaf, and therefore corresponding to the position of the next leaf initiation event (arrowed). (E) In a decussate abph1 apex, kn1 down regulation (arrowed) is evident on both sides of the meristem, corresponding to the positions where the next two leaf primordia will arise. Scale bar, 100 μm. (F,G) Expression of maize cyclin 1b mRNA by in situ hybridization to normal and abph1 decussate apices, respectively. In both cases the frequency of labelled cells was very low in the central zone compared to the peripheral zone or to the leaf primordia. Scale bar, 100 μm.

Fig. 3.

Initiation of the altered phyllotaxy in abph1 plants by the shoot apical meristem. (A-C) Scanning electron micrographs of replica casts of normal (A), and abph1 (B,C) apices from two-week-old seedlings. (A)Normal shoot apex showing the shoot apical meristem (the central dome of tissue) and P2 and P3 leaf primordia (the most recently initiated primordium, the P1, is obscured). (B) A decussate abph1 shoot apex showing the pair of P3 leaves which are perfectly matched. Only one P2 leaf is visible; the other one is behind the meristem. The ridge of tissue just above the P2 primordium corresponds to the abutted margins of the P1 primordia. (C) An abph1 shoot apex that is reverting from decussate to normal phyllotaxy. All the leaves dissected from this seedling were opposite and decussate, though at the meristem the phyllotaxy had switched to alternate, and the leaf primordia had split tips (asterisks). Scale bar, 100 μm. (D,E) Sections through shoot apices hybridized in situ to the kn1 probe. (D) A normal shoot apex shows down regulation of kn1 expression in a group of cells on the flank of the meristem opposite the most recently initiated leaf, and therefore corresponding to the position of the next leaf initiation event (arrowed). (E) In a decussate abph1 apex, kn1 down regulation (arrowed) is evident on both sides of the meristem, corresponding to the positions where the next two leaf primordia will arise. Scale bar, 100 μm. (F,G) Expression of maize cyclin 1b mRNA by in situ hybridization to normal and abph1 decussate apices, respectively. In both cases the frequency of labelled cells was very low in the central zone compared to the peripheral zone or to the leaf primordia. Scale bar, 100 μm.

The SEM analysis also indicated that the shoot apical meristem of decussate seedlings was larger than that of their normal siblings. We measured the difference in shoot meristem size using cleared apices from decussate, revertant and normal sibling seedlings. The decussate abph1 shoot meristem was on average about one third wider than that of normal siblings (Table 2). The significant range in shoot meristem size in each class is due to the normal size fluctuation during the leaf initiation cycle (Abbe et al., 1951). The shoot meristems of abph1 seedlings that had reverted to normal phyllotaxy were the same size as those of normal siblings. Shoot meristem sizes from abph1 heterozygous seedlings were not significantly different from those of homozygous wild-type siblings (not shown). There was no difference in root meristem size between decussate abph1 plants and their normal siblings (Table 2), indicating that the effects of the abph1 mutation were specific to the shoot. We also found no differences in the diameter of the seedling roots or the arrangement or number of lateral roots from normal or decussate seedlings (data not shown). To examine any possible effect of the abph1 mutation on shoot meristems initiated postembryonically, we measured lateral (ear) inflorescence meristem sizes from decussate abph1 plants and normal siblings, and found no significant difference (Table 2). In addition, flowers from abph1 plants were normal with respect to organ number and arrangement (data not shown), indicating that abph1 specifically affects the primary embryonic shoot apical meristem, and does not affect shoot meristems initiated postembryonically.

To determine how the abph1 mutation affects pattern formation in the shoot apical meristem, we used the homeobox gene knotted1 (kn1) as a marker. Normally, kn1 is expressed throughout the shoot meristem but is down regulated in a group of cells on the flank of the meristem opposite the most recently initiated leaf, marking the position where the next leaf will be initiated (Fig. 3D). Down regulation of kn1 spreads to encircle the meristem, resulting in a croissant shaped domain lacking kn1 that corresponds to the presumptive leaf founder cells (Jackson et al., 1994). In meristems from decussate abph1 seedlings, kn1 expression was down regulated equally on both sides of the meristem, revealing a pre-pattern that predicts the future phyllotaxy of the shoot (Fig. 2E). Therefore, the abph1 mutation acts in the shoot meristem to affect kn1 expression prior to the initiation of leaf primordia. The analysis of kn1 expression also revealed that the layered structure of the meristem is not altered in abph1 mutants; KN1 mRNA is expressed throughout the meristem corpus but is not detected in the tunica or L1 layer (Jackson et al., 1994), and this pattern is unaffected in decussate abph1 meristems (Fig. 3E). In contrast, KN1 protein is also detected in the tunica or L1 cells of normal meristems, and this was the case in abph1 meristems (not shown).

Shoot meristems are organized into a central zone, which typically has a low mitotic index, and a peripheral zone, from which cells are incorporated into primordia (Wardlaw, 1957). As a probe to reveal relative rates of cell division in the different zones of the meristem, we used a maize cyclin probe that is in a class of genes with predicted function in G2. Related genes in Antirrhinum have tightly restricted mRNA accumulation at a specific phase of the cell cycle (Fobert et al., 1994), so the frequency of cells that express this mRNA can be used as an indication of the mitotic index within a particular tissue. Probing apices with the maize cyclin 1b probe revealed a similar pattern in both normal and decussate abph1 apices. Only rarely did cells within the central zone label for cyclin 1b mRNA, whereas an increased frequency of labeling was seen in the peripheral zone of the meristem and in newly initiated leaf primordia (Fig. 2F,G). Therefore, both normal and abph1 decussate meristems had a reduced frequency of cells expressing this cyclin gene, and presumably a reduced rate of cell division, within the central zone of the meristem.

Initiation of altered phyllotaxy in abph1 embryos

The consistent effect of the abph1 mutation on the first leaves indicated that it acts during embryogenesis, where the shoot apical meristem and the first true leaf primordia are initiated. To follow the development of embryos of known genotype, decussate abph1 plants with two ear shoots were pollinated on the same day with normal (B73) pollen on one ear and with pollen from an abph1 mutant plant on the other ear. Developing kernels were sampled from both ears at set times (days after pollination) and embryos dissected out and prepared either for SEM or for whole mount in situ hybridization. Embryos were staged according to morphological landmarks as described by Abbe and Stein (1954); Clark and Sheridan (1991).

After fertilization, the maize embryo first develops into a club shaped structure comprising an apical region that will give rise to the embryo proper and the suspensor, which acts as a conduit for maternally supplied nutrients. Five to seven days after fertilization, the apical part of the embryo flattens into a structure called the scutellum, which is homologous to the cotyledon or seed leaf (Arber, 1925; Randolph, 1936). At this time, the shoot meristem becomes visible as a small dome of cells on the face of the scutellum, and the coleoptile primordium initiates on the apical side of the shoot meristem (Fig. 4A). The coleoptile is thought to be an outgrowth of the scutellum, and forms a protective, ensheathing structure surrounding the embryonic shoot (Arber, 1925; Randolph, 1936). The first true leaf is initiated opposite the point where the coleoptile was initiated (Fig. 4C,D), and hereby forms the first sign of alternate phyllotaxy; from this point on all future leaves will be initiated in an alternating or distichous pattern.

Fig. 4.

Development of normal and abph1 embryos. (A-D) Normal embryos; (E-H) the corresponding stages of abph1 embryos. (A) Normal and (E) abph1 embryos at the coleoptilar stage. Sc, scutellum; M, shoot meristem; Su, suspensor; C, coleoptile primordium. The dome of cells bounded by the coleoptile primordium, presumably the shoot meristem, is larger in the abph1 embryo. (B,F) Whole-mount in situ hybridizations of embryos at the same stage as those in A and E, hybridized with the kn1 probe. (C,G) Normal and abph1 embryos at the first leaf stage. The normal embryo is initiating a single first leaf primordium. The abph1 embryo is initiating a pair of first leaf primordia perpendicular to the normal plane. (D,H) Close up of the meristem region in C and G. C, coleoptile; 1, first leaf primordia. Scale bars A,C,E,G, 100 μm; D,H, 50 μm.

Fig. 4.

Development of normal and abph1 embryos. (A-D) Normal embryos; (E-H) the corresponding stages of abph1 embryos. (A) Normal and (E) abph1 embryos at the coleoptilar stage. Sc, scutellum; M, shoot meristem; Su, suspensor; C, coleoptile primordium. The dome of cells bounded by the coleoptile primordium, presumably the shoot meristem, is larger in the abph1 embryo. (B,F) Whole-mount in situ hybridizations of embryos at the same stage as those in A and E, hybridized with the kn1 probe. (C,G) Normal and abph1 embryos at the first leaf stage. The normal embryo is initiating a single first leaf primordium. The abph1 embryo is initiating a pair of first leaf primordia perpendicular to the normal plane. (D,H) Close up of the meristem region in C and G. C, coleoptile; 1, first leaf primordia. Scale bars A,C,E,G, 100 μm; D,H, 50 μm.

The major embryonic structures were initiated at similar times in abph1 embryos compared to normal embryos. In abph1 embryos, the coleoptilar stage embryo was distinguished by a larger dome of tissue, presumably the shoot meristem, on the face of a broader and more rounded scutellum (Fig. 4E). The larger dome, presumed to be the shoot meristem, was observed in all abph1 embryos that we examined (greater than one hundred observed in the SEM). A single coleoptile primordium encircled the dome and was therefore broader than normal. The mature coleoptile in abph1 seedlings was also broader and often had an increased number of prominent veins but was otherwise normal (not shown). Following initiation of the coleoptile, the abph1 shoot meristem initiated two opposite true leaf primordia perpendicular to the usual plane of phyllotaxy (Fig. 4G,H). This first indication of decussate phyllotaxy was observed in almost all abph1 embryos at this stage (46/48 abph1 embryos observed in the SEM). Therefore, the initiation of decussate phyllotaxy at the first node was a more reproducible aspect of the abph1 phenotype than the maintenance of altered phyllotaxy in the abph1 seedling, which was detected in approximately 50% of seedlings in this genetic background (Table 1). We assume therefore that the decussate pair of first leaf primordia often fused along one edge, either con- or postgenitally resulting in what appeared to be a single first leaf with two midveins, corresponding to the mild abph1 phenotype described earlier. Therefore the ‘mild’ phenotype could be thought of as a reversion of phyllotaxy from decussate to normal that occurred at the first node, equivalent to the phenotypic reversion observed in later nodes.

To confirm that the larger dome structure seen in abph1 embryos had meristem identity, we again used kn1 as a molecular marker, because the onset of kn1 expression in the maize embryo is coincident with the first histological changes associated with shoot meristem formation (Smith et al., 1995), and loss-of-function mutations in the SHOOTMERISTEMLESS gene, an Arabidopsis homolog of kn1, fail to initiate or maintain the shoot meristem (Clark et al., 1996, Long et al., 1996). Using whole-mount in situ hybridization, we showed that the domain of kn1 expression was indeed larger in abph1 embryos compared to their normal siblings and was coincident with the larger dome of tissue observed in the SEM (Fig. 4B,F). Therefore abph1 embryos initiated a larger dome of tissue that by position, morphology and kn1 expression appeared to have shoot meristem identity, and this larger meristem almost invariably initiated a decussate pair of first leaf primordia.

abph1 mutants have altered phyllotaxy and a larger shoot meristem

Although phyllotactic patterns have been described for centuries, little is known about the mechanisms involved in the initiation of these patterns. We have described a new recessive mutation, abph1, that leads to the formation of a larger shoot meristem and almost invariably causes the initiation of a decussate pair of first leaf primordia. In our studies, the frequency of abph1 shoots remaining decussate throughout their development was about 20%, though this frequency has been as high as 90% in field trials of abph1 lines in different genetic backgrounds (M. Menzi, pers. comm.). Although we do not understand the mechanism for reversion of phyllotaxy, the fact that reversion occurs indicates that the mode of action of abph1 is unlikely to reflect an underlying mechanism for counting the number of leaf primordia initiated per node. Instead, the initiation of the decussate phyllotactic pattern is probably due to the altered morphology of abph1 embryos, and in particular the presence of a larger shoot meristem domain (discussed later). The shoot apical meristems of decussate abph1 seedlings are normal in terms of their layered cellular structure, but are consistently larger than normal. In addition, the expression of a cyclin marker gene shows that abph1 meristems are correctly organized into central and peripheral zones, with a characteristic low mitotic index in the central zone. Shoot meristems initiated after embryogenesis, such as lateral inflorescence or floral meristems, are normal both in phyllotaxy and size, indicating that the effects of the abph1 mutation are specific to the primary shoot apical meristem. Despite the striking change in phyllotaxy, abph1 embryos initiate a single scutellum, an organ that is homologous to the cotyledon (Arber, 1925; Randolph, 1936), therefore the effects of the abph1 mutation are unrelated to this fundamental difference between dicots and monocots.

The relation between primordium and meristem size

The leaves of decussate abph1 plants were narrower than normal, an observation that is consistent with the relatively modest increase in meristem size despite the doubling of the number of leaves initiated per node. At two weeks after germination, when the maize shoot has initiated about 12 nodes, the meristem of decussate seedlings was about one third wider than normal, and therefore its circumference would also be only one third longer than normal. It is therefore not surprising that each leaf in the decussate pair is narrower than those of the normal siblings, since each primordium is initiated from only half the circumference of the meristem, compared to normal primordia that are initiated from the whole circumference. Based on this, one would predict that each decussate leaf primordium arises from a smaller number of founder cells, compared to normal primordia, and this is supported by preliminary clonal analysis data (D. Jackson and S. Hake, unpublished).

Despite the significant differences in leaf width between decussate and normal plants, the pattern of change in leaf width is similar. In normal maize plants, the leaf blade width increases progressively in successive nodes, peaks around leaves 12-14, then decreases. These changes probably reflect ontogenetic changes in meristem size and leaf initiation rate. During maize seedling development, the shoot meristem size increases gradually following each leaf initiation event (Abbe et al., 1951). Since the maize leaf is initiated as a ring of founder cells that surrounds the apex (Poethig, 1984), the increase in leaf width up to node 12 is likely due in part to the initiation of leaf primordia from a successively larger meristem. However, in later nodes, the time between leaf initiation events, the plastochron, shortens significantly (Abbe et al., 1951), so perhaps leaf width decreases at these nodes because the meristem has less time to recover in size before initiating the next leaf. In any case, it is significant that the pattern of change in leaf width was the same in abph1 decussate shoots compared to normal siblings, indicating that this specific aspect of meristem programming is unaffected by the abph1 mutation.

The effect of the ratio between meristem size and primordium size on phyllotaxy has been followed in a number of plants, and it is generally recognized that within a given system this ratio may correlate with the phyllotactic pattern. For example, in many dicots that switch from decussate phyllotaxy to spiral during their development, there is a corresponding increase in meristem size (Carr, 1984). What is not clear from these earlier studies is cause and effect; does the phyllotaxy follow from a change in meristem size, or is it the change in phyllotaxy that governs the size of the meristem? Our studies of the abph1 mutation indicate that the meristem is larger in the embryo before the first decussate pair of leaves is visible, suggesting in this case that the phyllotaxy follows from the geometry of the meristem. However, a caveat with this hypothesis is that we do not know at what stage the positions of the leaf primordia are determined in the maize embryo; in other plants it is thought to be about half a plastochron before their emergence (Lyndon, 1982; Snow and Snow, 1933). Therefore we cannot rule out the possibility that the meristem in the abph1 embryo is larger because more leaf initiation sites have been determined.

Mechanisms for determining phyllotaxy

In abph1 plants, we observed a strong correlation between meristem size and phyllotaxy. The shoot meristem is larger while initiating and maintaining decussate phyllotaxy, but returns to normal size when the phyllotaxy reverts to normal. Furthermore, when decussate abph1 shoots split to form two twin shoots, the phyllotaxy of each new shoot is alternate, and we assume this change in phyllotaxy results from smaller meristems formed during the twinning event.

Two main hypotheses have been proposed to explain the generation and maintenance of phyllotactic patterns. The first proposes that biophysical forces and tissue mechanics combine to promote morphogenesis through buckling of the tissue in predictable patterns (Green, 1987). Our observations of a correlation between meristem size and phyllotaxy are consistent with these ideas, and suggest a homeostatic mechanism balancing meristem size and phyllotaxy that could work through biophysical principles. A second model to explain the generation of phyllotaxy is the field model (Schoute, 1913; Wardlaw, 1949). This hypothesis proposes that leaf position is determined by inhibitory fields, presumably biochemical in nature, emanating from existing primordia and from the apex of the shoot meristem itself (Wardlaw, 1949). According to this model, the initiation of a different phyllotactic pattern in abph1 embryos may be a consequence of the increase in size of the shoot meristem, within which the inhibitory fields act to determine the position of leaf primordia. This is diagrammed in Fig. 5, where the simultaneous initiation of two primordia from the abph1 shoot meristem is modeled. Although one possibility is that the larger meristem would lead to the initiation of a single large primordium, the model shows how the concentration of a putative inhibitor could fall below a critical threshold level in two opposite regions of the meristem, leading to the simultaneous initiation of two primordia. In fact, Fig 5. could also represent the biophysical model if one assumes that the inhibitory fields are biophysical in nature.

Fig. 5.

A model to explain the initiation of decussate phyllotaxy in abph1 embryos. The shaded area represents the embryonic shoot apical meristem, prior to the initiation of true leaves. The gradient of shading represents the inhibitory effect of the meristem center on leaf initiation. X marks the site of initiation of the coleoptile, and the concentric dashed circles represent a field of inhibition emanating from this primordium. In the normal apex, the region of the meristem furthest from the zones of inhibition is opposite to the coleoptile and this is the site where the first leaf would initiate (arrowed). In the abph1 shoot meristem, which is considerably broader than normal, there are two zones where inhibition is lowest (arrowed). These are arranged perpendicular to the normal axis of leaf initiation, and correspond to the sites of leaf initiation in abph1 embryos.

Fig. 5.

A model to explain the initiation of decussate phyllotaxy in abph1 embryos. The shaded area represents the embryonic shoot apical meristem, prior to the initiation of true leaves. The gradient of shading represents the inhibitory effect of the meristem center on leaf initiation. X marks the site of initiation of the coleoptile, and the concentric dashed circles represent a field of inhibition emanating from this primordium. In the normal apex, the region of the meristem furthest from the zones of inhibition is opposite to the coleoptile and this is the site where the first leaf would initiate (arrowed). In the abph1 shoot meristem, which is considerably broader than normal, there are two zones where inhibition is lowest (arrowed). These are arranged perpendicular to the normal axis of leaf initiation, and correspond to the sites of leaf initiation in abph1 embryos.

The role of abph1 in normal maize development

In addition to producing a wider shoot meristem, the abph1 embryo is characterized by a wider scutellum and coleoptile, suggesting a more general role of the abph1 gene in controlling embryonic growth. The abph1 gene presumably plays a role in controlling the axial growth of several shoot structures in the embryo, however, it does not appear to affect all embryonic organs, for example the embryonic root develops into a normal primary root in abph1 seedlings.

Other mutations that increase the size of the shoot apical meristem in the embryo and have effects on phyllotaxy in the vegetative and floral shoots have been described (Clark et al., 1993, 1995; Leyser and Furner, 1992; Medford et al., 1992). However, when these mutations affect the vegetative phyllotaxy they cause it to become irregular, rather than changing it to a new regular pattern. Mutations that resemble abph1 more closely but affect floral organ number rather than leaf phyllotaxy include perianthia and wiggum (Running et al., 1998; Running and Meyerowitz, 1996). The mechanism of action of these mutations is probably different to abph1; pan leads to an increase in the number of outer whorl floral organs without affecting meristem size, and in wig flowers, although the width of the floral meristem is larger, floral organs are not initiated in a predictable pattern. We believe the abph1 mutation is unique because it is suggestive of a function that is specific to the establishment of pattern during embryogenesis, since in revertant seedlings the shoot meristem size returns to normal. The maintenance of a larger shoot meristem and decussate phyllotaxy in some abph1 plants does not necessarily reflect a function for the abph1 gene during postembryonic shoot development, rather this maintenance may be due to a homeostatic mechanism that could be biophysical or biochemical in nature. Therefore the function of abph1 may be more intimately associated with the establishment of the initial shoot apical meristem domain and of phyllotactic pattern, rather than being involved in the control of shoot meristem size throughout the life of the plant. Isolation and characterization of the abph1 gene should clarify its role in shoot development, and also help determine if it is involved in the evolution of phyllotactic patterns.

We would like to thank Drs M. Menzi and M. Frei for sending families of abphyl seed, the UC Berkeley SEM facility for training, Professor Paul Green for advice on the replica technique and many discussions on phyllotaxy, Drs Richard Greyson and David Walden for discussions on the abphyl syndrome, and members of the Hake laboratory for comments on the manuscript. D. J. was supported by a NATO postdoctoral fellowship and by USDA support to S. H. (Agricultural Research Service Project 5335-21000-007-00D).

This paper is dedicated to the memory of Paul Green, for his warm friendship and stimulating discussions in plant development.

Abbe
,
E. C.
,
Phinney
,
B. O.
and
Baer
,
D. F.
(
1951
).
The growth of the shoot apex in maize: internal features
.
Am. J. Bot
.
38
,
744
751
.
Abbe
,
E. C.
and
Stein
,
O. L.
(
1954
).
The growth of the shoot apex in maize: Embryogeny
.
Am. J. Bot
.
41
,
285
293
.
Arber
,
A.
(
1925
).
Monocotyledons: A Morphological Study
.
London
:
Cambridge University Press
.
Barnard
,
C.
(
1964
).
Form and Structure
.
In Grasses and Grasslands
(ed.
C.
Barnard
), pp.
47
72
.
London
:
MacMillan and Co. Ltd
.
Carr
,
D. J.
(
1984
).
Positional information in the specification of leaf, flower and branch arrangement
.
In Positional Controls in Plant Development
(ed.
P. W.
Barlow
and
D. J.
Carr
), pp.
441
460
.
Cambridge
:
Cambridge University Press
.
Clark
,
J. K.
and
Sheridan
,
W. F.
(
1991
).
Isolation and characterization of 51 embryo-specific mutations of maize
.
Plant Cell
3
,
935
951
.
Clark
,
S. E.
,
Jacobsen
,
S. E.
,
Levin
,
J. Z.
and
Meyerowitz
,
E. M.
(
1996
).
The CLAVATA and SHOOT MERISTEMLESS loci competitively regulate meristem activity in Arabidopsis
.
Development
122
,
1567
1575
.
Clark
,
S. E.
,
Running
,
M. P.
and
Meyerowitz
,
E. M.
(
1993
).
CLAVATA1, a regulator of meristem and flower development in Arabidopsis
.
Development
119
,
397
418
.
Clark
,
S. E.
,
Running
,
M. P.
and
Meyerowitz
,
E. M.
(
1995
).
CLAVATA3 is a specific regulator of shoot and floral meristem development affecting the same processes as CLAVATA1
.
Development
121
,
2057
2067
.
Clark
,
S. E.
,
Williams
,
R. W.
and
Meyerowitz
,
E. M.
(
1997
).
The CLAVATA1 gene encodes a putative receptor kinase that controls shoot and floral meristem size in Arabidopsis
.
Cell
89
,
575
585
.
Feldman
,
L.
(
1993
).
The maize root
.
In The Maize Handbook
.
New York
:
Springer Verlag
.
Fleming
,
A. J.
,
McQueen-Mason
,
S.
,
Mandel
,
T.
and
Kuhlemeier
,
C.
(
1997
)
Induction of leaf primordia by the cell wall protein expansin
.
Science
276
,
1415
1418
.
Fobert
,
P.
,
Coen
,
E.
,
Murphy
,
G.
and
Doonan
,
J.
(
1994
).
Patterns of cell division revealed by transcriptional regulation of genes during the cell cycle in plants
.
EMBO J
.
13
,
616
624
.
Green
,
P. B.
(
1987
).
Inheritance of pattern: Analysis from phenotype to gene
.
Amer. Zool
.
27
,
657
673
.
Green
,
P. B.
(
1994
).
Connecting gene and hormone action to form, pattern and organogenesis; biophysical transductions
.
J. Exp. Bot
.
45
,
1775
1788
.
Greyson
,
R. I.
and
Walden
,
D. B.
(
1972
).
The ABPHYL syndrome in Zea mays. I. arrangement, number and size of leaves
.
Amer. J. Bot
.
59
,
466
472
.
Greyson
,
R. I.
,
Walden
,
D. B.
,
Hume
,
J. A.
and
Erickson
,
R. O.
(
1978
).
The ABPHYL syndrome in Zea mays. II. Patterns of leaf initiation and the shape of the shoot meristem
.
Can. J. Bot
.
56
,
1545
1550
.
Jackson
,
D.
,
Veit
,
B.
and
Hake
,
S.
(
1994
).
Expression of maize KNOTTED1 related homeobox genes in the shoot apical meristem predicts patterns of morphogenesis in the vegetative shoot
.
Development
120
,
405
413
.
Kerstetter
,
R. A.
,
Laudencia-Chingcuanco
,
D.
,
Smith
,
L. G.
and
Hake
,
S.
(
1997
).
Loss of function mutations in the maize homeobox gene, knotted1, are defective in shoot meristem maintenance
.
Development
124
,
3045
3054
.
Laux
,
T.
,
Mayer
,
K. F. X.
,
Berger
,
J.
and
Jurgens
,
G.
(
1996
).
The Wuschel gene is required for shoot and floral meristem integrity in Arabidopsis
.
Development
122
,
87
96
.
Leyser
,
H. M. O.
and
Furner
,
I. J.
(
1992
).
Characterization of three shoot apical meristem mutants of Arabidopsis thaliana
.
Development
116
,
397
403
.
Long
,
J. A.
,
Moan
,
E. I.
,
Medford
,
J. I.
and
Barton
,
M. K.
(
1996
).
A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis
.
Nature (London)
379
,
66
69
.
Lyndon
,
R. F.
(
1982
).
Changes in polarity of growth during leaf initiation in the pea, Pisum sativum L
.
Ann. Bot
.
49
,
281
290
.
Marc
,
J.
and
Hackett
,
W. P.
(
1991
).
Gibberellin-induced reorganization of spatial relationships of emerging leaf primordia at the shoot apical meristem in Hedera helix L
.
Planta
185
,
171
178
.
Medford
,
J. I.
(
1992
).
Vegetative apical meristems
.
Plant Cell
4
,
1029
1039
.
Medford
,
J. I.
,
Behringer
,
F. J.
,
Callos
,
J. D.
and
Feldmann
,
K. A.
(
1992
).
Normal and abnormal development in the Arabidopsis vegetative shoot apex
.
Plant Cell
4
,
631
643
.
Meyerowitz
,
E. M.
(
1997
).
Genetic control of cell division patterns in developing plants
.
Cell
88
,
299
308
.
Michelmore
,
R. W.
,
Paran
,
I.
and
Kesseli
,
R. V.
(
1991
).
Identification of markers linked to disease-resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations
.
Proc. Nat. Acad. Sci. USA
88
,
9828
9832
.
Moussian
,
B.
,
Schoof
,
H.
,
Haecker
,
A.
,
Jurgens
,
G.
and
Laux
,
T.
(
1998
).
Role of the ZWILLE gene in the regulation of central shoot meristem cell fate during Arabidopsis embryogenesis
.
EMBO J
.
17
,
1799
1809
.
Poethig
,
R. S.
(
1984
).
Cellular parameters of leaf morphogenesis in maize and tobacco
.
In Contemporary Problems in Plant Anatomy (ed. R. A. White and W. C. Dickinson)
, pp.
235
258
.
New York
:
Academic Press
.
Randolph
,
L. F.
(
1936
).
Developmental morphology of the caryopsis in maize
.
J. Ag. Res
.
53
,
881
916
.
Reinhardt
,
D.
,
Wittwer
,
F.
,
Mandel
,
T.
and
Kuhlemeier
,
C.
(
1998
).
Localized upregulation of a new expansin gene predicts the site of leaf formation in the tomato meristem
.
Plant Cell
10
,
1427
1438
.
Renaudin
,
J. P.
,
Colasanti
,
J.
,
Rime
,
H.
,
Yuan
,
Z.
and
Sundaresan
,
V.
(
1994
).
Cloning of four cyclins from maize indicates that higher plants have three structurally distinct groups of mitotic cyclins
.
Proc. Natl. Acad. Sci. USA
91
,
7375
7379
.
Rosen
,
B.
and
Beddington
,
R. S. P.
(
1993
).
Whole-mount in situ hybridization in the mouse embryo: gene expression in three dimensions
.
Trends Genet
.
9
,
162
167
.
Running
,
M. P.
,
Fletcher
,
J. C.
and
Meyerowitz
,
E. M.
(
1998
).
The WIGGUM gene is required for proper regulation of floral meristem size in Arabidopsis
.
Development
125
,
2545
2553
.
Running
,
M. P.
and
Meyerowitz
,
E. M.
(
1996
).
Mutations in the PERIANTHIA gene of Arabidopsis specifically alter floral organ number and initiation pattern
.
Development
122
,
1261
1269
.
Scanlon
,
M. J.
,
Schneeberger
,
R. G.
and
Freeling
,
M.
(
1996
).
The maize mutant narrow sheath fails to establish leaf margin identity in a meristematic domain
.
Development
122
,
1683
1691
.
Schoute
,
J. C.
(
1913
).
Beitrage zur Blattstellungslehre. I Die theorie
.
Recueil des Travaux Botanique Neerlandais
10
,
153
325
.
Schwabe
,
W. W.
(
1984
).
Phyllotaxis
.
In Positional Controls in Plant Development
. (ed.
P. W.
Barlow
and
D. J.
Carr
), pp.
403
440
.
Cambridge
:
Cambridge University Press
.
Smith
,
L. G.
,
Jackson
,
D.
and
Hake
,
S.
(
1995
).
The expression of Knotted1 marks shoot meristem formation during maize embryogenesis
.
Dev. Gen
.
16
,
344
348
.
Snow
,
M.
and
Snow
,
R.
(
1933
).
Experiments on phyllotaxis II. The effect of displacing a primordium
.
Philos. Trans. R. Soc. Lond. B
222
,
353
400
.
Souer
,
E.
,
Vanhouwelingen
,
A.
,
Kloos
,
D.
,
Mol
,
J.
and
Koes
,
R.
(
1996
).
The no apical meristem gene of Petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordia boundaries
.
Cell
85
,
159
170
.
Steeves
,
T. A.
and
Sussex
,
I. M.
(
1989
).
Patterns in Plant Development
.
Cambridge
:
Cambridge University Press
.
Sussex
,
I. M.
(
1989
).
Developmental programming of the shoot meristem
.
Cell
56
,
225
229
.
Wardlaw
,
C. W.
(
1949
).
Experiments on organogenesis in ferns
.
Growth Suppl
.
13
,
93
131
.
Wardlaw
,
C. W.
(
1957
).
On the organization and reactivity of the shoot apex in vascular plants
.
Am. J. Bot
.
44
,
176
185
.
Williams
,
M. H.
and
Green
,
P. B.
(
1988
).
Sequential scanning electron microscopy of a growing plant meristem
.
Protoplasma
147
,
77
79
.