We have identified a Drosophila transcription factor that binds a sequence element found in the larval promoters of all known alcohol dehydrogenase (Adh) genes. DNA sequence analysis of cDNA clones encoding this protein, box A-binding factor (ABF), reveals that it is a member of the GATA family of transcriptional regulatory factors. ABF-binding sites within the D. mulleri and D. melanogaster larval Adh promoters function as positive regulatory elements and in cotransfection experiments, ABF functions as a transcriptional activator. In further support of a role for ABF in the regulation of Adh expression, ABF mRNA is expressed in the embryonic fat body, a tissue that contains high levels of Adh mRNA.

Our studies demonstrate that the fat body develops from segmentally repeated clusters of mesodermal cells, which later expand and coalesce to form the mature fat body. These observations establish ABF as the earliest known fat body precursor marker in the Drosophila embryo. Together with the established role of GATA factors during mammalian development, these results suggest that ABF may play a key role in the organogenesis of the fat body.

The Drosophila genes that encode the enzyme alcohol dehydrogenase (Adh) provide well-characterized examples of tissue-specific transcriptional regulation during eukaryotic development. Adh is transcribed in the embryonic, larval and adult fat bodies of every Drosophila species examined, as well as in other tissues that vary from species to species (Sofer and Martin, 1987). These species-specific differences are controlled by cis-acting elements closely linked to the structural genes (Bayer et al., 1992; Brennan and Dickinson, 1988; Brennan et al., 1988; Corbin and Maniatis, 1989a; Fischer and Maniatis, 1986). In order to investigate the mechanisms that control the temporal and tissue-specific transcription of the Adh gene, previous studies have compared the cis-acting regulatory elements required for the expression of the Adh genes in two distantly related species, Drosophila melanogaster (Corbin and Maniatis, 1989a,b, 1990) and Drosophila mulleri (Fischer and Maniatis, 1986, 1988).

Adh transcripts in D. melanogaster, as in most other Drosophila species, are generated in a stage-specific manner from a single gene by the differential utilization of two tandem promoters (Savakis et al., 1986). Transcription is initiated from the proximal promoter in embryos and larvae, whereas the distal promoter is active for a brief period during mid-embryogenesis, in late larval stages and in adults. Each of these promoters is active in the fat body and in a limited number of other tissues, including the gut and reproductive organs.

Using germ line transformation, the cis-acting sequences necessary for the proper expression of the D. melanogaster Adh gene in vivo have been identified. The Adh adult enhancer (AAE), a 140 bp element located at about −500, drives expression of the distal promoter in adults, whereas the complex Adh larval enhancer (ALE) drives expression of the proximal promoter in larvae (Corbin and Maniatis, 1989a, 1990). The detailed dissection of the proximal promoter using both germ line transformation (Corbin and Maniatis, 1990) and a somatic transient assay (Shen et al., 1991) has identified two regions within the 400 bp immediately upstream of the proximal transcriptional start site that are necessary for wild-type transcription levels in all larval tissues.

By contrast, two distinct functional Adh genes, Adh-1 and Adh-2, are present in D. mulleri. The Adh-1 gene is expressed in embryos and larvae, whereas the Adh-2 gene is expressed in adults. Although the organization of the locus is quite different, the Adh genes of D. mulleri are expressed in approximately the same pattern as those of D. melanogaster, and the D. mulleri Adh genes are expressed correctly when introduced into the germ line of D. melanogaster (Fischer and Maniatis, 1986).

In adults, expression of the D. mulleri Adh-2 gene is regulated by an enhancer located more than 2000 bp upstream of the start site of transcription (Fischer, 1987). In larvae, the expression of the Adh-1 gene requires two enhancer elements – an upstream enhancer, box B, and an enhancer located 3’ of the gene. These enhancers, like those of the D. melanogaster Adh gene, behave as fat body specific regulatory elements in association with a heterologous promoter. A promoter element, box A, is required for the proper expression in the full range of larval tissues. The identification of box A is based on the observation that linker substitution and deletion mutants that lie in the region between −91 and −60 of the Adh-1 promoter result in lower levels of expression in vivo (Fischer and Maniatis, 1988). Unlike the larval enhancer elements, multiple copies of box A are inactive when placed upstream of a heterologous promoter (Fischer, 1987).

Recent studies have sought to identify factors that play a role in the activity of these fat body-specific enhancers. All well-characterized fat body-specific enhancers contain a sequence that is recognized by box B-binding factor-2 (BBF-2), a Drosophila CREB/ATF transcriptional activator protein (Abel et al., 1992). In addition, adult fat body enhancers contain a regulatory unit which consists of a positive element that binds mammalian C/EBP and a negative element that binds Drosophila AEF-1, a zinc finger-containing transcriptional repressor (Falb and Maniatis, 1992). Studies using Drosophila tissue culture cells have localized an additional positive regulatory element within the AAE that shares sequence similarity with the steroid hormone response elements found in many mammalian genes and is recognized by FTZ-F1, a Drosophila member of the steroid hormone receptor super family (Ayer and Benyajati, 1992). One factor, Adh distal factor-1 (Adf-1), has been identified that interacts specifically with Adh upstream promoter elements (England et al., 1992).

In order to investigate the mechanisms responsible for the regulatory activities of the larval promoters of the Adh genes of D. mulleri and D. melanogaster, we have identified and characterized a factor that recognizes a sequence present within box A and the proximal promoter. This transcription factor, box A-binding factor (ABF), was initially cloned from a D. melanogaster cDNA library on the basis of its ability to bind specifically to the box A element of the D. mulleri Adh 1 gene. ABF recognizes a sequence element, T/AGATAA, which is found in the larval promoter of all known Drosophila Adh genes, including box A and the proximal promoter. DNA sequence analysis of ABF cDNA clones reveals that it contains a single DNA-binding zinc finger similar to those found in the DNA-binding domain of the GATA family of transcriptional regulatory proteins (Orkin, 1992). The best characterized member of the GATA family, GATA-1, has been implicated in the transcriptional regulation of erythroid-specific genes (Martin and Orkin, 1990; Tsai et al., 1989) and is involved in the determination of red cell lineage in vertebrates (Pevny et al., 1991). Early in development, ABF is expressed in a dynamic pattern which begins in the presumptive endoderm and cephalic mesoderm and ends in the fat body. Later in embryonic development, when Adh begins to be expressed in the mature fat body, ABF is also expressed exclusively in this tissue.

cDNA cloning and DNA sequencing

A 9-to 12-hour embryonic cDNA library in λgt11 (Zinn et al., 1988) was probed as described previously (Abel et al., 1992). For this screening, a multimerized probe prepared from an oligonucleotide encompassing box A and labeled by nick-translation (Sambrook et al., 1989) was used. This oligonucleotide includes the region from −60 to −91 of the Adh-1 promoter with a BamHI site added to the 5’ end and a BglII site at the 3’ end. The sequence is GATCCGCCGACCGCGCGGCCAGTGGTATTGATAAGACA(linker sequences underlined).

Other cDNA clones were isolated by screening the 9-to 12-hour embryonic cDNA library and ABF-specific embryonic cDNA clones using standard nucleic acid hybridization techniques (Sambrook et al., 1989). The ABF-specific cDNA clones were prepared using 0-to 12-hour embryonic poly(A)+ RNA. All reactions were carried out as described (Thanos and Maniatis, 1992) with the following modifications. First-strand synthesis was primed using an oligonucleotide complementary to nucleotides 1184 to 1167 of the ABF sequence shown in Fig. 1A. After second strand synthesis using RNaseH and DNA polymerase I, NotI-EcoRI linkers were added to the ends of the cDNA and the DNA fragments were cloned into the EcoRI site of λgt11. In screening these cDNA clones, a random-oligonucleotide primed DNA probe (Sambrook et al., 1989) prepared from a gel-purified EcoRI-NarI fragment of λABF, extending from 846 to 1270 of the ABF sequence shown in Fig. 1A was used.

Fig. 1.

ABF encodes an 82×103Mr protein with a DNA-binding domain homologous to the GATA family of transcriptional regulatory proteins. (A) cDNA and predicted protein sequences of ABF. The ORF begins at nucleotide 282 and ends at nucleotide 2618, thus encoding a protein of 779 amino acids. The zinc finger, which is characteristic of the GATA family of transcriptional regulatory proteins, is underlined. (B) A comparison of the zinc finger of ABF with other members of the GATA family. The amino acid sequence of the C terminal finger from each member of the human GATA family, hGATA-1 (Zon et al., 1990), hGATA-2 (Dorfman et al., 1992; Lee et al., 1991), and hGATA-3 (Ho et al., 1991; Joulin et al., 1991; Ko et al., 1991), the C-terminal finger of dGATAa (Winick et al., 1993), the single finger from areA (Kudla et al., 1990) and the single finger from nit-2 (Fu and Marzluf, 1990) are shown. The identity of the protein is shown at left, and the numbers preceding and following each sequence correspond to the first and last amino acid residue, respectively. The number shown in parentheses is the percent identity in the region shown between that factor and ABF. Vertical lines indicate residues that are identical between ABF and hGATA-2; two dots indicate conserved residues. The cysteines are underlined. The consensus sequence derived from this group of proteins is shown at the bottom, where dots indicate nonconserved positions.

Fig. 1.

ABF encodes an 82×103Mr protein with a DNA-binding domain homologous to the GATA family of transcriptional regulatory proteins. (A) cDNA and predicted protein sequences of ABF. The ORF begins at nucleotide 282 and ends at nucleotide 2618, thus encoding a protein of 779 amino acids. The zinc finger, which is characteristic of the GATA family of transcriptional regulatory proteins, is underlined. (B) A comparison of the zinc finger of ABF with other members of the GATA family. The amino acid sequence of the C terminal finger from each member of the human GATA family, hGATA-1 (Zon et al., 1990), hGATA-2 (Dorfman et al., 1992; Lee et al., 1991), and hGATA-3 (Ho et al., 1991; Joulin et al., 1991; Ko et al., 1991), the C-terminal finger of dGATAa (Winick et al., 1993), the single finger from areA (Kudla et al., 1990) and the single finger from nit-2 (Fu and Marzluf, 1990) are shown. The identity of the protein is shown at left, and the numbers preceding and following each sequence correspond to the first and last amino acid residue, respectively. The number shown in parentheses is the percent identity in the region shown between that factor and ABF. Vertical lines indicate residues that are identical between ABF and hGATA-2; two dots indicate conserved residues. The cysteines are underlined. The consensus sequence derived from this group of proteins is shown at the bottom, where dots indicate nonconserved positions.

All cDNA clones were subcloned into the EcoRI of pSp72 (Promega). Deletions were generated using Exonuclease III or appropriate restriction sites and these double-stranded templates were sequenced with either Sp6 or T7 promoter primers using Sequenase (US Biochemical) or Taq polymerase (Stratagene). For some regions with high GC content, deoxyinosine mixes were also used for sequencing. Both strands of four independent, overlapping clones were sequenced in their entirety.

Bacterial protein production

For expression in Escherichia coli, the EcoRI fragment from λABF (starting at amino acid 189 of the sequence shown in Fig. 1A) was subcloned in frame into the translation vector pET3b (Rosenberg et al., 1987). As a control, λABF insert was subcloned in the reverse orientation in this plasmid. These plasmids were transformed into the bacterial strain BL21(DE3), grown to OD600=0.4, induced with 0.4 mM IPTG, grown for an additional 2 hours and harvested by centrifugation. Total soluble bacterial protein was subsequently isolated (Desplan et al., 1985).

Gel retardation experiments and DNase I footprinting

For gel retardation assays, bacterial extracts were incubated with 15,000 cts/minute of the end-labeled box A oligonucleotide or an end-labeled probe prepared from the Adh-1 promoter using conditions as described (Abel et al., 1992). Samples were electrophoresed on a 4% 0.5× Tris-borate/EDTA nondenaturing gel at 4°C.

DNase I footprinting experiments using a box A probe and bacterial extract were carried out as described (Heberlein et al., 1985) using the modifications of Abel et al. (1992). Maxam-Gilbert sequencing reactions were run on the 8% polyacryamide sequenc ing gel as markers.

Schneider cell transfections

For expression in Drosophila tissue culture cells, a clone containing the complete coding region of ABF was constructed using a unique MluI site within ABF. This full-length ABF was subcloned into the effector plasmid pPac (Krasnow et al., 1989). In this plasmid (pPacABF), expression is driven by the actin5C promoter and transcripts are terminated at actin5C polyadenylation sites. Reporter plasmids were derived from pD-33CAT (Krasnow et al., 1989) in which the sequence from −33 to +53 of the D. melanogaster Adh gene is fused to the bacterial gene CAT. pBoxA6CAT was constructing by cloning a box A oligonucleotide flanked by BamHI and BglII sites into the BglII site of the modified pD-33CAT vector (Abel et al., 1992).

Schneider line 2 cells were grown and transfected exactly as described in Abel et al. (1992). The plasmid hsp82lacZ (provided by A. Ephrussi), which contains the Drosophila hsp82 promoter driving the expression of lacZ, was included as a control in all transfections. The amount of extract used in each CAT assay was normalized based on the β-galactosidase activity. CAT assays and β-galactosidase activities were carried out as described (Abel et al., 1992).

RNA preparation and northern analysis

For the isolation of embryonic RNAs, embryos were collected on yeasted grape juice plates from population cages at 6 hour intervals and aged at 25°C. They were dechorionated in 50% Clorox. For larval stages, first instar larvae were harvested at ∼36 hour of development and wandering third instar larvae were isolated. Adults were harvested 4 days after eclosion. Flies from all developmental stages were frozen on dry ice and stored at −80°C.

Frozen flies were pulverized on dry ice with a mortar and pestle and quickly transferred to a solution containing 4 M guanidinium thiocyanate, 25 mM sodium citrate, 0.5% Sarkosyl and 0.1 M 2 mercaptoethanol. Total RNA was isolated by centrifugation using standard procedures and poly(A)+ RNA was isolated by two passages over oligo(dT) cellulose (Sambrook et al., 1989).

For northern analysis, 4 µg of poly(A)+ RNA from various developmental stages was fractionated on a 1% agarose gel containing 6.7% formaldehyde, transferred to Biotrans (ICN) nylon membrane, hybridized and washed under stringent conditions (Sambrook et al., 1989). The probe for this experiment was an AvaI-BstXI fragment of the full-length ABF cDNA clone, which was labeled by random priming (Sambrook et al., 1989). The northern blot was also probed with a random-primed labeled EcoRI-HindIII fragment from the gene encoding ribosomal protein 49 (rp49; O’Connell and Rosbash, 1984).

Whole-mount embryo analysis

In situ hybridization to whole Oregon R embryos was carried out using the Genius DNA labeling and detection kit (Boehringer Mannheim) as described by Tautz and Pfiefle (1989) and modified by Michelson et al. (1990). The probe for this experiment was an AccI-EcoRI fragment from the ABF cDNA clone and a BamHI XbaI fragment from the genomic Adh clone (Goldberg, 1980). Stained embryos were mounted in 90% glycerol so that they could be rotated for visualization from all perspectives during microscopy and photography.

ABF contains a DNA-binding domain similar to that of the GATA family of transcriptional regulatory proteins

A cDNA clone encoding a protein that specifically binds to box A (−60 to −91 of the D. mulleri larval promoter) was isolated by screening a D. melanogaster 9-to 12-hour embryonic λgt11 cDNA expression library (Zinn et al., 1988) with a probe containing multiple copies of box A (Vinson et al., 1988). A D. melanogaster library was chosen because all studies of the cis-acting regulatory elements of the D. mulleri gene were carried out in D. melanogaster (Fischer and Maniatis, 1986, 1988). This stage of embryo-genesis was chosen because it is when Adh is first expressed (Fischer and Maniatis, 1986; Lockett and Ashburner, 1989; Savakis et al., 1986) and the fat body begins to form (Rizki, 1978). An initial isolate (box A-binding factor; λABF) containing an insert of 2.4 kb encoded a protein that bound specifically to the box A probe and not to other control probes (data not shown).

Preliminary sequence analysis of λABF revealed that it lacked a translation initiation codon and was a partial cDNA clone. Further nucleic acid hybridization screens were performed in order to isolate cDNA clones containing the entire coding region of ABF. Several overlapping cDNA clones spanning 3.2 kb of sequence were isolated. The complete nucleotide sequence of these clones contains an open reading frame of 2337 bp, encoding a protein of 779 amino acids with a predicted molecular mass of 82 kD (Fig. 1A). The use of the AUG at nucleotide 282 is consistent with the size of the in vitro translation product (data not shown). This coding region is flanked by 5’ and 3’ untranslated regions of 283 and 402 bp, respectively. The overlapping cDNA clones together encompass nearly the complete mRNA because the length of the cloned region is comparable to that of the corresponding mRNA (Fig. 4).

Southern blot analysis of Drosophila genomic DNA at high stringency revealed a simple pattern of bands suggesting that ABF is encoded by a single gene (data not shown). The cytological location of the ABF gene was determined using in situ hybridization to polytene chromosomes prepared from the salivary glands of third instar larvae. ABF maps to the third chromosome at cytological position 89B (data not shown) near the dominant marker Stubble (Lindsley and Zimm, 1992).

The examination of the amino acid sequence of the ABF protein and a search of the GenBank database revealed that ABF contains a single Cys-X2-Cys-X17-Cys-X2-Cys zinc finger, a domain which is found in the GATA family of DNA-binding transcriptional regulatory proteins (for a review, see Orkin, 1992; Fig. 1B). The four members of the GATA multigene family in vertebrates all contain two zinc fingers, both of which are necessary to achieve specific, stable DNA binding. The carboxyl finger, however, appears to play a dominant role in DNA binding because mutation of the amino finger of GATA-1 reduces the stability and specificity of DNA binding but does not eliminate binding (Martin and Orkin, 1990; Yang and Evans, 1992). ABF contains a single zinc finger, which is most similar to the carboxyl finger of vertebrate GATA factors (Fig. 1B), specifically the carboxyl finger of hGATA-2 (Dorfman et al., 1992; Lee et al., 1991); in a stretch of 72 amino acids, these proteins are 71% identical. As shown in Fig. 1B, ABF is more closely related to the human multigene GATA family than it is to another known member of the GATA family in Drosophila, dGATAa (Winick et al., 1993). Studies of the regulatory factors involved in nitrogen metabolism in Aspergillus and Neurospora have previously identified two GATA family members, areA (Kudla et al., 1990) and nit-2 (Fu and Marzluf, 1990), each of which contains a single finger. areA is the GATA family member that is most distantly related to ABF, for the DNA-binding domains of these proteins are only 46% identical. The similarity between ABF and other GATA family members does not extend beyond the DNA-binding domain.

The Drosophila opa repetitive element, which consists of units of the nucleotide triplet CAX (Wharton et al., 1985), is found in several regions of ABF. The opa element is found in both coding and noncoding regions of many Drosophila genes and it encodes the polyglutamine, polyasparagine and polyalanine stretches found in the ABF protein.

ABF binds to positive regulatory elements within Adh larval promoters

DNase I footprinting experiments were carried out in order to determine the region of box A recognized by ABF. As shown in Fig. 2A, recombinant ABF produced in bacteria protects a 13 bp region extending from −61 to −73 of the Adh-1 promoter from DNase I cleavage. This region lies at the 3’ end of box A and includes a sequence, TGATAA, which fits the GATA family consensus sequence of WGATAR (Evans et al., 1990).

Fig. 2.

ABF binds to box A and the proximal promoter. (A) DNase I footprinting studies of ABF binding to D. mulleri box A. (B) DNase I footprinting studies of ABF binding to the D. melanogaster proximal promoter. Endlabeled probes containing each of these promoters were incubated with the indicated amount (1-2 µl, above each lane) of bacterial extract containing ABF fusion protein or 2 µl of control bacterial extract (C) and then treated with DNase I. The products were then separated on a sequencing gel. The residues protected by ABF are shown beside each autoradiogram as a shaded oval. (C) ABF binds less well to linker substitution mutants that reduce Adh-1 expression in vivo. Gel retardation assay of ABF using mutant box A probes. Bacterial extract containing an ABF fusion protein (in the sense orientation (S) or in the antisense orientation (α)) was mixed with end-labeled probes prepared from the wild-type Adh-1 promoter (WT) and from two linker substitution mutants (LS21 and LS22; Fischer and Maniatis, 1988). After incubation, complexes were separated by electrophoresis on a native gel. The free probe and the complexes specific for ABF are marked. Other bands that are not labeled are also seen in control bacterial extract, which does not contain ABF protein, and they thus represent the binding of endogenous bacterial proteins. The multiple bound complexes appear to be the result of proteolysis.

Fig. 2.

ABF binds to box A and the proximal promoter. (A) DNase I footprinting studies of ABF binding to D. mulleri box A. (B) DNase I footprinting studies of ABF binding to the D. melanogaster proximal promoter. Endlabeled probes containing each of these promoters were incubated with the indicated amount (1-2 µl, above each lane) of bacterial extract containing ABF fusion protein or 2 µl of control bacterial extract (C) and then treated with DNase I. The products were then separated on a sequencing gel. The residues protected by ABF are shown beside each autoradiogram as a shaded oval. (C) ABF binds less well to linker substitution mutants that reduce Adh-1 expression in vivo. Gel retardation assay of ABF using mutant box A probes. Bacterial extract containing an ABF fusion protein (in the sense orientation (S) or in the antisense orientation (α)) was mixed with end-labeled probes prepared from the wild-type Adh-1 promoter (WT) and from two linker substitution mutants (LS21 and LS22; Fischer and Maniatis, 1988). After incubation, complexes were separated by electrophoresis on a native gel. The free probe and the complexes specific for ABF are marked. Other bands that are not labeled are also seen in control bacterial extract, which does not contain ABF protein, and they thus represent the binding of endogenous bacterial proteins. The multiple bound complexes appear to be the result of proteolysis.

To explore whether ABF interacts with any other well characterized Adh regulatory elements, we performed a gel shift analysis using probes from the D. melanogaster distal and proximal promoters, the D. melanogaster and D. mulleri adult enhancers, and the D. mulleri larval enhancer, box B. This analysis revealed that ABF specifically binds to the proximal promoter of D. melanogaster and to none of the other tested regulatory regions (data not shown). DNase I footprinting experiments demonstrate that recombinant ABF protects a region of the proximal promoter extending from −76 to −92 from DNase I cleavage (Fig. 2B). AGATAA, a sequence that fits the WGATAR consensus, lies within this region of the proximal promoter.

Thus two ABF-binding sites share a common sequence that fits the consensus for the GATA family of DNA-binding proteins. To demonstrate that ABF recognizes this sequence element within the footprinted region, we carried out a methylation interference experiment (Abel, 1993). This experiment revealed that ABF interacts with the guanine and adenine residues present in the sequence GATAAG, which lies at the 3’ end of box A in the region protected from DNase I cleavage by ABF. ABF also binds to the GATA element found in the erythropoietin receptor promoter (Zon et al., 1991; data not shown). Furthermore, recombinant mouse GATA-1 protein (Tsai et al., 1989) binds specifically to a box A probe (data not shown).

The binding site for ABF within box A lies in the region of two overlapping linker substitution mutations (LS21 and LS22) that lead to lower levels of expression in vivo (Fischer and Maniatis, 1988). A gel retardation assay was used to investigate the effect of these mutations on ABF binding. As shown in Fig. 2C, recombinant ABF binds at least one hundredfold less well to these two linker substitution mutants relative to wild-type ABF sequences. Thus, the ABF-binding site within box A is a positive regulatory element. Additional evidence of the importance of ABF-binding sites in Adh transcriptional regulation comes from germ line transformation experiments (Corbin and Maniatis, 1990) and somatic transient assays (Shen et al., 1991) which explored the effect of mutations within the D. melanogaster proximal promoter. Both of these studies demonstrated that deletion of the ABF-binding site within the proximal promoter leads to reduced levels of expression in vivo.

ABF is a transcriptional activator

The observation that ABF-binding sites function as positive regulatory elements within the larval promoters of the D. mulleri and D. melanogaster Adh genes suggested that ABF may function as a transcriptional activator protein. In order to investigate this function of ABF, we used transient cotransfection assays in Drosophila tissue culture cells. ABF was cloned into the Drosophila expression vector pPac (Krasnow et al., 1989), creating a vector (pPacABF) in which the Drosophila actin promoter drives expression of sense ABF. A reporter plasmid was constructed which contained six copies of box A driving expression of the bacterial chloramphenicol acetyltransferase (CAT) gene. This effector plasmid was transiently cotransfected along with the reporter plasmid into Drosophila Schneider 2 cells. Cotransfection of ABF increases expression from a reporter (pBoxA6CAT) containing the box A promoter element by about tenfold (Fig. 3). In the absence of cotransfected ABF, the box A promoter element exhibits some basal activity, consistent with the observation that ABF mRNA is present in this cell line (data not shown). ABF also activates transcription in HeLa cells where the basal activity of the reporter is low (data not shown).

Fig. 3.

ABF activates transcription in transient cotransfection studies in Drosophila tissue culture cells. S2 cells were transfected with 0.25 µg of a reporter plasmid containing 6 copies of box A driving the expression of CAT(pBoxA6CAT) and 5 µg of an effector plasmid containing ABF (pPacABF). As a control, the reporter plasmid (−33AdhCAT) lacking any promoter sequences and the effector plasmid (pPac) lacking an insert were used. The plasmid hsp82lacZ was used as a control for transfection efficiency. The amount of extract used in each CAT assay was normalized based on the β-galactosidase activity. The reactions were separated on TLC plates and autoradiograms of these TLC plates are shown. The numbers above each lane represent the percent conversion of 14C-labeled chloramphenicol to monoacetylated forms. Results similar to those shown have been observed in four independent experiments.

Fig. 3.

ABF activates transcription in transient cotransfection studies in Drosophila tissue culture cells. S2 cells were transfected with 0.25 µg of a reporter plasmid containing 6 copies of box A driving the expression of CAT(pBoxA6CAT) and 5 µg of an effector plasmid containing ABF (pPacABF). As a control, the reporter plasmid (−33AdhCAT) lacking any promoter sequences and the effector plasmid (pPac) lacking an insert were used. The plasmid hsp82lacZ was used as a control for transfection efficiency. The amount of extract used in each CAT assay was normalized based on the β-galactosidase activity. The reactions were separated on TLC plates and autoradiograms of these TLC plates are shown. The numbers above each lane represent the percent conversion of 14C-labeled chloramphenicol to monoacetylated forms. Results similar to those shown have been observed in four independent experiments.

Fig. 4.

ABF is expressed at varying levels throughout development. Poly(A)+ RNAs were isolated from 0-to 6-hour, 6-to 12-hour, 12-to 18-hour, and 18- to 24-hour embryos, first and third instar larvae and adults. These were run on an agarose gel, transferred to a nylon membrane and probed with radioactive DNA probes prepared from ABF and RP49 (O’Connell and Rosbash, 1984). The bands corresponding to these RNAs as well as their size in kb are shown.

Fig. 4.

ABF is expressed at varying levels throughout development. Poly(A)+ RNAs were isolated from 0-to 6-hour, 6-to 12-hour, 12-to 18-hour, and 18- to 24-hour embryos, first and third instar larvae and adults. These were run on an agarose gel, transferred to a nylon membrane and probed with radioactive DNA probes prepared from ABF and RP49 (O’Connell and Rosbash, 1984). The bands corresponding to these RNAs as well as their size in kb are shown.

Temporal and spatial pattern of ABF expression

The D. melanogaster proximal promoter is active from mid embryogenesis through the third larval instar (Savakis et al., 1986). Similarly, the D. mulleri Adh-1 gene, when introduced into the D. melanogaster genome using P-element mediated transformation, is expressed in embryos and at higher levels in larvae (Fischer and Maniatis, 1986). To compare the expression of the gene encoding ABF with the expression of these Adh genes, a northern blot containing poly(A)+ RNA prepared from various developmental stages was hybridized to a probe prepared from the ABF cDNA clone. As shown in Fig. 4, the ABF mRNA is 3.5 kb in length and is present at varying levels throughout development. The highest levels are seen during 6 to 12 hours of embryogenesis, a time when Adh transcription begins in the embryo.

A previous study, which used in situ hybridization to characterize in detail the temporal and spatial expression pattern of the D. melanogaster Adh gene during embryogenesis, established that Adh transcription begins 10.5 hours after fertilization (Lockett and Ashburner, 1989). This expression, which occurs from both the proximal and distal promoters, is confined to the fat body. At 16 hours, expression occurs solely from the proximal promoter and is seen in the gut in addition to the fat body. To explore the spatial and temporal expression pattern of ABF and to compare this pattern with that of Adh, ABF mRNA was localized in Drosophila embryos of various developmental stages using a whole-mount in situ hybridization technique (Tautz and Pfeifle, 1989).

The analysis of the spatial pattern of ABF expression during embryogenesis (Figs 5, 6) reveals that expression is dynamic and appears to occur in two phases. In the early phase, ABF transcripts are present in a variety of tissues that arise from different germ layers. In the late phase, which begins after the completion of germ band extension, ABF expression is observed only in the developing fat body.

Fig. 5.

Early in embryogenesis ABF is expressed in a variety of tissues. In situ hybridization to whole-mount embryos with digoxigenin labeled probe (Tautz and Pfeifle, 1989) was used to determine the spatial distribution of ABF mRNA in embryos of various stages. The product of the alkaline phosphatase reaction indicates the presence of ABF transcripts. Embryos were staged according to Campos-Ortega and Hartenstein (1985). In all views, anterior is to the left. Lateral views, with dorsal at the top, are shown in A,B,D and E; a dorsal view is shown in C; a ventral view is shown in F. (A) ABF expression first appears just following cellularization (late stage 5) in the anterior and posterior midgut primordium, the vitellophages, and the primordium of the cephalic mesoderm. Note the unstained pole cells, which are the germ line precursors, at the posterior pole. (B,C) As gastrulation begins and the ventral furrow forms (stage 6), ABF transcripts are detected in the amnioserosa. (D) During germ band elongation, staining for ABF becomes weaker in the anterior and posterior midgut and amnioserosa, but continues at high levels in the cephalic mesoderm. (E,F) At the completion of germ band extension, ABF transcripts are seen only in the cephalic mesoderm.

Fig. 5.

Early in embryogenesis ABF is expressed in a variety of tissues. In situ hybridization to whole-mount embryos with digoxigenin labeled probe (Tautz and Pfeifle, 1989) was used to determine the spatial distribution of ABF mRNA in embryos of various stages. The product of the alkaline phosphatase reaction indicates the presence of ABF transcripts. Embryos were staged according to Campos-Ortega and Hartenstein (1985). In all views, anterior is to the left. Lateral views, with dorsal at the top, are shown in A,B,D and E; a dorsal view is shown in C; a ventral view is shown in F. (A) ABF expression first appears just following cellularization (late stage 5) in the anterior and posterior midgut primordium, the vitellophages, and the primordium of the cephalic mesoderm. Note the unstained pole cells, which are the germ line precursors, at the posterior pole. (B,C) As gastrulation begins and the ventral furrow forms (stage 6), ABF transcripts are detected in the amnioserosa. (D) During germ band elongation, staining for ABF becomes weaker in the anterior and posterior midgut and amnioserosa, but continues at high levels in the cephalic mesoderm. (E,F) At the completion of germ band extension, ABF transcripts are seen only in the cephalic mesoderm.

Fig. 6.

Later in embryogenesis ABF is expressed in the developing fat body. (A-D) ABF and (E) Adh mRNAs were visualized using in situ hybridization to whole-mount embryos as described in Materials and Methods. In all views, anterior is to the left. A ventral view is shown in A; lateral views, with dorsal at the top, are shown in B and C; horizontal views are shown in D and E. (A) Expression in a segmentally repeated array of mesodermal cells is seen first in the fully extended germ band when expression in the cephalic mesoderm (out of the plane of focus) can still be seen. (B,C) As germ band shortening occurs, expression is seen only in these clusters of cells, which appear to represent fat body precursors. These clusters appear to expand laterally. (D) ABF transcripts are present in the mature fat body of a stage 15 embryo. (E) At this same stage, Adh transcripts are observed exclusively in the fat body.

Fig. 6.

Later in embryogenesis ABF is expressed in the developing fat body. (A-D) ABF and (E) Adh mRNAs were visualized using in situ hybridization to whole-mount embryos as described in Materials and Methods. In all views, anterior is to the left. A ventral view is shown in A; lateral views, with dorsal at the top, are shown in B and C; horizontal views are shown in D and E. (A) Expression in a segmentally repeated array of mesodermal cells is seen first in the fully extended germ band when expression in the cephalic mesoderm (out of the plane of focus) can still be seen. (B,C) As germ band shortening occurs, expression is seen only in these clusters of cells, which appear to represent fat body precursors. These clusters appear to expand laterally. (D) ABF transcripts are present in the mature fat body of a stage 15 embryo. (E) At this same stage, Adh transcripts are observed exclusively in the fat body.

ABF transcripts are first detected after cellularization at ∼3 hours postfertilization (Fig. 5A). These transcripts are initially found in four regions of the cellular blastoderm: the anterior and posterior midgut primordia, the primordium of the cephalic mesoderm (the more anterior ventral staining in Fig. 5A), and the vitellophages, which are located within the yolk in the center of the embryo. ABF appears first at the posterior of the embryo and this domain is similar to the posterior portion of the expression patterns of the gap gene tailless (tll) and huckebein (hkb), and the homeotic gene fork head (fkh)(reviewed in Skaer, 1993). These genes are also present in other regions of the embryo that do not appear to correspond to the regions in which ABF is expressed. Temporally, tll, hkb and fkh are detected in stage 4 embryos prior to cellularization before ABF expression appears. Recently, a Drosophila homolog of the mouse transcription factor HNF-4, termed HNF-4(D), has been identified (Zhong et al., 1993). HNF-4(D) is a maternal mRNA that is initially present uniformly throughout the egg and becomes localized to the terminal regions of the embryo prior to cellularization. ABF, in contrast, is not detected until cellularization is complete.

As gastrulation begins, ABF transcripts continue to be detected in these areas and are transiently observed in the dorsalmost region of the embryo that gives rise to the amnioserosa (Fig. 5B,C). Expression in the amnioserosa is in a series of five stripes which extend from about 25 to 55% of egg length. This pattern resemble the refined pattern of zerknüllt expression (the ‘mohawk’; Rushlow et al., 1987), but the region of ABF expression is more restricted in its anterior-posterior extent. The expression of ABF in the amnioserosa at this stage is similar to the expression pattern of dGATAa (Winick et al., 1993), but ABF is more restricted in its lateral extent. During germ band extension (Fig. 5D-F), ABF transcript levels decline in the anterior and posterior midgut and the amnioserosa, but expression continues to be observed in the cephalic mesoderm. The bilaterally symmetric plates of the cephalic mesoderm are clearly visible in Fig. 5F.

Immediately before the onset of germ band retraction, ABF-expressing mesodermal cells appear in segmentally repeating clusters. This pattern is reminiscent of the mesodermal expression of nautilus in clusters of unfused myogenic cells at the same developmental stage (Michelson et al., 1990), although the ABF-positive cells appear to be deeper within the mesoderm and are found in lateral but not medial positions. As the mesodermal expression of ABF appears in the germ band, that in the cephalic region begins to decay and midway through germ band retraction is no longer detected (Fig. 6A,B). During shortening of the germ band, however, the segmental groups of ABF-expressing cells persist, with a particularly large cluster observed in the posterior segments (Fig. 6B). After shortening is completed, the ABF-positive clusters expand and coalesce into a continuous sheet along the lateral wall of the embryo (Fig. 6C,D). This sheet of cells resides between the gut and the somatic muscles and is periodically interrupted by the emergence of tracheal branches (Fig. 6D). These anatomical features are characteristic of the maturing fat body (Hartenstein and Jan, 1992; Rizki, 1978; Rizki and Rizki, 1978). That ABF is expressed in the fat body at this stage is further supported by the coincident expression pattern of Adh (Fig. 7E), a known marker of the fully differentiated fat body (Lockett and Ashburner, 1989). It remains to be determined if all fat body cells express both of these markers. Expression of the Drosophila homolog of HNF-4 is also seen in the mature fat body in addition to a variety of other tissues (Zhong et al., 1993). Given this final localization and the apparent evolution of ABF expression within the germ band mesoderm, we infer that the earlier segmental clusters of ABF-positive cells represent fat body precursors. The segmental origin of the larval fat body, despite its final form as an apparent contiguous mass of cells that lacks morphologically distinct boundaries, has been suggested previously based on its altered development in homeotic mutants (Rizki and Rizki, 1978).

ABF is a Drosophila GATA family member

In this paper, we describe the cloning and characterization of ABF, a novel Drosophila member of the GATA family of transcriptional regulatory proteins. Given its membership in this family and the identification of another Drosophila member of the GATA family, dGATAa (Winick et al., 1993), we propose that ABF be called dGATAb. Unlike its mammalian counterparts, ABF contains a single zinc finger which is most similar to the Cterminal finger found in two-finger GATA proteins. Singlefinger GATA proteins have also been identified in Aspergillus (Kudla et al., 1990) and Neurospora (Fu and Marzluf, 1990). ABF binds to positive regulatory elements found in larval Adh promoters and activates transcription. The DNA-binding domain of ABF is most similar to mammalian GATA proteins and, indeed, ABF binds to the GATA site present in the erythropoietin receptor promoter. Reciprocally, mGATA-1 binds to box A.

During mammalian development, the four members of the GATA family are expressed in a variety of tissues (Orkin, 1992). GATA-1 was originally isolated as an erythroid cell nuclear protein that recognizes a sequence motif found in globin gene promoters and enhancers (Evans and Felsenfeld, 1989; Tsai et al., 1989). The cell type specificity of this factor suggested an important developmental role and, indeed, GATA-1 is required for erythroid cell development (Pevny et al., 1991). GATA-2 is more ubiquitous in its expression (Yamamoto et al., 1990), whereas GATA-3 is expressed at high levels in the nervous system and in T cells (Ho et al., 1991; Joulin et al., 1991; Ko et al., 1991; Yamamoto et al., 1990). GATA-4, recently identified, is expressed in a limited set of tissues, which include tissues of endodermal and mesodermal origin (Arceci et al., 1993; C. Kelly and L. Zon, personal communication).

During Drosophila development, two GATA factors, dGATAa (Winick et al., 1993) and ABF (dGATAb), are expressed in a limited range of tissues, suggestive of a developmental role for these proteins. dGATAa is initially expressed just after cellularization in the dorsalmost ectodermal region of the embryo. As development continues, dGATAa transcripts are observed within the dorsal epidermis. ABF transcripts are initially observed in the anlagen of the anterior and posterior midgut and the cephalic mesoderm. Like GATA-4, ABF is found in both the endo dermal and mesodermal germ layers. For a brief period during gastrulation, ABF is expressed in the amnioserosa, in a subset of the portion of the dorsal ectoderm in which dGATAa is expressed. Thus the expression patterns of ABF and dGATAa partially overlap. ABF is more restricted in its lateral extent, however, which is consistent with the later brief localization of ABF transcripts to the amnioserosa. During germ band retraction, ABF expression becomes restricted to the fat body, a tissue of mesodermal origin which expresses Adh at high levels.

The role of GATA sites in fat body-specific expression

Our studies of ABF have demonstrated that this protein binds to the sequence T/AGATA present within box A of the D. mulleri Adh-1 gene and within the proximal promoter of the D. melanogaster Adh gene. Mutagenesis experiments using either P-element transformation (Corbin and Maniatis, 1990; Fischer and Maniatis, 1988) or somatic transformation (Shen et al., 1991) have shown that the region of these promoters containing this sequence is required for expression in vivo. Further, DNase I foot printing studies have revealed that this region within the proximal promoter is recognized by a factor found in embryonic (Moses et al., 1990) and Kc cell nuclear extracts (Heberlein et al., 1985). Together, these data suggest that the ABF-binding site is recognized by a positive regulatory factor. Our results are consistent with the possibility that ABF is this transcriptional activator: ABF binds to these positive regulatory elements, functions as a transcriptional activator and is expressed in the embryonic fat body.

In addition to being required for expression in all tissues, box A has the interesting property of expanding the tissue specificity of box B, a fat body-specific enhancer (Fischer and Maniatis, 1988). Our studies have shown that ABF is expressed in the fat body and thus it may play a role in regulating expression from box A in this tissue. The factor that mediates expression in the gut and Malpighian tubules remains an open question. One possibility is that ABF is expressed in these tissues during larval development and future studies will explore the larval expression pattern of ABF using appropriate antibodies. Alternatively, other GATA family members may regulate expression in these tissues. In this context, it is interesting to note that on certain promoters, mammalian GATA-1 functions synergistically with other factors (Zon et al., 1991) in a way analogous to the interaction observed between box A and box B. Lastly, box A, as defined by linker scanning mutagenesis experiments (Fischer and Maniatis, 1988) extends beyond the GATA site. Therefore, proteins recognizing additional sequences within this element may also mediate the action of box A in a variety of tissues.

A large number of Adh genes have been cloned from a variety of Drosophila species and all of these genes contain the sequence T/AGATAA within the larval promoter around position −70. In addition to Adh, six major polypeptides, P1, P6, LSP-1α, LSP-1β, LSP-1β and LSP-2, are synthesized in the larval fat body (Delaney et al., 1987; Maschat et al., 1990; Rat et al., 1991). The regions required for the proper expression of some of these genes in vivo have been mapped (Delaney et al., 1987; Maschat et al., 1991), and in all cases these elements include a sequence that matches the GATA consensus found in the larval Adh promoters. In this way, the GATA regulatory element may be a common motif involved in mediating the expression of genes within the larval fat body.

ABF is the earliest known marker of fat body differentiation

The larval fat body, which is fully formed late in embryo genesis, has been described from morphological studies of wild-type embryos (Rizki, 1978) and enhancer trap lines (Hartenstein and Jan, 1992) as a loose sheet of cells located between the gut and the somatic musculature. Because of the lack of a suitable marker, the early development of the fat body has remained obscure. Staining for a variety of genes, including Adh (Lockett and Ashburner, 1989), and analysis of a variety of enhancer trap lines (Hartenstein and Jan, 1992) have revealed only the pattern of the mature tissue. By comparing the morphology of the larval fat body in wild-type and homeotic bithorax mutant larvae, Rizki and Rizki (1978) concluded that the larval fat body has a segmental origin whose organization is dependent upon the activity of genes within the bithorax complex.

ABF transcripts are present in the developing and fully differentiated fat body. The latter pattern is very similar to that of Adh in the later embryo. However, we cannot determine directly whether ABF, or indeed Adh, are expressed in all cells of the fat body. ABF expression within the germ band mesoderm is first observed during germ band retraction in segmentally repeated clusters of cells. These clusters appear to lie deeper within the mesoderm than do the unfused myogenic cells which express nautilus (Michelson et al., 1990), consistent with the anatomical location of the mature fat body. During shortening, the ABF-expressing clusters expand and coalesce, thus forming the continuous sheet of cells which is the mature fat body. The isolation and characterization of mutations in the ABF locus will be required to investigate the role that ABF plays in Adh expression and in fat body development. Our analysis of the expression pattern of ABF during development thus provides the most detailed description of the genesis of the fat body available, and this gene will provide a useful reagent to analyze the role of homeotic genes in the development of the mesoderm. Furthermore, the expression pattern of ABF, along with its identification as a member of the GATA family of transcriptional regulatory proteins, points to an important role for ABF in the organogenesis of a variety of tissues including the midgut and the fat body.

We thank D. Falb, D. Thanos, J. Olesen, T. Miller, M. Shea, N. Pandey and members of the Maniatis laboratory for helpful discussions, advice and critical reading of the manuscript. R. Lehmann, N. Perrimon, M. Bate, V. Hartenstein and H. Skaer provided insight in interpreting the embryo in situs. We thank S. Abmayr, K. Zinn, A. Ephrussi, M. Merika and S. Orkin for providing libraries, plasmids, RNAs and proteins necessary for this study. This work was supported by National Institutes of Health research grant GM29379 to T. M., a National Science Foundation Graduate Fellowship to T. A., and a Medical Foundation postdoc toral fellowship to A. M. M; A. M. M. is an Assistant Investigator of the Howard Hughes Medical Institute.

Abel
,
T.
(
1993
).
Transcription factors that bind to Drosophila Adh regulatory elements
.
Ph.D. Thesis, Department of Biochemistry and Molecular Biology, Harvard University
.
Abel
,
T.
,
Bhatt
,
R.
and
Maniatis
,
T.
(
1992
).
A Drosophila CREB/ATF transcriptional activator binds to both fat body- and liver-specific regulatory elements
.
Genes Dev
.
6
,
466
480
.
Arceci
,
R. J.
,
King
,
A. A. J.
,
Simon
,
M. C.
,
Orkin
,
S. H.
and
Wilson
,
D. B.
(
1993
).
Mouse GATA-4: A retinoic acid-inducible GATA-binding transcription factor expressed in endodermally derived tissues and heart
.
Mol. Cell. Biol
.
13
,
2235
2246
.
Ayer
,
S.
and
Benyajati
,
C.
(
1992
).
The binding site of a steroid receptor-like protein within the Drosophila Adh adult enhancer is required for high levels of tissue-specific alcohol dehydrogenase expression
.
Mol. Cell. Biol
.
12
,
661
673
.
Bayer
,
C. A.
,
Curtiss
,
S. W.
,
Weaver
,
J. A.
and
Sullivan
,
D.
(
1992
).
Delineation of cis-acting sequences required for expression of Drosophila mojavensis Adh-1
.
Genetics
131
,
143
153
.
Brennan
,
M. D.
and
Dickinson
,
W. J.
(
1988
).
Complex developmental regulation of the Drosophila affinidisjunta alcohol dehydrogenase gene in Drosophila melanogaster
.
Dev. Biol
.
125
,
64
74
.
Brennan
,
M. D.
,
Wu
,
C.-Y.
and
Berry
,
A. J.
(
1988
).
Tissue-specific regulatory differences for the alcohol dehydrogenase genes of Hawaiian Drosophila are conserved in Drosophila melanogaster transformants
.
Proc. Natl. Acad. Sci. USA
.
85
,
6866
6869
.
Campos-Ortega
,
J. A.
and
Hartenstein
,
V.
(
1985
).
The Embryonic Development of Drosophila melanogaster
.
Berlin
,
Springer-Verlag
.
Corbin
,
V.
and
Maniatis
,
T.
(
1989a
).
The role of specific enhancer-promoter interactions in the Drosophila Adh promoter switch
.
Genes Dev
.
3
,
2191
2200
.
Corbin
,
V.
and
Maniatis
,
T.
(
1989b
).
Role of transcriptional interference in the Drosophila melanogaster Adh promoter switch
.
Nature
337
,
279
282
.
Corbin
,
V.
and
Maniatis
,
T.
(
1990
).
Identification of cis-regulatory elements required for larval expression of the Drosophila melanogaster alcohol dehydrogenase gene
.
Genetics
124
,
637
646
.
Delaney
,
S. J.
,
Sunkel
,
C. E.
,
Genova-Seminova
,
G. K.
,
Davies
,
J. E.
and
Glover
,
D. M.
(
1987
).
Cis-acting sequences sufficient for correct tissue and temporal specificity of larval serum protein 1 genes of Drosophila
.
EMBO J
.
6
,
3849
3854
.
Desplan
,
C.
,
Theis
,
J.
and
O’Farrell
,
P. H.
(
1985
).
The Drosophila developmental gene, engrailed, encodes a sequence-specific DNA binding activity
.
Nature
318
,
630
635
.
Dorfman
,
D. M.
,
Wilson
,
D. B.
,
Bruns
,
G. A. P.
and
Orkin
,
S. H.
(
1992
).
Human transcription factor GATA-2
.
J. Biol. Chem
.
267
,
1279
1285
.
England
,
B. P.
,
Admon
,
A.
and
Tjian
,
R.
(
1992
).
Cloning of Drosophila transcription factor Adf-1 reveals homology to Myb oncoproteins
.
Proc. Natl. Acad. Sci. USA
89
,
683
687
.
Evans
,
T.
and
Felsenfeld
,
G.
(
1989
).
The erythrocyte-specific transcription factor Eryf1: A new finger protein
.
Cell
58
,
877
885
.
Evans
,
T.
,
Felsenfeld
,
G.
and
Reitman
,
M.
(
1990
).
Control of globin gene transcription
.
Annu. Rev. Cell Biol
.
6
,
95
124
.
Falb
,
D.
and
Maniatis
,
T.
(
1992
).
A conserved regulatory unit implicated in tissue-specific gene expression in Drosophila and man
.
Genes Dev
.
6
,
454
465
.
Fischer
,
J. A.
(
1987
).
Regulation of Drosophila Adh gene expression
.
Ph.D. Thesis, Department of Biochemistry and Molecular Biology
,
Harvard University
.
Fischer
,
J. A.
and
Maniatis
,
T.
(
1986
).
Regulatory elements involved in Drosophila Adh gene expression are conserved in divergent species and separate elements mediate expression in different tissues
.
EMBO J
.
5
,
1275
1289
.
Fischer
,
J. A.
and
Maniatis
,
T.
(
1988
).
Drosophila Adh: A promoter element expands the tissue specificity of an enhancer
.
Cell
53
,
451
461
.
Fu
,
Y.-H.
and
Marzluf
,
G. A.
(
1990
).
nit-2, the major nitrogen regulatory gene of Neurospora crassa, encodes a protein with a putative zinc finger DNA-binding domain
.
Mol. Cell. Biol
.
10
,
1056
1065
.
Goldberg
,
D. A.
(
1980
).
Isolation and partial characterization of the Drosophila alcohol dehydrogenase gene
.
Proc. Natl. Acad. Sci. USA
77
,
5794
5796
.
Hartenstein
,
V.
and
Jan
,
Y. N.
(
1992
).
Studying Drosophila embryogenesis with P-lacZ enhancer trap lines
.
Roux’s Arch. Dev. Biol
.
201
,
194
220
.
Heberlein
,
U.
,
England
,
B.
and
Tjian
,
R.
(
1985
).
Characterization of Drosophila transcription factors that activate the tandem promoters of the alcohol dehydrogenase gene
.
Cell
41
,
965
977
.
Ho
,
I.-C.
,
Vorhees
,
P.
,
Marin
,
N.
,
Oakley
,
B. K.
,
Tsai
,
S.-F.
,
Orkin
,
S. H.
and
Leiden
,
J. M.
(
1991
).
Human GATA-3: A lineage-restricted transcription factor that regulates the expression of the T cell receptor α gene
.
EMBO J
.
10
,
1187
1192
.
Joulin
,
V.
,
Bories
,
D.
,
Eleouet
,
J.-F.
,
Labastie
,
M.-C.
,
Chretien
,
S.
,
Mattei
,
M.-G.
and
Romeo
,
P.-H.
(
1991
).
A T-cell specific TCR δ DNA binding protein is a member of the human GATA family
.
EMBO J
.
10
,
1809
1816
.
Ko
,
L. J.
,
Yamamoto
,
M.
,
Leonard
,
M. W.
,
George
,
K. M.
,
Ting
,
P.
and
Engel
,
J. D.
(
1991
).
Murine and human T-lymphocyte GATA-3 factors mediate transcription through a cis-regulatory element within the human T-cell receptor δ gene enhancer
.
Mol. Cell. Biol
.
11
,
2778
2784
.
Krasnow
,
M. A.
,
Saffman
,
E. E.
,
Kornfeld
,
K.
and
Hogness
,
D. S.
(
1989
).
Transcriptional activation and repression by Ultrabithorax proteins in cultured Drosophila cells
.
Cell
57
,
1031
1043
.
Kudla
,
B.
,
Caddick
,
M. X.
,
Langdon
,
T.
,
Martinez-Rossi
,
N. M.
,
Bennett
,
C. F.
,
Sibley
,
S.
,
Davies
,
R. W.
and
Arst
,
H. N.
(
1990
).
The regulatory gene areA mediating nitrogen metabolite repression in Aspergillus nidulans. Mutations affecting specificity of gene activation alter a loop residue of a putative zinc finger
.
EMBO J
.
9
,
1355
1364
.
Lee
,
M.-E.
,
Temizer
,
D. H.
,
Clifford
,
J. A.
and
Quertermous
,
T.
(
1991
).
Cloning of the GATA-binding protein that regulates endothelin-1 gene expression in endothelial cells
.
J. Biol. Chem
.
266
,
16188
16192
.
Lindsley
,
D.
and
Zimm
,
G.
(
1992
).
The genome of Drosophila melanogaster
.
New York
,
Academic Press
.
Lockett
,
T. J.
and
Ashburner
,
M.
(
1989
).
Temporal and spatial utilization of the alcohol dehydrogenase gene promoters during the development of Drosophila melanogaster
.
Dev. Biol
.
134
,
430
437
.
Martin
,
D. I. K.
and
Orkin
,
S. H.
(
1990
).
Transcriptional activation and DNA binding by the erythroid factor GF-1/NF-E1/Eryf 1
.
Genes Dev
.
4
,
1886
1898
.
Maschat
,
F.
,
Dubertret
,
M.-L.
and
Lepesant
,
J.-A.
(
1991
).
Transformation mapping of the regulatory elements of the ecdysone-inducible P1 gene of Drosophila melanogaster
.
Mol. Cell. Biol
.
11
,
2913
2917
.
Maschat
,
F.
,
Dubertret
,
M.-L.
,
Therond
,
P.
,
Claverie
,
J.-M.
and
Lepesant
,
J.-A.
(
1990
).
Structure of the ecdysone-inducible P1 gene of Drosophila melanogaster
.
J. Mol. Biol
.
214
,
359
372
.
Michelson
,
A. M.
,
Abmayr
,
S. M.
,
Bate
,
M.
,
Arias
,
A. M.
and
Maniatis
,
T.
(
1990
).
Expression of a MyoD family member prefigures muscle pattern in Drosophila embryos
.
Genes Dev
.
4
,
2086
2097
.
Moses
,
K.
,
Heberlein
,
U.
and
Ashburner
,
M.
(
1990
).
The Adh gene promoters of Drosophila melanogaster and Drosophila orena are functionally conserved and share features of sequence structure and nuclease protected sites
.
Mol. Cell. Biol
.
10
,
539
548
.
O’Connell
,
P.
and
Rosbash
,
M.
(
1984
).
Sequence, structure, and codon preference of the Drosophila ribosomal protein 49 gene
.
Nucl. Acids Res
.
12
,
5495
5513
.
Orkin
,
S. H.
(
1992
).
GATA-binding transcription factors in hematopoietic cells
.
Blood
80
,
575
581
.
Pevny
,
L.
,
Simon
,
M. C.
,
Robertson
,
E.
,
Klein
,
W. H.
,
Tsai
,
S.-F.
,
D’Agati
,
V.
,
Orkin
,
S. H.
and
Costantini
,
F.
(
1991
).
Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1
.
Nature
349
,
257
260
.
Rat
,
L.
,
Veuille
,
M.
and
Lepesant
,
J.-A.
(
1991
).
Drosophila fat body protein P6 and alcohol dehydrogenase are derived from a common ancestral protein
.
J. Mol. Evol
.
33
,
194
203
.
Rizki
,
T. M.
(
1978
).
Fat body
.
Genetics and Biology of Drosophila
.
New York
,
Academic Press
.
Rizki
,
T. M.
and
Rizki
,
R. M.
(
1978
).
Larval adipose tissue of homoeotic bithorax mutants of Drosophila
.
Dev. Biol
.
65
,
476
482
.
Rosenberg
,
A. H.
,
Lade
,
B. N.
,
Chui
,
D.-S.
,
Lin
,
S.-W.
,
Dunn
,
J. J.
and
Studier
,
F. W.
(
1987
).
Vectors for the selective expression of cloned DNAs by T7 RNA polymerase
.
Gene
.
56
,
125
135
.
Rushlow
,
C.
,
Doyle
,
H.
,
Hoey
,
T.
and
Levine
,
M.
(
1987
).
Molecular characterization of the zerknüllt region of the Antennapedia gene complex in Drosophila
.
Genes Dev
.
1
,
1268
1279
.
Sambrook
,
J.
,
Fritsch
,
E. T.
and
Maniatis
,
T.
(
1989
).
Molecular Cloning: A Laboratory Manual
.
Cold Spring Harbor, NY
:
Cold Spring Harbor Laboratory Press
.
Savakis
,
C.
,
Ashburner
,
M.
and
Willis
,
J. H.
(
1986
).
The expression of the gene coding for alcohol dehydrogenase during the development of Drosophila melanogaster
.
Dev. Biol
.
114
,
194
207
.
Shen
,
N. L. L.
,
Hotaling
,
E. C.
,
Subrahmanyam
,
G.
,
Martin
,
P.
and
Sofer
,
W.
(
1991
).
Analysis of sequences regulating larval expression of the Adh gene of Drosophila melanogaster
.
Genetics
129
,
763
771
.
Skaer
,
H.
(
1993
).
The alimentary canal
.
In TheDevelopmentof Drosophila melanogaster
(eds
A.
Martinez-Arias
and
M.
Bate
),
Cold Spring Harbor Lab. Press, in press
.
Sofer
,
W.
and
Martin
,
P. F.
(
1987
).
Analysis of alcohol dehydrogenase gene expression in Drosophila
.
Annu. Rev. Genet
.
21
,
203
225
.
Tautz
,
D.
and
Pfeifle
,
C.
(
1989
).
A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback
.
Chromosoma
98
,
81
85
.
Thanos
,
D.
and
Maniatis
,
T.
(
1992
).
The high mobility group protein HMG I(Y) is required for NF-κB-dependent virus induction of the human IFN-β gene
.
Cell
71
,
777
790
.
Tsai
,
S.-F.
,
Martin
,
D. I. K.
,
Zon
,
L. I.
,
D’Andrea
,
A. D.
,
Wong
,
G. G.
and
Orkin
,
S. H.
(
1989
).
Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells
.
Nature
339
,
446
451
.
Vinson
,
C. R.
,
LaMarco
,
K. L.
,
Johnson
,
P. F.
,
Landschulz
,
W. H.
and
McKnight
,
S.
(
1988
).
In situdetection of sequence-specific DNA binding activity specified by a recombinant bacteriophage
.
Genes Dev
.
2
,
801
806
.
Wharton
,
K. A.
,
Yedvobnock
,
B.
,
Finnerty
,
V. G.
and
Artavanis-Tsakonas
,
S.
(
1985
).
opa: A novel family of transcribed repeats shared by the Notch locus and other developmentally regulated loci in D. melanogaster
.
Cell
40
,
55
62
.
Winick
,
J.
,
Abel
,
T.
,
Leonard
,
M. W.
,
Michelson
,
A. M.
,
Chardon-Loriaux
,
I.
,
Holmgren
,
R. A.
,
Maniatis
,
T.
and
Engel
,
J. D.
(
1993
).
A GATA family transcription factor is expressed along the embryonic dorsoventral axis in Drosophila melanogaster
.
Development 119 (in press)
.
Yamamoto
,
M.
,
Ko
,
L. J.
,
Leonard
,
M. W.
,
Beug
,
H.
,
Orkin
,
S. H.
and
Engel
,
J. D.
(
1990
).
Activity and tissue-specific expression of the transcription factor NF-E1 multigene family
.
Genes Dev
.
4
,
1650
1662
.
Yang
,
H.-Y.
and
Evans
,
T.
(
1992
).
Distinct roles for the two cGATA-1 finger domains
.
Mol. Cell. Biol
.
12
,
4562
4570
.
Zhong
,
W.
,
Sladek
,
F. M.
and
Darnell
,
J. E.
(
1993
).
The expression pattern of a Drosophila homolog to the mouse transcription factor HNF-4 suggests a determinative role in gut formation
.
EMBO J
.
12
,
537
544
.
Zinn
,
K.
,
McAllister
,
L.
and
Goodman
,
C.
(
1988
).
Sequence analysis and neuronal expression of fascilin in grasshopper and Drosophila
.
Cell
53
,
577
587
.
Zon
,
L. I.
,
Tsai
,
S.-F.
,
Burgess
,
S.
,
Matsudaira
,
P.
,
Bruns
,
G. A. P.
and
Orkin
,
S. H.
(
1990
).
The major erythroid DNA-binding protein (GF-1): Primary sequence and localization of the gene to the X chromosome
.
Proc. Natl. Acad. Sci. USA
87
,
668
672
.
Zon
,
L. I.
,
Youssoufian
,
H.
,
Mather
,
C.
,
Lodish
,
H. F.
and
Orkin
,
S. H.
(
1991
).
Activation of the erythropoietin receptor promoter by transcription factor GATA-1
.
Proc. Natl. Acad. Sci. USA
88
,
10638
10641
.