In order to screen for developmentally active chromosomal domains during zebrafish embryogenesis, we generated transgenic fish by microinjecting two different lacZ reporter constructs into fertilized eggs. Transgenic fish were screened among the progeny of injected fish (Fo) crossed to non-injected fish. Groups of 15 to 20 progeny of each cross were tested for lacZ expression and/or transmission of injected sequences using PCR and Southern hybrizations. Progeny from 2 of 102 fish injected with super coiled constructs containing Rous sarcoma virus promoter sequences showed apparently spatially regulated β-galactosidase (β-Gal) activity. However, we were not able to detect this reporter construct in DNA from fins of F, fish. Injections of a linear reporter construct containing mouse heat-shock promoter sequences revealed transmission of injected sequences to Fi progeny in about 6% of cases (8 of 129 fish, tested with PCR). We found one ZacZ-expressing line that showed a spatially and temporally restricted expression of lacZ and, therefore, features typical characteristics of ‘enhancer trap’lines. In this line, lacZ expression starts at 16 hours post-fertilization in trigeminal ganglion cells. At about 24 hours lacZ expression can be detected in trigeminal ganglion neurons and Rohon-Beard neurons, indicating that the development of these two cell types shows common features. The reporter gene has integrated as a single copy. The founder fish was mosaic: 19% of its offspring (3 of 16 tested animals) carried the reporter construct in their fins; about 51% (13 of 27 tested animals) of the progeny of F, fish were β-Gal positive indicating full hemizygosity. We traced the heritability up to the 4th generation and showed that the reporter construct is stably integrated and inherited in a Mendelian manner. These results demonstrate that it is possible to generate “enhancer trap” lines in zebrafish, albeit with low efficiency.

The zebrafish Brachydanio rerio is particularly useful for studying developmental processes in higher eucaryotes, since the embryos develop outside the mother and are optically transparent, allowing direct observation of their embryonic development. Screening for recessive mutations is facilitated by methods for the production of haploid and gynogenetic offspring (Streisinger et al., 1981; Walker and Streisinger, 1983; Chakrabarti et al., 1983; Kimmel, 1989). Furthermore, production, maintenance and analysis of transgenic or mutant fines is aided by a relatively short generation time of 2-3 months. Recently, it has been shown that it is possible to produce transgenic zebrafish via microinjection of foreign DNA into the cytoplasm of fertilized eggs (Stuart et al., 1988, 1990; Culp et al., 1991).

In some organisms, transgene expression may be influenced by endogenous elements near the position of integration (Hazelrigg et al., 1984; Palmiter and Brinster, 1986). Gene constructs containing weak promoters have been used in different transgenic organisms to detect endogenous genomic regulatory elements (O’Kane and Gehring, 1987; Allen et al., 1988; Kothary et al., 1988; Gossler et al., 1989). In Drosophila, P-element-mediated enhancer detection is widely used to screen for developmentally regulated genes on a large scale, using protocols that permit developmental, genetic and molecular analysis of these genes (Bier et al., 1989; Bellen et al., 1989; Wilson et al., 1989; Ghysen and O’Kane, 1989). The main goal of our study was to determine whether this “enhancer trap” technique can also be applied to zebrafish. We used two different constructs, with the Rous sarcoma promoter (pRSVβGal), and with a truncated mouse heat-shock promoter (phs6-lacZA). Following injections of this latter construct in linear form, we isolated one stable transgenic line of zebrafish expressing lacZ with enhancer trap features. The reporter gene lacZ is expressed exclusively in primary sensory neurons, including Rohon-Beard neurons of the spinal cord and trigeminal ganglion neurons in the head.

Preparation of plasmid DNA for injection

The fusion construct pRSVβGal (a gift of Manfred Schartl, Würzburg; Edlund et al., 1985) contains Rous sarcoma virus promoter sequences linked to lacZ coding for β-gal. The other fusion construct used for our studies is phs6-lacZA (a gift of Achim Gossler, Köln; personal communication). It contains a truncated mouse heat-shock promoter linked to lacZ. In both constructs, lacZ is linked to SV40 polyadenylation signal sequences which were extracted with phenol/chloroform prior to injection. In one set of injections, phs6-lacZA was digested with Pstl, which Hberates the reporter as a 4.8 kb fragment. This DNA fragment was isolated and recovered by precipitation with an equal volume of isopropanol in the presence of 0.2 M NaCl. Transgenic lines r200 and r215 were produced by microinjection of circular pRSVβGal’, h32 was generated by microinjecting the linear 4.8 kb Pstl fragment of phs6-lacZA.

Microinjection

Reporter construct DNA was injected into fertilized zebrafish eggs prior to first cleavage, essentially as described by Stuart et al. (1988), with the foUowing modifications. Soon after spawning, fertilized eggs were washed in embryo medium (a modified Hanks saline containing 1.3 mM CaCI2, 1 mM MgCl2 and 4 mM NaHCO3) and placed in plastic Petri dishes (5 cm diameter). Injections were carried out under sight control using a dissecting microscope and with the aid of a micromanipulator. In contrast to previous studies (Stuart et al., 1988,1990; Culp et al., 1991), we did not dechorionate the fertilized eggs prior to injection. Chorions were removed about 24 hours later, at which time the zebrafish embryos are well developed and crucial steps in embryogenesis have been completed. Micropipettes were made on a horizontal puller using 1 mm Hilgenberg glass capillary tubing with an inner filament for backfilhng the pipettes with DNA solution. Injection solutions contained 0.5% phenol red to allow estimation of the injected volume.

DNA extraction and blot analysis

DNA manipulations were carried out essentially according to Sambrook et al. (1989). DNA for PCR and Southern analysis was extracted from whole fish at 1-3 weeks of age, from fins of adult fish or from whole adult fish by dissolving the tissue in extraction buffer (10 mM Tris-HCl pH 8.0, 0.1 M EDTApH 8.0 and 0.5% SDS). The samples were digested with 100μg/ml proteinase K overnight at 50°C. After removing undissolved material by centrifugation, DNA samples were subsequently extracted in phenol/chloroform/ethyl ether and precipitated with isopropanol as described above for plasmid DNA. DNA samples were resuspended in TE (10 mM Tris pH 7.5, 0.25 mM EDTA). For Southern analysis, DNA samples were digested with restriction enzymes as specified by the manufacturer, foUowed by gel electrophoresis and capillary transfer onto nitrocellulose filters (Sambrook et al., 1989). Blots were prehybridized overnight at 42°C with a solution containing 5 ×SSPE, 5 ×Denhardt’s, 0.2% SDS, 50% formamide and 0.1 mg/ml sheared calf thymus DNA. The blots were then hybridized overnight at 42°C in this solution containing radioactive probes for the plasmids pRSVβGal or phs6-lacZA, labelled to a specific activity of 108 cts/min/μg by random priming (Feinberg and Vogelstein, 1983). The blot was then washed twice in 2 ×SSPE, 0.2 SDS (5 minutes), twice in 0.5 ×SSPE, 0.2 SDS (15 minutes) and twice 0.1 ×SSPE, 0.2 SDS (15 minutes) at RT. Exposure to film was carried out at — 80°C with an enhancing screen.

Screening of transgenic fish by the polymerase chain reaction (PCR)

DNA from either 15-20 fish 1-3 weeks old or from fins of single adults was used. Approximately 1 μg template DNA was used for PCR following a modification of the protocol of Sambrook et al. (1989): 67 mM Tris-HCl (pH 8.8); 16 mM (NH4)2SO4; 6.7 mM MgCl2; 0.67 pM. EDTA; 1 mM 2-mercaptoethanol; 200 μM dNTP; primers 1 μM; Taq DNA polymerase 2-5 units. Sense primer was derived from the promoter sequence of the injected construct, forphs6-lacZA: 5’CCCGATCCTCGGCCAGGACC 3’; for pRSV-ßGal: 5’CCATGGCCACCCACTTCTGGTC3’. The anti-sense primer was derived from the lacZ sequence: 5’ CGCGTAAAAATGCGCTCAGG 3’. These primers generated a PCR product of 614 bp for phs6-lacZA and about 1.1 kb for pRSVβGal. The reaction was carried out as foUows: melting temperature 95°C 3 cycles for 2 minutes, 35 cycles for 10 seconds, annealing temperature 62°C 3 cycles for 1 minute, 35 cycles for 1 minute and primer extension 72°C 3 cycles for 2 minutes, 35 cycles for 1 minute, and a 15 minutes final step at 72°C elongation. Amplified fragments were verified by hybridization analysis.

Detection of β-Gal activity

Zebrafish embryos at various stages were fixed in 12.5% glutaraldehyde for 10 minutes (in 0.1 M PBS, pH 7.2) and washed several times in PBT (0.3% Triton-X in 0.1 M PBS, pH 7.2). β-Gal activity was made visible by incubation in X-Gal staining solution: [0.2% 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Biomol) in dimethylformamide; 5 mM K3 (Fe HI (CN)6); 5 mM K4 (Fe n (CN)6) in 0.1 M citrate buffer pH 8.0] overnight at 37°C. Stained embryos were dehydrated in increasing concentrations of ethanol, incubated for 5 minutes in xylene and mounted in Durcupan (Fluka).

Double-labeling

Double-labeling of embryos from the fine h32 was carried out using X-Gal staining followed by incubation with zn-12 (a monoclonal antibody that recognizes the L2/HNK-1 epitope, a gift of Charles Kimmel, Eugene, Oregon). Fixation and staining for X-Gal was as above, followed by several 5 minute washes in 0.1 M PBS pH 7.2 and then distilled water, all at room temperature. The staining protocol for antibody labeling was performed essentially as described (Westerfield, 1989). The embryos were permeabilized with acetone for 7 minutes at — 20°C, followed by 5 minute washes in distilled water and PBS. The samples were then incubated in 1% BSA, 1% DMSO in PBS for 5, 15, 30 and then 60 minutes. The embryos were next treated overnight at 4°C with the supernatant containing the monoclonal zn-12 antibody. After washing the samples again 4 times in 1% BSA, 1% DMSO in PBS (5, 15, 30 and 60 minutes), the secondary antibody (HRP-coupled goat anti-mouse) diluted 1:500 with the BSA/DMSO/PBS solution was applied for 1 hour at 37°C. The embryos were then washed 4 times (5, 15, 30 and 60 minutes) in PBS. Immunoreactivity was made visible with a 1 mg/ml solution of diamino benzidine (Sigma) in PBS pH 7.2 to which 1 μl of a 3% H2O2 solution was added. Stained embryos were dehydrated and mounted as above.

Histology

Embryos to be sectioned for histology were treated as above. Prior to mounting in Durcupan, the samples were incubated in a mixture of xylene and Durcupan (1:1) overnight at 4°C. After evaporation of xylene at room temperature, the embryos were embedded in fresh Durcupan, then incubated for 24 hours at 45°C and then for 30 hours at 60°C. 2 to 3μm sections were cut with a microtome (Reichert), followed by counter staining with methylene blue-borax and mounted in DePeX (Sigma).

Transient expression of lacZ in early embryos

We injected several hundred fertilized zebrafish eggs prior to first cleavage with either pRSVβGal or phs6-lacZA. The recombinant lacZ genes in these constructs were expected to be functional in zebrafish due to the presence of eucaryotic transcription initiation (RSV-LTR, heat-shock promoter from mouse) and termination signals (SV-40 polyadenylation signal). The results of Stuart et al. (1990) had already indicated that the RSV-LTR functions in transgene zebrafish. In mouse, it has been shown that the truncated mouse heat-shock promoter can be used as a minimal promoter in enhancer trap experiments (Gossler et al., 1989). To verify the ability of these constructs to produce functional β-Gal, injected embryos were fixed and stained for β-Gal activity about 24 hours after injection. Embryos injected with circular pRSVβGal exhibited staining mainly in cells of mesodermal origin (data not shown; Overbeek et al., 1986; Swain et al., 1987). In contrast, the 4.8 kb Pstl fragment of phs6-lacZA gave rise to expression of lacZ in cells of most if not all tissues (data not shown).

Functional lacZ genes are inherited by the progeny of injected fish

Presence or absence of foreign DNA in the germline of injected fish was determined by crossing injected fish with non-injected fish and examining their progeny for β-Gal activity and/or by PCR or Southern hybridization. Since transgenic founder fish have been reported to be mosaic (Stuart et al., 1988, 1990; Culp et al., 1991), groups of 15 to 20 progeny of each cross were examined. We performed three sets of injections: (1) F1 progeny from 102 fish injected with pRSVβGal (as supercoiled construct, 30 to 100μg/ml, Table 1) were examined for lacZ expression by using the X-Gal reaction. The results indicated that two of the injected parental fish had β-Gal activity in their germ-lines (Table 1). (2) Fi progeny from 129 fish were tested for transmission of the 4.8 kb PstI fragment of phs6-lacZA (40 to 80 μg/ml, Table 2) using PCR. We detected the expected PCR product in offspring of eight of these fish. Progeny of one of these eight fines (h32) exhibited β-Gal activity in identifiable cells. (3) Injections of phs6-lacZA as a supercoiled fusion construct (50βg/ml) did not result in germ-line transmission (n=46), as tested by PCR (Table 2).

Table 1.

Transgenic founder fish after injection of supercoiled pRSVβGal DNA

Transgenic founder fish after injection of supercoiled pRSVβGal DNA
Transgenic founder fish after injection of supercoiled pRSVβGal DNA
Table 2.

Transgenic animals after injections of phs6-lacZA DNA

Transgenic animals after injections of phs6-lacZA DNA
Transgenic animals after injections of phs6-lacZA DNA

Founder fish r200 and r215 injected with supercoiled pRSVβGal DNA produced F1progeny expressing lacZ in a few cells of mesodermal origin (not shown). However, DNA was prepared from fins of 20 F1 r200 and 15 F1 r215 siblings and found negative after screening by PCR. One line with β-Gal activity was established (h32) from fish injected with the 4.8 kb Pstl fragment of phs6-lacZA. The founder fish was indeed mosaic, since we detected the presence of the PCR product in the fins of three of a total of 16 offspring tested (19%; Table 3). Using the X-Gal reaction, the offspring of 18 of 35 F1 fish (51%) were positive, whereas using PCR, 7 of 15 (47%) were positive, indicating that F1 fish were fully hemizygous. We were able to demonstrate heritability of β-Gal activity through the 4th generation (Table 3).

Table 3.

Inheritance of lacZ expressivity in transgenic

Inheritance of lacZ expressivity in transgenic
Inheritance of lacZ expressivity in transgenic

The reporter construct has integrated as a single copy in the genome of line h32

Stable transmission through the germline over several generations, as shown above, provides strong evidence for genomic integration. Since extrachromosomal inheritance may also occur in other species (Stinchcomb et al., 1985; Rassoulzadegan et al., 1986; Mello et al., 1991, see above), the presence of junction fragments of reproducible size on Southern blots can provide further support for this conclusion. As mentioned above, we found no evidence for integration in offspring of founder fish r200, and r215, suggesting extrachromosomal inheritance of the pRSVβGal construct. Southern blot analysis of DNA from the line h32, however, showed that the 4.8 kb PstI fragment has integrated as a single copy in the genome. Whereas digestion with EcoRI, which has one cleavage site in the insert, revealed two bands, digestion with BamHI, which has two sites in the insert, generated three bands. Digestion with HmdIII reveals only one hybridizing band at about 5.5 kb, indicating cleavage within specific flanking regions, since 77/ndIH does not cut within the insert. The hypothesis of genomic integration is further supported by the observation that inherited foreign DNA migrated with high molecular weight (genomic) DNA, if left undigested (Fig. 1).

Fig. 1.

Southern analysis of line h32 DNA. (A) Lanes 1, 6 and 7 contained about 10 μg samples of BamHI (lane 1), HindIII (lane 6) and EcoRI (lane 7) digests. Lane 5 contained about 3μg undigested DNA. Lanes 2, 3 and 4 contained PstI(lane 2, 500 ng) and Biadili (lane 3, 500 ng; lane 4, 50 ng) digests of phs6-lacZA as positive controls. The position of length standards (1 kb ladder) are shown on the left. (B) Diagram of the derived restriction map of the insert and flanking regions (see text). Abbreviations: B, ZiaznHI; RI, EcoRI.

Fig. 1.

Southern analysis of line h32 DNA. (A) Lanes 1, 6 and 7 contained about 10 μg samples of BamHI (lane 1), HindIII (lane 6) and EcoRI (lane 7) digests. Lane 5 contained about 3μg undigested DNA. Lanes 2, 3 and 4 contained PstI(lane 2, 500 ng) and Biadili (lane 3, 500 ng; lane 4, 50 ng) digests of phs6-lacZA as positive controls. The position of length standards (1 kb ladder) are shown on the left. (B) Diagram of the derived restriction map of the insert and flanking regions (see text). Abbreviations: B, ZiaznHI; RI, EcoRI.

lacZ is expressed exclusively in primary sensory neurons in line h32

lacZ expression was found in a few cells of the trigeminal ganglion and in individual neurons within the spinal cord (Fig. 2). Using double labeling with X-Gal and the monoclonal antibody zn-12, we identified the ZacZ-expressing cells as Rohon-Beard neurons in the spinal cord and trigeminal neurons in the head. By analyzing the ZacZ-expression pattern at various stages, we detected the onset of lacZ expression at about 16 hours post-fertilization in the trigeminal ganglion (data not shown) and at about 24 hours in the spinal cord; expression in the trigeminal ganglion persists until 72 hours and until 48 hours in the Rohon-Beard cells. Onset of lacZ expression in trigeminal cells coincides with the onset of immunoreactivity to the monoclonal antibody zn-12 in these cells; developing axons begin to grow at about the same stage (Metcalfe et al., 1990). This temporal coincidence suggests that lacZ expression might be related to a neuronal cytodifferentiation process. lacZ expression is fully penetrant with respect to the trigeminal ganglion cells, but not with respect to the Rohon-Beard cells; that is to say, all embryos that carried the construct showed one or more lacZ-expressing trigeminal cells, but not all embryos showed ZacZ-expressing Rohon-Beard cells. In addition to this variable penetrance, expressivity was found to vary as well, for the number of ;β-Gal positive cells differed between embryos, from one to about 20 β-Gal-positive cells per trigeminal ganglion per embryo. We could not correlate ZacZ-expressing Rohon-Beard neurons with positions along the anteroposterior axis. Hence, it is unlikely that lacZ expression occurs in a distinct subset of these cells. However, since Rohon-Beard neurons are primary sensory’ cells mediating tactile sensitivity (Metcalfe et al., 1990), it might well be that the subset of trigeminal neurons expressing lacZ are also specific for tactile stimuli (Fig. 2).

Fig. 2.

lacZ expression pattern in embryos of the line h32. The embryo in C is 30 hours old, all others are 24 hours old. Photographs A and B were taken of the same embryo (for orientation, the arrow in both photographs points to the same β-Gal positive cell in the spinal cord). (A) Neurons show β-Gal activity in both trigeminal ganglia; (B) several Rohon-Beard neurons show β-Gal activity. Photographs C-G show embryos double-stained for lacZ expression with X-Gal and for expression of the L2/HNK-1 carbohydrate with the zn-12 antibody. (C) Note β-Gal activity in the trigeminal ganglion (arrow) and the network of sensory axons stained with the zn-12 antibody. (D) shows lacZ expression in a neuron (overstained) neighbouring several zn-12 positive (Rohon-Beard) cells. The arrow in E points to the membrane, which is brown because of L2/HNK-1 expression, whereas the nucleus is stained in blue (lacZ expression). (F and G) show cross sections through the mesencephalon (F) and the spinal cord (G). The arrows point to β-Gal positive (blue) cells. The membranes of the trigeminal ganglion cells (F) and of the Rohon-Beard cells (G) (brown) are labelled with the zn-12 antibody. Whole-mounts are oriented with anterior to the left. Abbreviations: notochord (n), canalis centralis (cc). Magnification bar in A (same in B) is 50 μm; C is 30 μm; D (same in G) is 9 μm; E (same in F) is 14 μm.

Fig. 2.

lacZ expression pattern in embryos of the line h32. The embryo in C is 30 hours old, all others are 24 hours old. Photographs A and B were taken of the same embryo (for orientation, the arrow in both photographs points to the same β-Gal positive cell in the spinal cord). (A) Neurons show β-Gal activity in both trigeminal ganglia; (B) several Rohon-Beard neurons show β-Gal activity. Photographs C-G show embryos double-stained for lacZ expression with X-Gal and for expression of the L2/HNK-1 carbohydrate with the zn-12 antibody. (C) Note β-Gal activity in the trigeminal ganglion (arrow) and the network of sensory axons stained with the zn-12 antibody. (D) shows lacZ expression in a neuron (overstained) neighbouring several zn-12 positive (Rohon-Beard) cells. The arrow in E points to the membrane, which is brown because of L2/HNK-1 expression, whereas the nucleus is stained in blue (lacZ expression). (F and G) show cross sections through the mesencephalon (F) and the spinal cord (G). The arrows point to β-Gal positive (blue) cells. The membranes of the trigeminal ganglion cells (F) and of the Rohon-Beard cells (G) (brown) are labelled with the zn-12 antibody. Whole-mounts are oriented with anterior to the left. Abbreviations: notochord (n), canalis centralis (cc). Magnification bar in A (same in B) is 50 μm; C is 30 μm; D (same in G) is 9 μm; E (same in F) is 14 μm.

We present evidence that the 4.8 kb Pstl fragment of phs6-lacZA can integrate functionally into the zebrafish genome. In addition, we find that the truncated mouse heat-shock promoter can be used as a minimal promoter in zebrafish, which may come under the influence of genomic regulatory elements, conferring spatially and temporally restricted expression of lacZ on a specific tissue. In the case reported in this paper, expression of lacZ is restricted exclusively to primary sensory neurons during the period of approximately 16 to 72 hours embryonic development. This may be due to cis-acting effects from nearby enhancers or other tissue-specific regulatory sequences. As in other species (O’Kane and Gehring, 1987; Allen et al., 1988; Gossler et al., 1989), lacZ expression in the zebrafish may therefore serve as a valuable morphological marker to study patterns of gene expression at the cellular level.

In three previous studies, rates of germline transmission and stable integration in the zebrafish genome, following injection of foreign DNA, were found to vary greatly (Stuart et al., 1988,1990 ; Culp et al., 1991). This variation may be due to a number of factors, such as the conditions of injection anchor the method used to screen for germline positives. Injection of supercoiled plasmids was reported to result in a higher frequency of germline transformation (5% in Stuart et al., 1990; or up to 25% in Culp et al., 1991) than injection of linear constructs [no transgenic was found by Culp et al. (1991) and one was found among 20 P fish by Stuart et al. (1988) with linear constructs]. Since our main concern was the production of lacZ-expressing trans-genics, rather than the production of transgenics as such, our material was screened in various ways; consequently, our data cannot be directly compared to previously published data. Since our main interest was functional lacZ expression, we did not verify by Southern blotting whether all our PCR-positive fish were germline transformants.

Indeed, we believe that all available numbers, those previously published as well as our own data, are too low to permit any meaningful generalizations and that there are still many imponderables which are beyond our control. Founder fish r200 and r215 provided evidence compatible with transmission in an extrachromosomal state (Table 2; see below). Hence, it may be that some of the PCR-positives may still have carried the constructs as plasmids rather than integrated in their genome. Alternatively, rearrangements or suppression of expression after passage through the germline may also account for the failure to detect lacZ expression in the other seven PCR-positive lines. However, one fish of the eight PCR-positive founder fish injected with linear DNA (h32) carried the reporter construct as a single copy in its genome. This observation is novel, since all other transgenic zebrafish studied so far (Stuart et al., 1988; 1990; Culp et al., 1991) carried the foreign DNA in a rearranged state or as multiple copies; this has also been observed for transgenic mice (Palmiter and Brinster, 1986).

Following injections of supercoiled pRSVβGal, Culpe et al. (1991) tested five of their 19 transgenic lines for lacZ expression. Although all were transgenic fish (verified by Southern analysis), none showed β-Gal activity in their offspring. Following injections of pRSV-βGal (also supercoiled), we observed lacZ expression in the Fx offspring of two injected animals; however, we studied Fi lines established from these animals and could not find evidence for stable germline transformation (see above). We cannot decide to what extent the failure to detect stable lacZ expression is due to the pRSVβGal construct. In C. elegans and mouse, it is possible for injected sequences to be maintained extrachromosomally, even when passed through the germline (Stinchcomb et al., 1985; Rassoulzadegan et al., 1986; Mello et al., 1991). Therefore, we assume that, in the lines r200 and r215, sequences were passed through the germline in an extrachromosomal state.

One of the main goals of our study was to apply enhancer trap techniques to the zebrafish. Transgenic animals carrying a reporter gene can serve as a tool to search for developmentally regulated genes, for generation of specific deletion mutations using the expression of the reporter gene as a dominant marker, and for further molecular work on the corresponding genes. The line h32 examined in this study exhibits a precisely regulated expression pattern in time and space. Double-labeling allowed us to identify the lacZ-expressing cells as primary sensory neurons. Although we followed the inheritance through four generations, in which the pattern of β-Gal activity is reproducible, lacZ expression is not fully penetrant. We have no compelling explanation for this latter observation; a variety of possibilities, such as the position of the insertion in the genome, may be considered. Nevertheless, this technique can in principle be applied to the zebrafish, as it has been applied in similar fashion to several other animal species (O’Kane and Gehring, 1987; Allen et al., 1988; Gossler et al., 1989). However, the frequency of enhancer detection is apparently very low in the zebrafish, at least with the constructs used in our study. We screened by various means the progeny of a total of 304 P animals injected with one of two different constructs and found only one case in which lacZ expression was transmitted stably over several generations.

The pattern of expression in this case (line h32) is remarkable. Metcalfe et al. (1990) characterized with the antibody zn-12 the temporal and spatial pattern of expression of the L2/HNK-1 tetrasaccharide in zebrafish embryos, focusing in particular on the primary sensory neurons. Primary neurons are a distinct set of large neurons that arise early, rapidly develop long axons and interconnect to form a simple neural network that mediates the early behaviour of the embryo (Grunwald et al., 1988; Kimmel and Westerfield, 1990). It has been suggested that the primary sensory neurons (Rohon-Beard neurons in the trunk and trigeminal neurons in the head) follow a common developmental program. The developmental profile of the transgene line h32 seems to support this observation, since lacZ expression can be found exclusively in these two cell types. We detect β-Gal activity at about 16 hours, when trigeminal cells are being established. Considering that lacZ transcription starts earlier, the endogenous zebrafish gene could have an early function in the development of the primary sensory neurons.

We would like to thank Eva Varus for expert technical assistance, Paul Hardy for constructive criticisms on the manuscript, Achim Gossler for advice and discussions, and Beate Schmitz, Christiane Bierkamp for discussions. The research reported here was supported by a doctoral Fellowship of the Fritz-Thyssen Stiftung to T.A.B. and by grants of the Deutsche Forschungsgemeinschaft (DFG, SFB 243).

Allen
,
N. D.
,
Cran
,
D. G.
,
Barton
,
S. C.
,
Hettle
,
S.
,
Reik
,
W.
and
Surani
,
M. A.
(
1988
).
Transgenes as probes for active chromosomal domains in mouse development
.
Nature
333
,
852
855
.
Bellen
,
H. J.
,
O’Kane
,
C. J.
,
Wilson
,
C.
,
Grossnlklaus
,
U.
,
Pearson
,
R. K.
and
Gehring
,
W. J.
(
1989
).
P element mediated enhancer detection: a versatile method to study development in Drosophila
.
Genes Dev
3
,
1288
1300
.
Bier
,
E.
,
Vaessin
,
H.
,
Sheperd
,
S.
,
Lee
,
K.
,
McCall
,
K.
,
Barbel
,
S.
,
Ackerman
,
L.
,
Carretto
,
R.
,
Uemura
,
T.
,
Grell
,
E.
,
Jan
,
L. Y.
and
Jan
,
Y. N.
(
1989
).
Searching for pattern and mutation in the Drosophila genome with a P-lacZ vector
.
Genes Dev
3
,
1273
1287
.
Chakrabarti
,
S.
,
Streisinger
,
G.
,
Singer
,
F.
and
Walker
,
C.
(
1983
).
Frequency of X-ray induced specific locus and recessivelethal mutations in mature germ cells of the zebrafish, Brachydanio rerio
.
Genetics
103
,
109
123
.
Culp
,
P.
,
Nüsslein-Volhard
,
C.
and
Hopkins
,
N.
(
1991
).
High-frequency germ-fine transmission of plasmid DNA sequences injected into fertilized zebrafish eggs
.
Proc. Natl. Acad. Sci. USA
88
,
7953
7957
.
Edlund
,
T.
,
Walker
,
M. D.
,
Barr
,
P. J.
and
Rutter
,
W. J.
(
1985
).
Cellspecific expression of the rat insuhn gene: evidence for a role of two distinct 5’ flanking elements
.
Science
230
,
912
916
.
Feinberg
,
A. P.
and
Vogelstein
,
B.
(
1983
).
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity
.
Anal. Biochem
.
137
,
266
267
.
Ghysen
,
A.
and
O’Kane
,
C.
(
1989
).
Neural enhancer-like elements as cell specific markers in Drosophila
.
Development
105
,
35
52
.
Gossler
,
A.
,
Joyner
,
A. L.
,
Rossant
,
J.
and
Skarnes
,
W. C.
(
1989
).
Mouse embryonic stem cells and reporter constructs to detect developmentally regulated genes
.
Science
244
,
463
465
.
Grunwald
,
D. J.
,
Kimmel
,
C. B.
,
Westerfield
,
M.
,
Walker
,
C.
and
Streisinger
,
G.
(
1988
).
A neural degeneration mutation that spares primary neurons in the zebrafish
.
Dev. Biol
.
126
,
115
129
.
Hazelrigg
,
T.
,
Levis
,
R.
and
Rubin
,
G. M.
(
1984
).
Transformation of . white locus DNA in Drosophila’, dosage compensation, zeste interaction, and position effects
.
Cell
36
,
469
481
.
Kimmel
,
C. B.
(
1989
).
Genetics and early development of zebrafish
.
TIG
5
, no.
8
,
283
288
.
Kimmel
,
C. B.
and
Westerfield
,
M.
(
1990
).
Primary neurons of the zebrafish
.
In Signals and Sense
(ed.
G.M.
Edelman
and
M.W.
Cowan
)
New York
:
Wiley Interscience
.
Kothary
,
R.
,
Clapoff
,
S.
,
Brown
,
A.
,
Campbell
,
R.
,
Peterson
,
A.
and
Rossant
,
J.
(
1988
).
A transgene containing lacZ inserted into the dystonia locus is expressed in neural tube
.
Nature
335
,
435
437
.
Mello
,
C. C.
,
Kramer
,
J. M.
,
Stinchcomb
,
D.
and
Ambros
,
V.
(
1991
).
Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences
.
EMBO J
.
10
, no.
12
,
3959
3970
.
Metcalfe
,
W. K.
,
Myers
,
P. Z.
,
Trevarrow
,
B.
,
Bass
,
M. B.
and
Kimmel
,
C. B.
(
1990
).
Primary neurons that express the L2/HNK-1 carbohydrate during early development of the zebrafish
.
Development
110
,
491
504
.
O’Kane
,
C. J.
and
Gehring
,
W. J.
(
1987
).
Detection of regulatory elements in Drosophila
.
Proc. Natl. Acad. Sci. USA
84
,
9123
9127
.
Overbreek
,
P. A.
,
Lal
,
S.
,
Van Quii
,
K. R.
and
Westphal
,
H.
(
1986
).
Tissue-specific expression in transgenic mice of a fused gene containing RSV terminal sequences
.
Science
231
,
1574
1577
.
Palmiter
,
R. D.
and
Brinster
,
R. L.
(
1986
).
Germ-line transformation of mice
.
Ann. Rev. Genet
.
20
,
465
499
.
Rassoulzadegan
,
M.
,
Leopold
,
P.
,
Vallly
,
J.
and
Cuzin
,
F.
(
1986
).
Germ-line transmission of autonomous genetic elements in transgenic mouse strains
.
Cell
46
,
513
519
.
Sambrook
,
J.
,
Fritsch
,
E. F.
and
Maniatis
,
T.
(
1989
).
Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY)
, 2nd Ed.
Stinchcomb
,
D. T.
,
Shaw
,
J. E.
,
Carr
,
S. H.
and
Hirsh
,
D.
(
1985
).
Extrachromosomal DNA transformation of Caenorhabditis elegans
.
Molec. cell. Biol
.
5
,
3484
3496
.
Streisinger
,
G.
,
Walker
,
C.
,
Dower
,
N.
,
Knauber
,
D.
and
Singer
,
F.
(
1981
).
Production of clones of homozygous diploid zebrafish (Brachydanio rerio)
.
Nature
291
,
293
296
.
Stuart
,
G. W.
,
McMurray
,
J. V.
and
Westerfield
,
M.
(
1988
).
Replication, integration, and stable germ-line transmission of foreign sequences injected into early zebrafish embryos
.
Development
103
,
403
412
.
Stuart
,
G. W.
,
Vielkind
,
J. R.
,
McMurray
,
J. V.
and
Westerfield
,
M.
(
1990
).
Stable lines of transgenic zebrafish exhibit reproducible patterns of transgene expression
.
Development
109
,
577
584
.
Swain
,
J. L.
,
Stewart
,
T. A.
and
Leder
,
P.
(
1987
).
Parental legacy determines methylation and expression of an autosomal transgene: A molecular mechanism for parental imprinting
.
Cell
50
,
719
727
.
Walker
,
C.
and
Streisinger
,
G.
(
1983
).
Induction of mutations by grays in pregonial germ cells of zebrafish embryos
.
Genetics
103
,
125
136
.
Westerfield
,
M.
, ed. (
1989
).
The Zebrafish Book
.
Eugene
:
Univ, of Oregon Press
.
Wilson
,
C.
,
Pearson
,
R. K.
,
Bellen
,
H. J.
,
O’Kane
,
C. J.
,
Grossnlklaus
,
U.
and
Gehring
,
W. J.
(
1989
).
P element-mediated enhancer detection: an efficient method for isolating and characterizing developmentally regulated genes in Drosophila
.
Genes Dev
.
3
,
1301
1313
.