The specialised epithelia lining the respiratory tract, pancreatic ducts, male genital ducts and sweat gland ducts are defective in the severe inherited disease, cystic fibrosis (CF).

We have looked at the expression of the CF gene in human fetal tissues to throw light on the development of function in specialised ductal epithelia and to determine the age of onset of the CF disease process. The CF gene is already seen to be transcribed in mid-trimester fetal lung, pancreas and male genital ducts. Hence, by this developmental stage, and before they are fully differentiated, these epithelia have the capability to perform important transport functions. Epithelial cell cultures derived from fetal pancreas and male genital ducts maintain expression of the CF gene in vitro and so form good models for analysing CF gene function and differentiation of these specialised epithelia.

Cystic fibrosis (CF) is the most common autosomal recessive disease in Caucasian races. The disease affects four main organ systems: in the sweat glands, the disease causes increased levels of sodium chloride in the sweat; in the lungs, poor mucus clearance results in recurrent lung infections; in the pancreas, blockage of pancreatic ducts with inspissated secretions causes gradual autolysis of the organ and acini are replaced by cystic spaces; in the male genital ducts, the vas deferens is usually absent and the epididymis structurally abnormal, causing sterility in 97% of affected males; this structural defect probably results from an early blockage of the vas deferens with secretory deposits.

Though the CF gene has recently been cloned (Rommens et al. 1989; Riordan et al. 1989; Kerem et al.1989), we do not yet know its exact function. From phenotypic characteristics it appears that the basic defect in CF affects the regulation of chloride ion transport. This abnormality is seen in the specialized epithelial cells that line the sweat gland duct, the airways and, presumably, the pancreatic and genital ducts (Quinton, 1983; Sato and Sato, 1984; Widdi-combe et al. 1985; Knowles et al. 1983; Welsh and Liedtke, 1986; Frizzell et al. 1986; Gray et al. 1989, 1990. The precise defect at the cellular level has not yet been elucidated.

The protein product predicted from the cDNA sequence of the CF gene (Riordan et al. 1989) would appear to have 2 membrane-spanning domains, 2 nucleotide (ATP) binding folds and a cytoplasmic domain in which are located multiple potential sub-strate sites for protein kinase A and protein kinase C. How exactly this protein might influence the regulation of Cl movements across the apical membrane of these specialised epithelial cells remains unclear. However, it is possible that the cystic fibrosis transmembrane conductance regulator (CFTR) is not itself a chloride ion channel (Hyde et al. 1990).

The tissue-specific expression of the CF gene postnatally has been shown to correlate well with the pathology of the disease. High levels of expression are seen in pancreas and nasal polyps, and lower levels in the lung, colon and sweat glands. Detection of the 6.5 kb CF gene message on northern blots of total RNA has not been possible for skin fibroblasts, lymphoblastoid cell lines or peripheral blood lymphocytes (Riordan et al. 1989).

There is already good evidence from the pathology of mid-trimester fetuses, terminated following a diagnosis of CF, that some tissues show certain features that are likely to represent the onset of later degenerative changes (Boue et al. 1986; Ornoy et al. 1987). However, to date the pattern of CF gene expression in human fetal tissues has not been examined. This question is of fundamental importance in understanding the disease process for the following reasons. First, if the CF gene is expressed in early fetal development then the effects of its mutation might well cause tissue and organ damage prior to birth when conventional CF treatments can commence. Second, the expression patterns of the CF gene in fetal epithelial cells are key factors in establishing the validity of certain model systems for studying CF gene function (Harris and Coleman, 1987, 1988, 1989). Lack of availability of viable tissues from two adult organs that are primarily affected in CF, specifically the pancreas and male genital ducts, means that, in order to elucidate how the CF gene functions at a cellular level in these tissues, it will be essential to study fetal material.

The ductal epithelium from the pancreas cannot be obtained in a viable form from adults post mortem since pancreatic autolysis causes irreversible damage very shortly after death. In CF patients, the pancreas is also gradually destroyed by the disease process. Blockage of pancreatic ducts prevents normal release of enzymes that instead autolyse the acini. In the mid-trimester fetal pancreas, there are no fully developed, enzyme-secreting acini and so ductal epithelium can be obtained post mortem for long-term propagation in vitro. The availability of male genital ducts postnatally is also limited. We have established cell culture systems for both fetal pancreatic duct epithelium and male genital duct epithelium. (Harris and Coleman, 1987, 1988, 1989). However, if these epithelial cells are to be useful in analysing the mechanism of action of the CF gene and its protein product, it is important to demonstrate expression of this gene in vivo and in vitro.

We have analysed expression of the CF gene both in tissues derived from mid-trimester fetuses and in cultured cell lines derived from fetal tissues. Further, cDNA libraries have been constructed from mRNA from normal and CF pancreatic duct epithelial cells. These libraries have been screened for representation of the CF gene message. Positive cDNA clones have been analysed further to compare their sequence with CFTR cDNAs isolated from other tissues.

Development and differentiation of specialised ductal epithelial cells in human tissues have received comparatively little attention. Analysis, during development, of the expression of a gene that is involved in the transport functions of these epithelia is of fundamental importance.

Materials

Mid-trimester fetal material was obtained (with ethical permission) from mid-trimester prostaglandin-induced terminations or spontaneous abortions. CF diagnoses were made on the basis of amniotic fluid microvillar enzyme levels and alkaline phosphatase levels at 18 weeks (Brock et al. 1984, 1985; Boue et al. 1986), and/or using polymorphic DNA markers linked to the CF gene to follow its inheritance (Harris et al. 1988; Harris, 1990).

Cell culture

Establishment of cell cultures, culture media, culture sub-strates and routine passaging of cells were as described previously (Harris and Coleman, 1987, 1988, 1989). Briefly, cultures of fetal pancreatic duct epithelial cells and genital duct epithelial cells were maintained in CMRL1066 medium containing 10–20 % fetal calf serum (Gibco UK), with insulin (0.2unitsml−1), cholera toxin (10−10M) and hydrocortisone (1μg ml−1), all from Sigma. Cells were grown in Primaria flasks (Falcon, Becton Dickinson) at 37°C in a humidified 5 % CO2 incubator. Pancreatic duct cells were passaged with dispase (Boehringer, Mannheim) and genital duct cells with trypsin (0.25%) and EDTA (0.02%).

RNA extraction and construction of cDNA libraries

RNA was prepared from tissue samples and from cell cultures by guanidinium thiocyanate extraction (Chirgwin et al. 1979). Since the number of cells that can be grown from one fetal pancreas is limited, the amounts of mRNA produced are small, so total RNA has been used (without poly (A)+ selection) to construct cDNA libraries. Methods used were based on those of Gubler and Hoffman (1983). cDNA fragments were blunt-end ligated into the PvuII site of the plasmid vector pATX (Chung et al. 1985). Two cDNA libraries have been constructed, one (JR27) from normal 17-week fetal pancreatic duct cells and one (VA–CF) from pancreatic duct cells derived from an 18-week CF fetus. This fetus was diagnosed as having CF on the basis of abnormal amniotic fluid microvillar enzymes (Boue et al. 1986). It has subsequently been shown not to carry the ΔF508 common CF mutation (Kerem et al. 1989; Mathew et al. 1989) in either of its CF genes, hence it cannot be unequivocally diagnosed as CF until further mutations in the CF gene have been defined.

Detection of expression of the CF gene

The CF gene transcript was detected in RNA from tissue samples and cell cultures either by northern blotting or by direct amplification of cDNA synthesized from the RNA.

For northern blots total RNA was separated on denaturing formaldehyde gels by standard methods, and transferred to Gene Screen Plus (NEN) or Hybond N (Amersham) membranes. Northern blots were hybridized in 50% forma-mide at 42°C either with a probe (H, see below) amplified from the 3′ end of the CF gene by the polymerase chain reaction (PCR) (Saiki et al. 1988) or the human DNA insert from the 4A10 CFTR cDNA clone (see below).

For direct detection of the CF gene transcript cDNA synthesized from total RNA was amplified by PCR. The primers for the PCR reaction were derived from the CF cDNA sequence (Riordan et al. 1989), EIR 5′→3′ 3055 AGATTCTCCAAAGATATAGC 3074 and EIL 5′→3′ 3824 GAAATGTTGTCTAATATGGC 3805. The EIL oligonucleotide was annealed to 1 μg of RNA at 65 °C for 10 min and used to prime cDNA synthesis at 42°C for 60 min with reverse transcriptase (BRL). The amplification reaction was at 94 °C for 5 min, then 30 cycles of 93°C for 1 min, 60°C for 1 min, 72°C for 4.5 min, with a final elongation at 72°C for 5 min. DNA fragments were resolved on a 0.8% agarose gel or a 3.5% acrylamide gel.

The cDNA libraries were screened with a 945 bp probe (H) constructed by PCR using primers specific for the 3’ untranslated region of the published CF gene cDNA sequence. The template for the PCR reaction was DNA from a normal female. The first primer sequence HIR, 5′→3′ is 5127 GAATACCACAGGAACCACAA 5146; the second, HIL 5′→3′ is 6072 GCAGTCTTCTTAAGAGTCCAG 6053. The amplification reaction was at 94°C for 5 min, then 93°C for 1 min, 58°C for 1 min, 72°C for 7 min for 30 cycles with a final 72°C elongation for 5 min. The probe (H) was separated from unincorporated nucleotides and excess primer by Geneclean (Bio101) and gel purification. The probe was labelled to 3×108cts min−1μg−1 by random oligonucleotide priming (Feinberg and Vogelstein, 1983). Libraries were screened on replica Hybond C (Amersham) filters.

DNA sequencing

cDNA clones were analysed by double-stranded DNA sequencing according to the methods of Green et al. (1989), using Sequenase (USB). Sequencing primers homologous to the pATX cloning vector adjacent to the cloning site in both orientations and a relevant internal primer D2L homologous to the CF gene cDNA sequence 5′→3′ 3259 GTTGTTTGAGTTGCTGTGGAG 3240 in exon 17A were used.

Detection of messenger RNA

The CF gene message can be detected in ductal epithelial cells derived from 18-week fetal pancreas by probing northern blots of total RNA. In Fig. 1A, expression of a 6.5 kb message, homologous to a CF gene cDNA probe, is detected in pancreatic duct epithelial cells (P), though not pancreatic fibroblasts (F). The smear of hybridization to lower relative molecular mass species is probably due to partial degradation of mRNA. Fig. IB shows the same northern blot as in Fig. 1A hybridized with a partial cDNA for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a housekeeping gene with a 1.1 kb message, to illustrate that this mRNA is largely intact and to enable quantitation of the amounts of RNA that have been loaded in each lane. This is the first demonstration of expression of the CF gene in fetal tissues. The CFTR message can also be readily detected following cDNA amplification by PCR. Fig. 2 shows amplification of the CF gene mRNA, following cDNA synthesis from an appropriate PCR primer, in mid-trimester fetal tissues or cell lines derived from them.

Fig. 1.

Northern blots of (A) total RNA from pancreatic duct cells (P) 5 μg and pancreatic fibroblasts (F) 20 μg, probed with the 4A10 CFTR cDNA clone insert and (B) the same blot probed with a partial cDNA for GAPDH.

Fig. 1.

Northern blots of (A) total RNA from pancreatic duct cells (P) 5 μg and pancreatic fibroblasts (F) 20 μg, probed with the 4A10 CFTR cDNA clone insert and (B) the same blot probed with a partial cDNA for GAPDH.

Fig. 2.

Amplification of a 769 bp fragment E of the CF gene from mRNA derived from the following 18-week fetal tissues: PD, cultured fetal pancreatic duct epithelial cells; P, whole pancreas; LU, lung; LI, liver; GD, male genital ducts; GO, gonad; GU, gut; FI, cultured fetal pancreas-derived fibroblasts; NT, no reverse trancriptase; NR, no RNA. The size markers are a 1 kb ladder (BRL). The primers for the PCR reaction were EIR 5′→3′ 3055 AGATTCTCCAAAGATATAGC 3074 and EIL 5′→3′ 3824 GAAATGTTGTCTAATATGGC 3805. DNA fragments were resolved on a 0.8% agarose gel.

Fig. 2.

Amplification of a 769 bp fragment E of the CF gene from mRNA derived from the following 18-week fetal tissues: PD, cultured fetal pancreatic duct epithelial cells; P, whole pancreas; LU, lung; LI, liver; GD, male genital ducts; GO, gonad; GU, gut; FI, cultured fetal pancreas-derived fibroblasts; NT, no reverse trancriptase; NR, no RNA. The size markers are a 1 kb ladder (BRL). The primers for the PCR reaction were EIR 5′→3′ 3055 AGATTCTCCAAAGATATAGC 3074 and EIL 5′→3′ 3824 GAAATGTTGTCTAATATGGC 3805. DNA fragments were resolved on a 0.8% agarose gel.

A 769 bp fragment E, from base 3055–3824 in the CFTR cDNA sequence (Riordan et al. 1989), that spans part of the second predicted membrane-spanning domain in CFTR was amplified by PCR. The EIL oligonucleotide was used to prime cDNA synthesis. Equal amounts (l μg) of total RNA were used in each reaction and amplification of a 757 bp fragment from the 5′ end of a housekeeping gene, glucose phosphate isomerase, from equal volumes of the same RNA samples was used to confirm the approximately equal amounts of template RNA and the efficiency of transcription and polymerase chain reaction in each sample (not shown). The following pattern of expression of the CF gene in 18-week fetal tissues is evident: substantial expression in pancreatic duct cells (PD), clearly detectable expression in whole pancreas (P), lung (L), male genital ducts (GD) and gut (GU) but no detectable expression in liver (L) or pancreas-derived fibroblasts (FI) at the same age (Fig. 2). Low levels of expression of the CF gene in fetal testis are seen but are not detectable in this figure (GO). Amounts of the CFTR mRNA in pancreatic duct epithelial cells, lung and liver from 12- to 18-week CF fetuses (heterozygous for the ΔF508 mutation) were indistinguishable from the levels seen in the respective normal tissues (data not shown). The apparent levels of expression in fetal pancreatic duct cells (PD) is between 5- to 10-fold higher than in whole pancreas (P) or lung (L).

Screening of pancreatic duct cDNA libraries

The JR27 library contains 1.19×105 independent cDNA clones and the VA–CF library contains 1.59×105 cDNA clones. Each library was screened with a 945 bp probe (H) constructed by PCR (Saiki et al. 1988) using primers specific for the 3′ untranslated region of the published CF gene cDNA sequence (Riordan et al.1989).

The normal (JR27) library contained a representation of 0.017 % positive clones and the CF (VA–-CF) library 0.033 %. This is comparable with an estimation of the CF gene transcript as approximately 0.01 % of total mRNA in T84 cells (Riordan et al. 1989). Positive cDNA clones were rescreened, and DNA prepared from them. The cDNA clones with the largest human inserts were analysed further by double-stranded sequencing (Green et al. 1989) to determine the positions of their 5′ and 3′ ends on the CF gene cDNA map. Sequencing primers homologous to the pATX cloning vector adjacent to the cloning site in both orientations and an internal primer D2L homologous to the CF gene cDNA sequence 5′ →3′ 3259 GTTGTTTGAGTTGCTGTGGAG 3240 in exon 17A were used. The 5′ end of the largest clone (4A10) from the VA-CF library is located in exon 13 of the CF gene at bp 2132, encompassing a cDNA of approximately 4 kb. The 3′ end includes 15 residues of the poly (A)+ tail of the gene, though another clone (2B11) has more than 75 A residues at its 3′ end. Further, the 200bp sequenced from each primer shows no deviation from the published cDNA sequence (Riordan et al. 1989). Preliminary restriction mapping of the CF gene cDNA clones isolated from pancreatic duct cells suggests that there are no major differences in splicing patterns of the CF gene between exons 13 and 27 in this tissue and the sweat gland duct, lung and colon from which the published cDNA sequence’ was derived (Fig. 3). The clone 4A10 was cleaved with BamHI; EcoRI; BamHI plus EcoRI; BstXI-, and HindIII. According to the published CFTR cDNA sequence each of these enzymes should cleave the cDNA at one or more sites between bp 2132 and the 3′ end of the gene (see Table 1). 4A10 cDNA restriction fragment sizes for all enzymes shown in Fig. 3 correspond to the expected sizes calculated from the published cDNA sequence in Table 1.

Table 1.

Restriction sites in CF cDNA from bp 2132 to polyA tail

Restriction sites in CF cDNA from bp 2132 to polyA tail
Restriction sites in CF cDNA from bp 2132 to polyA tail
Fig. 3.

Restriction enzyme cleavage of 4A10 cDNA clone. U=uncut; B=BamHI; E=EcoRI; B+E = BamHI+EcoRI; Bs=BstX; H=HindIII; M= 1 kb ladder BRL.

Fig. 3.

Restriction enzyme cleavage of 4A10 cDNA clone. U=uncut; B=BamHI; E=EcoRI; B+E = BamHI+EcoRI; Bs=BstX; H=HindIII; M= 1 kb ladder BRL.

We have shown that the CF gene is expressed in substantial amounts in certain fetal tissues by 18 weeks of gestation. The highest levels of transcription are seen in the pancreas, with lower levels in the lungs, gut and genital ducts. Within the genital ducts, CFTR message is largely localised in the vas deferens. No detectable CFTR message is seen in the liver at this age. These expression patterns reflect the differential expression levels seen in the same tissues postnatally.

In terms of development of specialised ductal epithelia, this is an interesting observation since we know that at 18 weeks gestation these epithelia are not fully differentiated. In particular, the two main cell types seen in cultures of mid-trimester fetal pancreatic duct encompass only a small percentage of the differentiated epithelial cell types regionally distributed along the mature pancreatic duct system (Harris and Coleman, 1987, 1988). On morphological and secretory criteria, one cell type appears to be a developmental precursor of the other. Both populations express CFTR as assayed by analysis of cultures containing either only the precursor cell type or both cell types (data not shown). Hence, despite their structural and functional immaturity, these cells have already developed significant transport capabilities (assuming transcription of the CF gene reflects production of a functional CFTR protein).

It is of interest that the pancreas at 18 weeks contains such high levels of the CFTR message, since at 18 weeks there are no fully developed acini in the organ. In other words, it seems probable that CF gene expression in the ductal tree, which is already well established at this age, may be of greater physiological significance than any potential expression of CFTR in the acini. Amounts of the CFTR mRNA in pancreatic duct epithelial cells, lung and liver from a 12-week CF fetus were indistinguishable from the levels seen in the respective normal tissues (data not shown). This would be expected from the nature of the vast majority of mutations defined in the CF gene to date (CF genetic analysis consortium, unpublished observations), which simply alter the amino acid sequence of the CFTR protein. Since the CF gene is already expressed in the mid-trimester fetal pancreas, lungs and genital ducts, it is likely that a mutant gene may have caused considerable damage to these organ systems and possibly others before birth.

Also of importance is the observation that the CF gene is already expressed in substantial amounts at 18 weeks in the lung. It is well known that the lung epithelium exhibits different functions and electro-physiological characteristics before and after birth. In adult sheep, the tracheal epithelium absorbs sodium, whereas the fetal tracheal epithelium secretes chloride ions (Cotton et al. 1983; Olver and Robinson, 1985). This observation may suggest that the CFTR protein may only affect chloride ion transport secondarily. In other words, the CF phenotype, measurable in terms of abnormal regulation of ion transport in specialised epithelial cells, may only be a secondary effect of the disease. Current confusion over the precise chloride ion channel that may be abnormally regulated in different CF epithelia (Frizzell et al. 1986; Welsh 1986; Welsh and Liedtke 1986; Schoumacher et al. 1987; Li et al. 1988; Gray et al. 1989, 1990; Rich et al. 1990; Drumm et al. 1990; Anderson et al. 1991; Kartner et al. 1991) could also be accounted for by this explanation. However, recent data suggesting that the CFTR cDNA may code for a small chloride ion channel (Anderson et al. 1991 ; Kartner et al. 1991) would imply a direct role for CFTR in ion transport.

The CFTR cDNA sequence published by Riordan et al. (1989) was based largely on cDNA clones derived from colon, lung and sweat gland duct. Hence it was of interest to examine the CF gene transcript in pancreas more extensively. Restriction mapping and sequence analysis of CFTR partial cDNA clones derived from the fetal pancreatic duct cDNA libraries suggests that there are no major differences between the CFTR cDNA in pancreatic duct cells and sweat gland duct cells, lung or colon (Riordan et al. 1989). This observation has been confirmed and extended through analysis of CFTR cDNA amplified by PCR from pancreatic duct epithelial cells (data not shown). This is of particular interest since it now seems likely that the specific chloride ion channel that shows defective regulation in CF is different in the pancreatic duct from that seen in airway and sweat gland duct epithelia (Gray et al. 1989, 1990), and may be more directly related to the CFTR gene product (Anderson et al. 1991; Kartner et al. 1991). However, it is also possible that the CFTR either interacts with distinct channels to regulate their activity or the protein affects chloride ion channel activity only indirectly.

In summary, these data validate the use of epithelial cell cultures from human fetal tissues to study differentiated transport functions in specialised human ductal epithelia and more specifically the function of the CF gene and the role of the CFTR protein. Further, they may have significant bearing on devising new strategies for treating CF.

The authors thank Drs David Bentley and Peter Green for help and invaluable advice; also Professors A. Boue and J. P. Fryns, Drs Jean Keeling, Mary Seller and Jamie Walker; and Adrienne Knight for secretarial assistance. The work was supported by Guy’s Special Trustees, the Generation Trust, the Cancer Research Campaign, the Cystic Fibrosis Research Trust and the Spastics Society.

Anderson
,
M. P.
,
Rich
,
D. P.
,
Gregory
,
R. J.
,
Smith
,
A. E.
and
Welsh
,
M. J.
(
1991
).
Generation of cAMP-activated chloride currents by expression of CFTR
.
Science
251
,
679
682
.
Boué
,
A.
,
Muller
,
F.
,
Nezelof
,
C.
,
Oury
,
J. F.
,
Duchatel
,
F.
,
Dumez
,
Y.
,
Aubry
,
M. C.
and
Boué
,
J.
(
1986
).
Prenatal diagnosis in 200 pregnancies with a l-in-4 risk of cystic fibrosis
.
Hum. Genet
.
74
,
288
297
.
Brock
,
D. J. H.
,
Barron
,
L.
,
Bedgood
,
D.
and
Hayward
,
C.
(
1985
).
Prospective prenatal diagnosis of cystic fibrosis
.
Lancet
i
,
1175
1178
.
Brock
,
D. J. H.
,
Bedgood
,
D.
and
Hayward
,
C.
(
1984
).
Prenatal diagnosis of amniotic fluid microvillar enzymes
.
Hum. Genet
.
65
,
248
251
.
Chirgwin
,
J. M.
,
Przybyla
,
A. E.
,
Macdonald
,
R. J.
and
Rutter
,
W. J.
(
1979
).
Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease
.
Biochemistry
18
,
5294
5299
.
Chung
,
L. P.
,
Bentley
,
D. R.
and
Reid
,
K. B. M.
(
1985
).
Molecular cloning and characterisation of the cDNA coding for C4b-binding protein, a regulatory protein of the classical pathway of the human complement system
.
Biochem. J
.
230
,
1933
1956
.
Cotton
,
C. U.
,
Lawson
,
E. E.
,
Boucher
,
R. C.
and
Gatzy
,
J. T.
(
1983
).
Bioelectric properties and ion transport of airways excised from adult and fetal sheep
.
J. appt. Physiol.
55
,
1542
1549
.
Drumm
,
M. L.
,
Pope
,
H. A.
,
Cliff
,
W. H.
,
Rommens
,
J. M.
,
Marvin
,
S. A.
,
Tsui
,
L-C.
,
Collins
,
F. S.
,
Frizzell
,
R. A.
and
Wilson
,
J. M.
(
1990
).
Correction of the cystic fibrosis defect in vitro by retrovirus-mediated gene transfer
.
Cell
62
,
1227
1233
.
Feinberg
,
A. P.
and
Vogelstein
,
B.
(
1983
).
A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity
.
Analyt. Biochem
.
132
,
6
13
.
Frizzell
,
R. A.
,
Rechkemmer
,
G.
and
Shoemaker
,
R. L.
(
1986
).
Altered regulation of airway epithelial cell chloride channels in cystic fibrosis
.
Science
233
,
558
560
.
Gray
,
M. A.
,
Harris
,
A.
,
Coleman
,
L.
,
Greenwell
,
G. R.
and
Argent
,
B. E.
(
1989
).
Two types of chloride channel on duct cells cultured from human fetal pancreas
.
Am. J. Physiol
.
257
,
C240
C251
.
Gray
,
M. A.
,
Pollard
,
C. E.
,
Harris
,
A.
,
Coleman
,
L.
,
Greenwell
,
J. R.
and
Argent
,
B. E.
(
1990
).
Anion selectivity and block of the small-conductance chloride channel on pancreatic duct cells
.
Am. J. Physiol
.
259
,
C752
C761
.
Green
,
P. M.
,
Bentley
,
D. R.
,
Mibashan
,
R. S.
,
Nilsson
,
I. M.
and
Giannelli
,
F.
(
1989
).
Molecular pathology of haemophilia B
.
EMBO J
.
8
,
1067
1072
.
Gubler
,
U.
and
Hoffman
,
B. J.
(
1983
).
A simple and very efficient method for generating cDNA libraries
.
Gene
25
,
263
269
.
Harris
,
A.
(
1990
).
DNA markers near the Cystic Fibrosis locus: further analysis of the British population
.
J. med. Genet
.
27
,
39
41
.
Harris
,
A.
and
Coleman
,
L.
(
1987
).
Establishment of a tissue culture system for epithelial cells derived from human pancreas: a model for the study of cystic fibrosis
.
J. Cell Sci
.
87
,
695
703
.
Harris
,
A.
and
Coleman
,
L.
(
1988
).
Cultured epithelial cells derived from human fetal pancreas as a model for the study of cystic fibrosis: further analyses on the origins and nature of the cell types
.
J. Cell Sci
.
90
,
73
77
.
Harris
,
A.
and
Coleman
,
L.
(
1989
).
Ductal epithelial cells cultured from human fetal epidymis and vas deferens: relevance to sterility in Cystic Fibrosis
.
J. Cell Sci
.
92
,
687
690
.
Harris
,
A.
,
Quinlan
,
C.
and
Bobrow
,
M.
(
1988
).
Cystic fibrosis typing with DNA probes: experience of a screening laboratory
.
Hum. Genet.
79
,
76
79
.
Hyde
,
S. C.
,
Elmsley
,
P.
,
Hartshorn
,
M. J.
,
Mimmack
,
M. M.
,
Gileadi
,
U.
,
Pearce
,
S. R.
,
Gallager
,
M. P.
,
Gill
,
D. R.
,
Hubbard
,
R. E.
and
Higgins
,
C. F.
(
1990
).
Structural model of ATP-binding proteins associated with cystic fibrosis, multidrug resistance and bacterial transport
.
Nature
346
,
362
365
.
Kartner
,
N.
,
Hanrahan
,
J. W.
,
Jensen
,
T. J.
,
Naismith
,
A. L.
,
Sun
,
S.
,
Ackerley
,
C. A.
,
Reyea
,
E. F.
,
Tsui
,
L-C.
,
Rommens
,
J. R.
,
Bear
,
C. E.
and
Riordan
,
J. R.
(
1991
).
Expression of the cystic fibrosis gene in non-epithelial invertebrate cells produces a regulated anion conductance
.
Cell
64
,
681
691
.
Kerem
,
B-S.
,
Rommens
,
J. M.
,
Buchanan
,
J. A.
,
Mankiewicz
,
D.
,
Cox
,
T. C.
,
Chakravarti
,
A.
,
Buchwald
,
M.
and
Tsui
,
LG
. (
1989
).
Identification of the cystic fibrosis gene: genetic analysis
.
Science
245
,
1073
1080
.
Knowles
,
M. R.
,
Stutts
,
M. J.
,
Spock
,
A.
,
Fischer
,
N.
and
Gatzy
,
J. T.
(
1983
).
Abnormal ion permeation through cystic fibrosis respiratory epithelium
.
Science
221
,
1067
1070
.
Li
,
M.
,
Mccann
,
D.
,
Liedtke
,
C. M.
,
Nairn
,
A. C.
,
Greengard
,
P.
and
Welsh
,
M. J.
(
1988
).
Cyclic AMP-dependent protein kinase opens chloride channels in normal but not cystic fibrosis airway epithelium
.
Nature
331
,
358
360
.
Mathew
,
C. J.
,
Roberts
,
R. G.
,
Harris
,
A.
,
Bentley
,
D. R.
and
Bobrow
,
M.
(
1989
).
Rapid screening for AF508 deletion in cystic fibrosis
.
Lancet
ii
,
1346
.
Olver
,
R. E.
and
Robinson
,
E. J.
(
1985
).
Sodium and chloride transport by the tracheal epithelium of fetal, newborn and adult sheep
.
J. Physiol
.
375
,
377
390
.
Ornoy
,
A.
,
Arnos
,
J.
,
Katznelson
,
D.
,
Granat
,
M.
,
Caspi
,
B.
and
Chemke
,
J.
(
1987
).
Pathological confirmation of cystic fibrosis in the fetus following prenatal diagnosis
.
Am. J. med. Genet
.
28
,
935
947
.
Quinton
,
P. M.
(
1983
).
Chloride impermeability in cystic fibrosis
.
Nature
301
,
421
422
.
Rich
,
D. R.
,
Anderson
,
M. P.
,
Gregory
,
R. J.
,
Cheng
,
S. H.
,
Paul
,
S.
,
Jefferson
,
D. M.
,
Mccann
,
J. D.
,
Klinger
,
K. W.
,
Smith
,
A. E.
and
Welsh
,
M. J.
(
1990
).
Expression of cystic fibrosis transmembrane conductance regulator corrects defective chloride channel regulation in cystic fibrosis airway epithelial cells
.
Nature
347
,
358
363
.
Riordan
,
J. R.
,
Rommens
,
J. M.
,
Kerem
,
B-S.
,
Alon
,
N.
,
Rozmahel
,
R.
,
Grzelczak
,
Z.
,
Zielenski
,
J.
,
Lok
,
S.
,
Plavsic
,
N.
,
Chou
,
J-L.
,
Drumm
,
M. L.
,
Iannuzzi
,
M. C.
,
Collins
,
F. S.
and
Tsui
,
L. C.
(
1989
).
Identification of the cystic fibrosis gene: cloning and characterisation of complementary DNA
.
Science
245
,
1066
1073
.
Rommens
,
J. M.
,
Iannuzzi
,
M. C.
,
Kerem
,
B-S.
,
Drumm
,
M. L.
,
Melmer
,
G.
,
Dean
,
N.
,
Zsiga
,
M.
,
Buchwald
,
M.
,
Riordan
,
J. R.
,
Tsui
,
L-C.
and
Collins
,
F. S.
(
1989
).
Identification of the cystic fibrosis gene: chromosome walking and jumping
.
Science
245
,
1059
1065
.
Saiki
,
R. K.
,
Gelfand
,
D. H.
,
Stoffel
,
S.
,
Scharf
,
S. J.
,
Higuchi
,
R.
,
Horn
,
G. T.
,
Mullis
,
K. B.
and
Erlich
,
H. A.
(
1988
).
Primer-direct enzymatic amplification of DNA with a thermostable DNA polymerase
.
Science
239
,
487
491
.
Sato
,
K.
and
Sato
,
F.
(
1984
).
Defective beta-adrenergic response of cystic fibrosis sweat glands in vivo and in vitro
.
J. clin. Invest
.
73
,
1763
1771
.
Schoumacher
,
R. A.
,
Shoemaker
,
R. L.
,
Halm
,
D. R.
,
Tallant
,
E. A.
,
Wallace
,
R. W.
and
Frizzell
,
R. A.
(
1987
).
Phosphorylation fails to activate chloride channels from cystic fibrosis airway cells
.
Nature
330
,
752
754
.
Welsh
,
M. J.
(
1986
).
An apical-membrane chloride channel in human tracheal epithelium
.
Science
232
,
355
364
.
Welsh
,
M. J.
and
Liedtke
,
C. M.
(
1986
).
Chloride and potassium channels in cystic fibrosis airway epithelia
.
Nature
322
,
467
470
.
Widdicombe
,
J. H.
,
Welsh
,
M. J.
and
Finkbeiner
,
W. E.
(
1985
).
Cystic fibrosis decreases the apical membrane chloride permeability of monolayers cultured from cells of tracheal epithelium
.
Proc. natn. Acad. Sci. U.S.A
.
82
,
6167
6171
.