Chika Yokota, Matt Kofron, Mike Zuck, Douglas W. Houston, Harry Isaacs,Makoto Asashima, Chris C. Wylie and Janet Heasman Development130, 2199-2212.
On p. 2200, the sequence of Xnr3 morpholino oligo is incorrect. The correct sequence is 5′TCTCTGGGTAGATTTGTGGTGACTC 3′.
The authors apologise to readers for this mistake.
You do not currently have access to this content.