Influences of lamin A levels on induction of pluripotent stem cells

Lamin A encoded by the LMNA gene is a major nuclear architectural protein important for maintaining nuclear membrane inner structure integrity and function (Dechat et al., 2008). Lamin A is involved in regulation of gene expression in health and disease through interplay with cell cycle progression, DNA replication, signal transduction pathways, transcription factors, chromatin-associated proteins and tissue homeostasis (Andrés and González, 2009; Broers et al., 2006; Naetar and Foisner, 2009). Dysfunction of lamin A triggers DNA damage response, cellular senescence or apoptosis (Bridger and Kill, 2004; Lees-Miller, 2006; Musich and Zou, 2009). LMNA mutations cause a variety of human diseases termed laminopathies, including progeroid syndromes and premature-ageing disorders, e.g. Hutchinson-Gilford Progeria Syndrome (HGPS) (Andrés and González, 2009; Csoka et al., 2004; Decker et al., 2009; Naetar and Foisner, 2009; Scaffidi and Misteli, 2008). A-type lamins are regarded as intrinsic modulators of ageing within adult stem cells and their niches that are essential for survival to old age (Pekovic and Hutchison, 2008). Increased expression of HGPS truncated lamin A transcript accelerates a subset of the pathological changes that contribute to aging processes (Burtner and Kennedy, 2010; Rodriguez et al., 2009). Notably, mice carrying lamin A mutation also display defects consistent with HGPS (Mounkes et al., 2003).

Lamin A also may control the onset of aging-associated decline in normal fibroblasts (Kudlow and Kennedy, 2006). Increased levels of wild-type lamin A in normal human cells result in decreased replicative lifespan and nuclear membrane alterations that lead to apoptotic cell death and senescence in a manner that is strongly reminiscent of the phenotype shown by HGPS cells and that are also observed in cells from old-age individuals (Candelario et al., 2008), suggesting that the elevated levels of lamin A are associated with aging. Modeling of premature ageing syndromes by generation of induced pluripotent stem (iPS) cells from HGPS patients (Ho et al., 2011; Liu et al., 2011a; Liu et al., 2011b; Zhang et al., 2011), and from patients with dyskeratosis congenita (Agarwal and Daley, 2011; Agarwal et al., 2010), could provide in vitro model to understand the mechanisms of development of diseases and aging processes and help developing novel therapeutic drugs for interference of diseases.

During development, A-type lamins do not appear until midway through embryonic development, suggesting that these proteins may be involved in the regulation of terminal differentiation (Röber et al., 1989). In adult tissues, expression of lamin A differs at different stages of cell differentiation, and plays critical roles in transcriptional activation of genes important for differentiation (Peric-Hupkes et al., 2010; Stewart and Burke, 1987; Takamori et al., 2007). Moreover, mice lacking A-type lamins develop to term without overt abnormalities (Sullivan et al., 1999), indicating that lamin A deficiency itself does not negatively affect embryonic development and differentiation during fetal development. However, A-type lamins are required for postnatal growth and the maintenance of quiescence and differentiation (Pekovic and Hutchison, 2008; Sullivan et al., 1999). Pluripotent embryonic stem (ES) cells generated from preimplantation embryos maintain unlimited self-renewal and undifferentiated states, yet do not express lamin A in the nuclear envelope (Bru et al., 2008; Butler et al., 2009; Constantinescu et al., 2006). Absence of lamin A in ES cells and strong expression of lamin A in the nuclear envelope of somatic cells may allow distinguishing pluripotent stem cells from differentiated cells.

While stemness facilitates reprogramming, as shown by more efficient reprogramming of progenitor stem cells to iPS cells than of differentiated cells (Eminli et al., 2009), cell senescence impairs reprogramming to pluripotency in iPS induction (Banito et al., 2009). Recently, iPS cells have been generated from HGPS patients (Ho et al., 2011; Liu et al., 2011a; Liu et al., 2011b; Zhang et al., 2011). Whether levels of lamin A in somatic cells influence reprogramming efficiency of iPS induction has not been directly addressed. Also, it remains unclear whether mouse cells show efficient reprogramming of lamin A during iPS induction to become silenced, like ES cells. We tested the hypothesis that levels of lamin A in somatic cells influence reprogramming and pluripotency. Minimizing levels of lamin A might enhance iPS cell induction.

Lamin A was highly expressed in the nuclear membrane of adult mouse tail-tip fibroblasts (TTF) that showed absent Oct4 expression, whereas Oct4 was specifically expressed in the nuclei of ES cells that showed no visible expression of lamin A in the nuclear membrane (Fig. 1A). Lamin A also may control the onset of aging-associated decline in normal human fibroblasts, and increased levels of wild-type lamin A lead to apoptotic cell death and senescence (Candelario et al., 2008; Kudlow and Kennedy, 2006). Levels of lamin A also may link to differentiation of stem cells (Pekovic and Hutchison, 2008; Sullivan et al., 1999). We further assessed the lamin A expression in various cell types from various ages of C57BL/6 mice, and also compared with that of ES cells served as negative controls. J1 ES was used as controls because they were maintained as undifferentiated state without mouse embryonic fibroblasts (MEF) feeders to eliminate the feeder cell contamination that complicates lamin A quantification. MEFs as feeders showed high expression of lamin A. Consistent with immunostaining data, lamin A was at minimal or undetectable level in ES cells, whereas lamin A was at high levels in somatic cells (Fig. 1B,C). Moreover, levels of lamin A were higher in differentiated adult somatic cells TTF from older mice (8 months of age) than in TTF from younger mice and at earlier passages. MEFs showed lower levels of lamin A than those of TTF, and mesenchymal stem cells (MSCs) at P1 expressed much lower levels of lamin A than other somatic cells (Fig. 1C). The mRNA levels of lamin A generally corresponded to the protein levels by Western blot analysis (Fig. 1D). By relative quantification using β-actin as internal loading reference and Bio-rad software, the protein levels of lamin A in MEFs were higher than those of MSCs and lower than those of TTFs at early passages. Together, aging somatic cells express higher levels of lamin A, whereas younger cells at early passages show lower levels of lamin A, suggesting that reduced levels of lamin A are associated with the youth and stemness.

We sought to test whether expression levels of lamin A influence reprogramming efficiency of fibroblasts to iPS cells. We have shown that MSCs generated iPS cells with high efficiency (Fan et al., 2011). Here, MEFs and TTF from young and older mice isolated from C57BL/6 with three different expression levels of lamin A were chosen for iPS induction by transfection of Yamanaka factors (Okita et al., 2007) (see Materials and Methods). During iPS induction, cells began to aggregate by day 3, and MEFs formed colony aggregates as early as day 6, but TTF from 8 month old mice did not (Fig. 2A), suggesting earlier reprogramming of MEFs in contrast to slower processes of iPS-like primary clone formation from TTF particularly from older mice. Consistently, MEFs gave rise to alkaline phosphatase (AP) positive iPS-like colonies at higher frequency than did TTFs, and TTF from 4 week old mice generated more iPS-like clones than did TTF from 8 month old mice (Fig. 2B). These data suggest that cells with elevated expression levels of lamin A show slower processes and reduced efficiency in iPS induction. We recently examined dynamics of expression of pluripotent genes Nanog, Oct4 and telomerase genes Tert and Terc during induction of iPS cells from TTFs and found that these genes gradually activated, but Terc activated earlier than endogenous Oct4 and Nanog (Wang et al., 2012). Also, MEFs showed increased expression of endogenous pluripotent genes Nanog and Oct4 and telomerase genes, particularly Terc during iPS induction (Fig. 2C). Under the same culture and induction condition, TTFs from 8 week old mice showed dynamic expression of Nanog, Oct4, Tert and Terc during reprogramming. Interestingly, the expression of these genes also increased but to less extent during iPS induction from TTFs, compare to those of MEFs. We speculate that higher levels of lamin A in TTFs may negatively affect expression of pluripotent genes, and slow down progress of iPS induction.

We further tested whether reduced levels of lamin A by RNA interference directly influence efficiency of iPS induction. Levels of lamin A in C57BL/6 MEFs was effectively reduced to about 20% of the control lamin A by retrovirus-mediated lamin A shRNA interference (pSIREN-RetroQ-laminA-shRNA) in two independent experiments (Fig. 3A–D). MEFs exhibited normal morphology 48 h after RNA interference (Fig. 3A). Efficient knockdown of lamin A at 48 h by lamin A shRNA was characterized by immunofluorescence microscopy (Fig. 3B), and verified by quantitative PCR and western blot analysis (Fig. 3C,D). Lamin A-RNAi MEFs showed lower levels of lamin A than those of control-RNAi MEFs.

MEFs tended to undergo cell senescence after only a few passages in culture, such that we were unable to obtain stable MEF lines with depleted lamin A by RNAi for iPS cell induction. Thus, MEFs with reduced levels of lamin A at 48 h following shRNA of lamin A were used for induction of iPS cells, and compared directly with those of control shRNA. Dynamic changes in morphology of MEFs occurred and Nanog GFP expressed also earlier in lamin A knockdown MEFs following transfection of Yamanaka factors, compared to shRNA controls. Compact iPS-like colonies with clear boundary formed by day 12 in the lamin A knockdown MEFs, in contrast to loosened cell aggregates in the control MEFs (Fig. 3E). Likewise, Nanog GFP of lamin A knockdown MEFs appeared as early as day 9 and more evident at day 12, whereas control RNAi MEFs showed no obvious expression of GFP at day 12. These data show that reduced levels of lamin A by shRNA accelerate the iPS colony formation. By continuous culture without pick up of the colonies, about 3–4 fold increases in Nanog-GFP clones with brighter GFP fluorescence were found in lamin A knockdown MEFs at day 15, compared to control MEFs (Fig. 3F). Consistently, the percentage of Nanog- GFP-positive cells by flow cytometry analysis doubled from day 9 to day 12 during iPS induction following lamin A knockdown, compared to controls (Fig. 3G), indicating increased efficiency of reprogramming by RNAi for lamin A. Early formation and increased frequency of iPS-like clones by lamin A knockdown suggests that reduced levels of lamin A facilitates reprogramming processes of iPS induction.

By immunofluorescence microscopy, fewer MEFs showed expression of lamin A during reprogramming by lamin A-shRNA than those of controls (Fig. 4A). Real-time PCR analysis confirmed that expression levels of lamin A in lamin A-shRNA MEFs were much lower than those of controls during iPS induction (Fig. 4B). Expression of endogenous pluripotent genes Nanog, Oct4 and Essrb was increased in subpopulations of MEFs during iPS induction, and lamin A-shRNA MEFs showed even higher increased levels of Nanog and Essrb (about 2 fold) and Oct4 (about 3 fold) by day 12, compared to controls (Fig. 4B). The difference at day 12 may reflect a role for lamin A in expansion of iPS cells, but not the early reprogramming process per se. In general, expression of Tert and Terc was increased during iPS induction and these increases were not apparently affected by lamin A-shRNA. These data show that reduced levels of lamin A facilitate iPS cell production, coincided with increased expression of endogenous pluripotent genes.

Further, iPS cell lines generated from lamin A knockdown MEFs exhibited morphology typical ES cell colonies, and resembled iPS cells induced from control RNAi MEFs (Fig. 5A). Regardless of lamin A depletion, the formed iPS cells at early passage were negative for lamin A by immunostaining but positive for pluripotent markers, Oct4, Nanog and SSEA1. Like control iPS cells, Lamin A-RNAi iPS cells exhibited active and repressive histone methylation patterns shown by immunostaining of H3K4me3 and H3K9me3/H3K27me3 (Fig. 5B). It seemed, however, that the levels of H3K9me3 and H3K27me3 marks associated with gene silencing were decreased, whereas Oct4, Nanog and SSEA1 immunofluorescence increased in iPS cells after lamin A RNAi. More than 70% of lamin A-RNAi iPS cells had normal karyotype of 40 chromosomes, similar to control-RNAi iPS cells (Fig. 5C). Also, their telomere lengths estimated by T/S ratio did not differ between Lamin A-RNAi and control iPS cells (Fig. 5D). Overall, early passage iPS cells derived from lamin A-depleted MEFs show chromosome stability and express markers for pluripotency, like ES cells.

Next, we tested whether overexpression of lamin A retards dynamics of reprogramming to iPS cells. Nanog-GFP MEFs overexpressing lamin A and control MEFs transfected with mock vectors were induced to iPS in KSR based induction media. During our independent experiments, we found that iPS induction in FBS based media was slower than in KSR based media (data not shown), consistent with recent report (Okada et al., 2010). The cell aggregates were visible in the control MEFs by day 6 of induction and the primary clones formed around day 10, whereas MEFs overexpressing lamin A slowly formed aggregations by day 10 (Fig. 6A,B). By day 12, ES-like primary iPS-like clones with Nanog GFP fluorescence were formed in the control MEFs. In contrast, Nanog-GFP fluorescence was not visible in iPS-like primary clones that also formed in lamin A overexpression MEFs. Consistently, the percentage of Nanog- GFP-positive cells by flow cytometry analysis was decreased 2–3 fold by day 12 during iPS induction in lamin A overexpression MEFs, compared to controls (Fig. 6C), showing that lamin A overexpression indeed reduces reprogramming efficiency. These data suggest that cells with higher levels of lamin A could be induced to form iPS-like clones but at lower pace and quality.

Expression levels of lamin A in ES or iPS cells are very low, and these cells do not show lamin A immunostaining in the nuclear membrane, whereas somatic cells (mouse fetal fibroblasts and adult fibroblasts) express high levels of lamin A, and the levels of lamin A increase with cell senescence during passages and with organism age, consistent with previous findings (Candelario et al., 2008; Kudlow and Kennedy, 2006). MSCs show reduced expression of lamin A but somatic fibroblasts from older mice increased levels of lamin A. This is consistent with a previous report that lamins A/C are not or only marginally present in the somatic stem cells or progenitor stem cells (Takamori et al., 2007). Misregulation of lamin A of adult stem cells is associated with accelerated ageing (Scaffidi and Misteli, 2008). Low levels of lamin A are associated with higher potential of proliferation and differentiation capacity. High expression of lamin A in somatic cells is reduced to minimal levels during reprogramming to iPS cells. Consistently, lamin A/C found only in differentiated cells is also removed from their nuclei by exposure of the somatic cells to ES cell extracts, and reprogramming of gene expression for pluripotency is induced (Bru et al., 2008). Differential expression of lamin A in somatic cells versus pluripotent stem cells might suggest function of lamin A in differentiated cells quite different from that of iPS/ES cells.

High levels of lamin A in TTF from older mice lead to slower dynamics of reprogramming and reduced rates of iPS-like colony formation. Lamin A reduction by shRNA enhances early reprogramming of iPS cell induction.

Absence of A-type lamin expression is identified as a novel marker for undifferentiated ES cells (Constantinescu et al., 2006). Increased levels of lamin A and reduced expression of pluripotent genes are essential for ES cell differentiation. By contrast, depletion of lamin A by RNAi leads to earlier activation of Nanog and Oct4, facilitating reprogramming. Lamin A might directly inhibit activation of pluripotent genes and telomerase genes or indirectly influence their expression by Wnt signaling or other pathways. Critical amount of Oct4 and Nanog is required to sustain stem-cell self-renewal and undifferentiated states; either high or low expression of the genes leads to differentiation of ES cells (Chambers et al., 2007; Niwa et al., 2000). It is likely that lamin A negatively regulates expression of pluripotent genes, activating expression of genes for differentiation, but this speculation requires further experimentation to validate.

Indeed, high resolution maps of genome-nuclear lamina interactions reveal that expression of pluripotent genes Oct4, Nanog and several others depends on their spatial distribution relative to nuclear lamina (Peric-Hupkes et al., 2010). Nuclear lamina seems to repress their activation when they locate closely to the lamina as seen in differentiated cells, while this repression is removed when these genes move away from nuclear lamina presumably in undifferentiated ES cells, consistent with high levels of Oct4 and Nanog in ES cells. Depletion of lamin A in the nuclear lamina of ES cells might link to the desuppression of Oct4 and Nanog and other genes associated with stemness. Mechanisms underlying the dynamics and their relationships of lamin A and pluripotent genes and telomerase genes remain further investigation.

Lamin A deficiency abrogates telomere integrity and leads to telomere shortening in differentiated somatic cells (De Vos et al., 2010; Gonzalez-Suarez et al., 2009; Uhlírová et al., 2010), in association with defective membrane structure (Shimi et al., 2008). Also, fibroblasts from premature aging HGPS patients exhibit shorter telomeres than those of age-matched controls (Decker et al., 2009). We were concerned about whether telomeres were shortened by lamin A depletion during iPS cell induction. Intriguingly, like ES cells, iPS cells express no or minimal lamin A which is invisible in the nuclear envelope, yet they do not show shortened, but instead elongated telomeres, compared to progenitor fibroblasts (Agarwal et al., 2010; Huang et al., 2011; Wang et al., 2012; Marion et al., 2009). Thus, it is not surprising that reduction of lamin A by shRNA also does not shorten the telomeres of iPS cells. Instead, lack of lamin A may facilitate telomere elongation in pluripotent stem cells. Lamina-associated domains represent a strongly repressive chromatin environment enriched by H3K9me2, H3K9me3 and H3K27me3, and restrict movement and expression of genes nearby (Guelen et al., 2008; Peric-Hupkes et al., 2010; Wen et al., 2009). Repressive lysine methylated histones negatively regulate telomere lengths likely by controlling telomere recombination (Benetti et al., 2007; Blasco, 2007). Sufficient telomere lengths are required to maintain chromosomal stability and pluripotency of ES/iPS cells (Huang et al., 2011). We extend the observations by generation of iPS cells, and further speculate that lamin A depletion in the nuclear envelope might facilitate movement of telomeres, accessible for telomere elongation associated proteins, as well as amenable for recombination to elongate telomeres, essential for maintenance of pluripotency of iPS/ES cells.

Successful generation and characterization of iPS cells from HGPS fibroblasts have been recently reported (Liu et al., 2011a; Liu et al., 2011b; Zhang et al., 2011). Remarkably, progerin expression and senescence phenotypes are lost in iPS cells but not in differentiated progeny. These new HGPS iPS cells are valuable for characterizing the role of progerin in driving HGPS and aging and for screening therapeutic strategies to prevent or delay cell senescence (Niedernhofer et al., 2011). A synergistic relationship between telomere dysfunction and progerin production may participate in the induction of cell senescence and normal aging process (Cao et al., 2011). Telomere length can be reset during induction of iPS from DKC patients (Agarwal and Daley, 2011). It would be interesting to know the telomere states during reprogramming to iPS cells from HGPS patients.

Together, levels of lamin A influence reprogramming and pluripotency. High levels of lamin A in differentiated cells or overexpression of lamin A retards iPS cell induction. On the contrary, lower levels of lamin A or depletion of lamin A by RNAi accelerate iPS cell formation. Human fibroblasts overexpressing lamin A exhibit accelerated telomere shortening and rapid replicative senescence and progroid phenotypes (Huang et al., 2008). Lamin A is involved in premature aging and also normal physiological aging (Kudlow and Kennedy, 2006; Scaffidi and Misteli, 2006). Generation of iPS cells by depletion of lamin A may enhance effectiveness in the processes of reversing cellular aging from older patients or premature aging patients and have implications in potential stem cell therapy.

MEFs were derived from E13.5 embryos from C57BL/6J mice isolated by caesarean section and washed in HBSS. Heads and visceral tissues were removed, and remaining tissue was washed in fresh PBS, then submerged in 0.05 mM trypsin/1 mM EDTA HBSS solution and incubated at 37°C for 10 min. Tissue was pipetted repeatedly to aid in tissue dissociation, then added to MEF media containing 10% FBS and plated (passage 0). Isolation of TTFs and MSCs was performed as described, respectively (Fan et al., 2011; Huang et al., 2011; Liu et al., 2004). The tails from adult mice were peeled, briefly rinsed with 70% ethanol, minced into 1×1 mm³ pieces, placed onto culture dishes, and incubated for 7 days in MEF medium (DMEM containing 10% FBS). Cells that migrated out of the grafted pieces were transferred to new plates and maintained in MEF medium.

Derivation of iPS cells from TTFs or MEFs has been described previously (Huang et al., 2011; Wang et al., 2012). iPS cells were induced by transduction with four Yamanaka factors using standard protocol (Okita et al., 2007), with slight modification on induction media for some experiments. The day before transduction, Plat-E cells were seeded at 5×10⁶ cells per 100 mm dish. On the next day, pMXs-based retroviral vectors (pMXs-Sox2, Klf4, Oct4, c-Myc) were introduced into Plat-E cells using lipo-2000 transfection reagent according to the manufacturer's recommendations. Infection cells were replated in 10 ml ES cell medium containing knock-out DMEM medium (Invitrogen), added with 20% FBS or 20% KSR, 1000 U/ml LIF, 0.1 mM β-mercaptoethanol, 1 mM L-glutamine and 0.1 mM non-essential amino acids, and antibiotics. Six days after infection, the cells were passaged on MEF feeders and the medium was changed every day. Twelve or 13 days after infection, ES-like colonies were picked and passaged using standard protocols. For alkaline phosphatase (AP) assay, 10,000 cells were plated in a 6-well plate, and the formed colonies assessed using the Vector blue kit from Vector Laboratories (USA).

N33 ES cell lines as control were derived from C57BL/6J mice (Huang et al., 2011). The ES cell culture medium consisted of knock-out DMEM added with 15% (J1 ES) or 20% FBS (N33ES), 1000 U/ml leukemia inhibitory factor (LIF) (ESGRO, Chemicon), 0.1 mM non-essential amino acids, 0.1 mM β-mercaptoethanol, 1 mM L-glutamine, and penicillin (100 U/ml) and streptomycin (100 µg/ml). The medium was changed daily and cells were routinely passaged every 2 days.

Immunofluorescence staining was performed as described (Huang et al., 2011). Cells were washed twice in phosphate buffered saline (PBS), then fixed in freshly prepared 3.7% paraformaldehyde in PBS (pH 7.4), permeabilized in 0.1% Triton X-100 in blocking solution (3% goat serum in PBS) for 30 min, washed three times, and left in blocking solution for 1 h. Cells were incubated overnight at 4°C with primary antibodies against Lamin A (Abcam, ab26300), Oct4 (sc5279, Santa Cruz, CA), Nanog (Abcam, ab10626), SSEA-1 (DSHB, MC-480), H3K4 (Abcam, ab1012), and H3K9 (Millipore, 07212), washed three times, and incubated for 2 h with secondary antibodies at RT, Alexa Fluor 488 goat anti-mouse (MP, A-11001), Alexa Fluor 568 goat anti-rabbit (MP, A-11011), diluted 1:200 with blocking solution. Samples were washed, and counterstained with 0.5 µg/ml Hochest33342 (MP, H1398) or DAPI in Vectashield mounting medium. Fluorescence was detected and imaged using a Leica inverted fluorescence microscope.

Cells were washed twice in PBS, collected, and lysed in SDS Sample Buffer at 99°C for 5 min; 25 µg total proteins of each cell extracts were resolved by 10–12% Bis-Tris SDS-PAGE and transferred to polyvinylidine difluoride membranes (PVDF, Millipore). Non-specific binding was blocked by overnight incubation in 5% skin milk in TBS at 4°C. Blots were then probed for 1–2 h at room temperature with anti-laminA (Rabbit polyclonal; Abcam, ab26300), anti-β-actin (Rabbit polyclonal; Santa Cruz, sc1616R). Immunoreactive bands were then probed for 1–2 h at room temperature with the appropriate horseradish peroxidase-conjugated secondary anti-Rabbit IgG -HRP (GE Healthcare 371624). Protein bands were detected by Enhanced ECL AmershamTM prime western blotting detection reagent (GE Healthcare RPN2232).

Total RNA was purified using a RNA mini kit (QIAGEN), treated with DNase I (Ambion), and the cDNA was generated from 0.2 µg RNA using random primers and SuperScript II (Invitrogen). Primers (supplementary material Table S1) were confirmed their specificity with dissociation curves. All data are normalized using β-actin as internal control. Quantitative real-time PCR was carried out on a MyiQ Detection system (BIO-RAD, USA) using SYBR Green I PCR Master Mix (TOYOBOL, JPN). For the analysis, all reactions (in triplicate) were carried out by amplifying target genes and endogenous controls in the same plate. The amplification was performed for primary denaturation at 95°C for 1 min, then 40 cycles of denaturation at 95°C for 15 s, annealing at 58°C for 10 s and elongation at 72°C for 15 s, and the last cycle under 55–95°C for dissociation curve. Relative quantitative evaluation of target gene was determined by comparing the threshold cycles.

After initial test of four different shRNA designs against lamin A mRNA, the following shRNA sequence (19-nucleotide linker sense oligonucleotides, a hairpin loop, and an antisense of 19-nucleotide sense sequence, and an antisense of the linker) was used for the following experiment:

forward, GATCCGGAGCTTGACTTCCAGAAGTTCAAGAGACTTCTGGAAGTCAAGCTCCTTTTTTAAGCTTG; reverse, AATTCAAGCTTAAAAAAGGAGCTTGACTTCCAGAAGTCTCTTGAACTTCTGGAAGTCAAGCTCCG.

Control sequence:

forward, GATCCGGCGTTCAATTAGCAGACCATTCAAGAGATGGTCTGCTAATTGAACGCCTTTTTTAAGCTTG; reverse, AATTCAAGCTTAAAAAAGCGTTCAATTAGCAGACCATCTCTTGAATGGTCTGCTAATTGAACGCCG.

The shRNAs were cloned into pSITEN-RetroQ (Clontech), the resultant vector was transfected into Plat-E cells with lipofectamine 2000 according to the manufacturer's instruction to package, and corresponding retrovirus used to transfect C57BL/6 MEF as controls. C57BL/6 MEFs at same passages were transfected with lamin A shRNA and control shRNA virus enriched for 48 and 72 h, respectively. After each transfection with corresponding retrovirus, the media were changed to complete culture medium (ES media) at 8–12 h, and cells continued culture for 48 h, and were collected for immunostaining, western blot and real-time PCR analysis.

Average telomere length was measured from total genomic DNA using a real-time PCR assay, as previously described (Cawthon, 2002), but modified for measurement of mouse telomeres (Callicott and Womack, 2006; Huang et al., 2011). Cells were washed in PBS and stored at −20°C until subsequent DNA extraction. Genome DNA was prepared using DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA). Average telomere length was measured from total genomic DNA using a real-time PCR assay, as previously described, but modified for measurement of mouse telomeres. PCR reactions were performed on the iCycler iQ real-time PCR detection system (Bio-Rad, Hercules, CA), using telomeric primers, primers for the reference control gene (mouse 36B4 single copy gene) and PCR settings as previously described. For each PCR reaction, a standard curve was made by serial dilutions of known amounts of DNA. The telomere signal was normalized to the signal from the single copy gene to generate a T/S ratio indicative of relative telomere length. Equal amounts of DNA (20 ng) were used for each reaction, with at least three replicates for each specimen.

iPS cells were incubated with 0.5 µg/ml nocodazole for 1.5–2 h to arrest the cells in metaphase. The cells were exposed to hypotonic treatment with 75 mM KCl solution and fixed with methanol:glacial acetic acid (3:1) and spread onto clean slides.

The full length 1666 bp Lamina was amplified from mouse ES cDNA using TransStar Fastpfu (Transgene) and cloned into pCMV-Tag2B. For lamin A overexpression in iPS induction experiments, cells at the concentration of 5×10⁵ were transfected with the vectors using lipofectamine and 24 h later selected with 400 µg/ml G418 for 3 days. Samples were collected at 48 for analysis of efficiency of lamin A OE. Then, plates with the residual cells at 1×10⁵ were used for iPS induction by the method using pMXs-Sox2, Klf4, Oct4, c-Myc described above, except for that 20% FBS was replaced by KSR in the media, and cells at 1×10⁴ were plated on inactivated MEF feeders.

Flow cytometry analysis of the iPSCs were carried out using a BD LSR analyzer (BD Biosciences). The mean SSC-H was calculated by using CELLQuest Pro software. At least two independent pairs of Lmna knockdown or Lmna overexpression cells and controls were assayed to verify the percentage of GFP positive cells.

Percentages were transformed using arcsin transformation. Percentage transformed data and other number were analyzed by ANOVA and means compared by Fisher's protected least-significant difference (PLSD) using the StatView software from SAS Institute Inc. (Cary, NC). Linear relation analysis was performed using SigmaPlot 8.0. Significant differences were defined as P<0.05, 0.01 or lower.

We thank Minshu Li, Qian Zhang and Xiaoying Ye for help with the experiments. This work was supported by China MOST National Major Basic Research Program (2009CB941000, 2010CB94500). Author contributions: B.Z.: data collection, analysis and interpretation, manuscript writing; J.Y., F.W., L.W., Y.Y., J.D., N.L.: data collection and analysis. L.L.: conception and design, financial support, data interpretation, manuscript writing and final approval.